Contributors are those that engage in discussions in the context of the Genomic CDS ontology: Bob Freimuth, Michel Dumontier, Bob Powers, Simon Lin, Scott Marshall, Joanne Luciano, Richard Boyce, Eric Prud'Hommeaux Matthias Samwald, http://samwald.info/ Creative Commons 3.0 CC-by license If you want to contribute or report a bug, please write an e-mail to Matthias Samwald, samwald@gmx.at Pharmacogenomic Clinical Decision Support ontology ('Genomic CDS') 0.8.0 A clinical decision support message relevant for a patient belonging to this class. CDS message The orientation of the polymorphism in the corresponding dbSNP entry with respect to the reference genome. The value 'forward' means that the dbSNP entry uses the same orientation as the reference genome, the value 'reverse' means that the dbSNP entry uses the reverse orientation (i.e., the opposite strand of DNA). This information can be used for normalizing the orientation, and converting sequences from one strand to the other. All polymorphisms and sequences in the Genomic CDS ontology are reported using the forward orientation of the reference genome (the 'plus' strand). dbSNP orientation on reference genome A generic property, stating that one entitiy is relevant in the context of obersving some other entity. For example, it can be used to state that a specific classification of a patient is relevant for dosing a specific drug. relevant for The RS identifier of a corresponding entry in the NCBI dbSNP database. rsid symbol of associated gene A generic property. For example, it can be used to relate a patient with specific attributes and features, such as genetic polymorphisms, alleles and phenotypes. has A property used for reasoning about possible alleles given a set of polymorphism variants. If a specific polymorphism variant is 'taken by' a specific allele, it cannot be used for calling another allele. taken by ABCB1 ABCB1 ABCB1_star_1 ABCB1 *1 ABCB1_star_13 ABCB1 *13 ABCB1_star_13__per_Kroetz_et_al._2003__PMID__12893986__ ABCB1 *13 (per Kroetz et al. 2003 [PMID: 12893986]) ABCB1_star_2__per_Kim_et_al._2001__PMID__11503014__ ABCB1 *2 (per Kim et al. 2001 [PMID: 11503014]) ABCB1_star_2__per_Kroetz_et_al._2003__PMID__12893986__ ABCB1 *2 (per Kroetz et al. 2003 [PMID: 12893986]) ABCC2 ABCC2 ABCG2 ABCG2 ACE ACE ADRB1 ADRB1 ADRB1_H1 ADRB1 H1 ADRB1_H2 ADRB1 H2 ADRB1_H3 ADRB1 H3 ADRB2 ADRB2 AHR AHR ALOX5 ALOX5 ANKK1 ANKK1 Azathioprine An immunosuppressive pro-drug. It is converted into 6-mercaptopurine in the body where it blocks purine metabolism and DNA synthesis. [Adapted from PubChem and DrugBank] Azathioprine BRCA1 BRCA1 BRCA1_1 BRCA1 1 BRCA1_10 BRCA1 10 BRCA1_1_hash BRCA1 1# BRCA1_2 BRCA1 2 BRCA1_2_hash BRCA1 2# BRCA1_3 BRCA1 3 BRCA1_3_hash BRCA1 3# BRCA1_4 BRCA1 4 BRCA1_4_hash BRCA1 4# BRCA1_5 BRCA1 5 BRCA1_5_hash BRCA1 5# BRCA1_6 BRCA1 6 BRCA1_7 BRCA1 7 BRCA1_8 BRCA1 8 BRCA1_9 BRCA1 9 C18orf56 C18orf56 COMT COMT COMT_Haplotype_high_activity COMT Haplotype high activity COMT_Haplotype_intermediate_activity COMT Haplotype intermediate activity COMT_Haplotype_low_activity COMT Haplotype low activity CYP1A1 CYP1A1 CYP1A2 CYP1A2 CYP1A2_star_1 CYP1A2 *1 CYP1A2_star_10 CYP1A2 *10 CYP1A2_star_11 CYP1A2 *11 CYP1A2_star_12 CYP1A2 *12 CYP1A2_star_13 CYP1A2 *13 CYP1A2_star_14 CYP1A2 *14 CYP1A2_star_15 CYP1A2 *15 CYP1A2_star_16 CYP1A2 *16 CYP1A2_star_17 CYP1A2 *17 CYP1A2_star_18 CYP1A2 *18 CYP1A2_star_19 CYP1A2 *19 CYP1A2_star_1A CYP1A2 *1A CYP1A2_star_1B CYP1A2 *1B CYP1A2_star_1C CYP1A2 *1C CYP1A2_star_1E CYP1A2 *1E CYP1A2_star_1F CYP1A2 *1F CYP1A2_star_1G CYP1A2 *1G CYP1A2_star_1H CYP1A2 *1H CYP1A2_star_1J CYP1A2 *1J CYP1A2_star_1K CYP1A2 *1K CYP1A2_star_2 CYP1A2 *2 CYP1A2_star_20 CYP1A2 *20 CYP1A2_star_21 CYP1A2 *21 CYP1A2_star_3 CYP1A2 *3 CYP1A2_star_4 CYP1A2 *4 CYP1A2_star_5 CYP1A2 *5 CYP1A2_star_6 CYP1A2 *6 CYP1A2_star_7 CYP1A2 *7 CYP1A2_star_8 CYP1A2 *8 CYP1A2_star_9 CYP1A2 *9 CYP2A6 CYP2A6 CYP2A6_star_1 CYP2A6 *1 CYP2A6_star_10 CYP2A6 *10 CYP2A6_star_11 CYP2A6 *11 CYP2A6_star_12 CYP2A6 *12 CYP2A6_star_12A CYP2A6 *12A CYP2A6_star_12B CYP2A6 *12B CYP2A6_star_12C CYP2A6 *12C CYP2A6_star_13 CYP2A6 *13 CYP2A6_star_14 CYP2A6 *14 CYP2A6_star_15 CYP2A6 *15 CYP2A6_star_16 CYP2A6 *16 CYP2A6_star_17 CYP2A6 *17 CYP2A6_star_18 CYP2A6 *18 CYP2A6_star_18A CYP2A6 *18A CYP2A6_star_18B CYP2A6 *18B CYP2A6_star_18C CYP2A6 *18C CYP2A6_star_19 CYP2A6 *19 CYP2A6_star_1A CYP2A6 *1A CYP2A6_star_1B1 CYP2A6 *1B1 CYP2A6_star_1B10 CYP2A6 *1B10 CYP2A6_star_1B11 CYP2A6 *1B11 CYP2A6_star_1B12 CYP2A6 *1B12 CYP2A6_star_1B13 CYP2A6 *1B13 CYP2A6_star_1B14 CYP2A6 *1B14 CYP2A6_star_1B15 CYP2A6 *1B15 CYP2A6_star_1B16 CYP2A6 *1B16 CYP2A6_star_1B17 CYP2A6 *1B17 CYP2A6_star_1B2 CYP2A6 *1B2 CYP2A6_star_1B3 CYP2A6 *1B3 CYP2A6_star_1B4 CYP2A6 *1B4 CYP2A6_star_1B5 CYP2A6 *1B5 CYP2A6_star_1B6 CYP2A6 *1B6 CYP2A6_star_1B7 CYP2A6 *1B7 CYP2A6_star_1B8 CYP2A6 *1B8 CYP2A6_star_1B9 CYP2A6 *1B9 CYP2A6_star_1C CYP2A6 *1C CYP2A6_star_1D CYP2A6 *1D CYP2A6_star_1E CYP2A6 *1E CYP2A6_star_1F CYP2A6 *1F CYP2A6_star_1G CYP2A6 *1G CYP2A6_star_1H CYP2A6 *1H CYP2A6_star_1J CYP2A6 *1J CYP2A6_star_1K CYP2A6 *1K CYP2A6_star_1L CYP2A6 *1L CYP2A6_star_1X2A CYP2A6 *1X2A CYP2A6_star_1X2B CYP2A6 *1X2B CYP2A6_star_2 CYP2A6 *2 CYP2A6_star_3 CYP2A6 *3 CYP2A6_star_5 CYP2A6 *5 CYP2A6_star_6 CYP2A6 *6 CYP2A6_star_7 CYP2A6 *7 CYP2A6_star_8 CYP2A6 *8 CYP2A6_star_9 CYP2A6 *9 CYP2A6_star_9A CYP2A6 *9A CYP2A6_star_9B CYP2A6 *9B CYP2B6 CYP2B6 CYP2B6_star_1 CYP2B6 *1 CYP2B6_star_10 CYP2B6 *10 CYP2B6_star_11 CYP2B6 *11 CYP2B6_star_11A CYP2B6 *11A CYP2B6_star_11B CYP2B6 *11B CYP2B6_star_12 CYP2B6 *12 CYP2B6_star_13 CYP2B6 *13 CYP2B6_star_13A CYP2B6 *13A CYP2B6_star_13B CYP2B6 *13B CYP2B6_star_14 CYP2B6 *14 CYP2B6_star_15 CYP2B6 *15 CYP2B6_star_15A CYP2B6 *15A CYP2B6_star_15B CYP2B6 *15B CYP2B6_star_16 CYP2B6 *16 CYP2B6_star_17 CYP2B6 *17 CYP2B6_star_17A CYP2B6 *17A CYP2B6_star_17B CYP2B6 *17B CYP2B6_star_18 CYP2B6 *18 CYP2B6_star_19 CYP2B6 *19 CYP2B6_star_1A CYP2B6 *1A CYP2B6_star_1B CYP2B6 *1B CYP2B6_star_1C CYP2B6 *1C CYP2B6_star_1D CYP2B6 *1D CYP2B6_star_1E CYP2B6 *1E CYP2B6_star_1F CYP2B6 *1F CYP2B6_star_1G CYP2B6 *1G CYP2B6_star_1H CYP2B6 *1H CYP2B6_star_1J CYP2B6 *1J CYP2B6_star_1K CYP2B6 *1K CYP2B6_star_1L CYP2B6 *1L CYP2B6_star_1M CYP2B6 *1M CYP2B6_star_1N CYP2B6 *1N CYP2B6_star_2 CYP2B6 *2 CYP2B6_star_20 CYP2B6 *20 CYP2B6_star_21 CYP2B6 *21 CYP2B6_star_22 CYP2B6 *22 CYP2B6_star_23 CYP2B6 *23 CYP2B6_star_24 CYP2B6 *24 CYP2B6_star_25 CYP2B6 *25 CYP2B6_star_26 CYP2B6 *26 CYP2B6_star_27 CYP2B6 *27 CYP2B6_star_28 CYP2B6 *28 CYP2B6_star_29 CYP2B6 *29 CYP2B6_star_2A CYP2B6 *2A CYP2B6_star_2B CYP2B6 *2B CYP2B6_star_3 CYP2B6 *3 CYP2B6_star_4 CYP2B6 *4 CYP2B6_star_4A CYP2B6 *4A CYP2B6_star_4B CYP2B6 *4B CYP2B6_star_4C CYP2B6 *4C CYP2B6_star_4D CYP2B6 *4D CYP2B6_star_5 CYP2B6 *5 CYP2B6_star_5A CYP2B6 *5A CYP2B6_star_5B CYP2B6 *5B CYP2B6_star_5C CYP2B6 *5C CYP2B6_star_6 CYP2B6 *6 CYP2B6_star_6A CYP2B6 *6A CYP2B6_star_6B CYP2B6 *6B CYP2B6_star_6C CYP2B6 *6C CYP2B6_star_7 CYP2B6 *7 CYP2B6_star_7A CYP2B6 *7A CYP2B6_star_7B CYP2B6 *7B CYP2B6_star_8 CYP2B6 *8 CYP2B6_star_9 CYP2B6 *9 CYP2C19 CYP2C19 CYP2C19_star_1 CYP2C19 *1 CYP2C19_star_10 CYP2C19 *10 CYP2C19_star_11 CYP2C19 *11 CYP2C19_star_12 CYP2C19 *12 CYP2C19_star_13 CYP2C19 *13 CYP2C19_star_14 CYP2C19 *14 CYP2C19_star_15 CYP2C19 *15 CYP2C19_star_16 CYP2C19 *16 CYP2C19_star_17 CYP2C19 *17 CYP2C19_star_18 CYP2C19 *18 CYP2C19_star_19 CYP2C19 *19 CYP2C19_star_1A CYP2C19 *1A CYP2C19_star_1B CYP2C19 *1B CYP2C19_star_1C CYP2C19 *1C CYP2C19_star_2 CYP2C19 *2 CYP2C19_star_22 CYP2C19 *22 CYP2C19_star_23 CYP2C19 *23 CYP2C19_star_24 CYP2C19 *24 CYP2C19_star_25 CYP2C19 *25 CYP2C19_star_26 CYP2C19 *26 CYP2C19_star_27 CYP2C19 *27 CYP2C19_star_2A CYP2C19 *2A CYP2C19_star_2B CYP2C19 *2B CYP2C19_star_2C CYP2C19 *2C CYP2C19_star_2D CYP2C19 *2D CYP2C19_star_3 CYP2C19 *3 CYP2C19_star_3A CYP2C19 *3A CYP2C19_star_3B CYP2C19 *3B CYP2C19_star_4 CYP2C19 *4 CYP2C19_star_4A CYP2C19 *4A CYP2C19_star_4B CYP2C19 *4B CYP2C19_star_5 CYP2C19 *5 CYP2C19_star_5A CYP2C19 *5A CYP2C19_star_5B CYP2C19 *5B CYP2C19_star_6 CYP2C19 *6 CYP2C19_star_7 CYP2C19 *7 CYP2C19_star_8 CYP2C19 *8 CYP2C19_star_9 CYP2C19 *9 CYP2C8 CYP2C8 CYP2C9 CYP2C9 CYP2C9_star_1 CYP2C9 *1 CYP2C9_star_10 CYP2C9 *10 CYP2C9_star_11 CYP2C9 *11 CYP2C9_star_12 CYP2C9 *12 CYP2C9_star_13 CYP2C9 *13 CYP2C9_star_14 CYP2C9 *14 CYP2C9_star_15 CYP2C9 *15 CYP2C9_star_16 CYP2C9 *16 CYP2C9_star_17 CYP2C9 *17 CYP2C9_star_18 CYP2C9 *18 CYP2C9_star_19 CYP2C9 *19 CYP2C9_star_2 CYP2C9 *2 CYP2C9_star_20 CYP2C9 *20 CYP2C9_star_21 CYP2C9 *21 CYP2C9_star_22 CYP2C9 *22 CYP2C9_star_23 CYP2C9 *23 CYP2C9_star_26 CYP2C9 *26 CYP2C9_star_27 CYP2C9 *27 CYP2C9_star_28 CYP2C9 *28 CYP2C9_star_29 CYP2C9 *29 CYP2C9_star_3 CYP2C9 *3 CYP2C9_star_30 CYP2C9 *30 CYP2C9_star_31 CYP2C9 *31 CYP2C9_star_32 CYP2C9 *32 CYP2C9_star_33 CYP2C9 *33 CYP2C9_star_34 CYP2C9 *34 CYP2C9_star_4 CYP2C9 *4 CYP2C9_star_5 CYP2C9 *5 CYP2C9_star_7 CYP2C9 *7 CYP2C9_star_8 CYP2C9 *8 CYP2C9_star_9 CYP2C9 *9 CYP2D6 CYP2D6 CYP2D6_star_1 CYP2D6 *1 CYP2D6_star_10 CYP2D6 *10 CYP2D6_star_17 CYP2D6 *17 CYP2D6_star_2 CYP2D6 *2 CYP2D6_star_29 CYP2D6 *29 CYP2D6_star_4 CYP2D6 *4 CYP2D6_star_41 CYP2D6 *41 CYP2J2 CYP2J2 CYP3A4 CYP3A4 CYP3A4_star_6 CYP3A4 *6 CYP3A5 CYP3A5 Clopidogrel Clopidogrel, an antiplatelet agent, is used to reduce atherosclerotic events such as myocardial infarction, stroke, and vascular death in patients who have had a recent stroke, recent MI, or have established peripheral vascular disease. [Adapted from PubChem and DrugBank] Clopidogrel DPYD DPYD DRD2 DRD2 ENOSF1 ENOSF1 F5 F5 FLOT1 FLOT1 G6PD G6PD G6PD_haplotype_A-_202A__376G G6PD haplotype A- 202A/ 376G G6PD_haplotype_A-_680T__376G G6PD haplotype A- 680T/ 376G G6PD_haplotype_A-_968C__376G G6PD haplotype A- 968C/ 376G G6PD_haplotype_B__wildtype_ G6PD haplotype B (wildtype) G6PD_haplotype_Mediterranean G6PD haplotype Mediterranean GSTP1 GSTP1 HCP5 HCP5 HMGCR HMGCR HMGCR_H2 HMGCR H2 HMGCR_H7 HMGCR H7 KCNH2 KCNH2 KCNJ11 KCNJ11 MED12L MED12L MTHFR MTHFR Mercaptopurine An antimetabolite antineoplastic agent with immunosuppressant properties. It interferes with nucleic acid synthesis by inhibiting purine metabolism and is used, usually in combination with other drugs, in the treatment of or in remission maintenance programs for leukemia. [Adapted from PubChem and DrugBank] Mercaptopurine NAT1 NAT1 NAT2 NAT2 NBR1 NBR1 NQO1 NQO1 NR1I2 NR1I2 P2RY1 P2RY1 P2RY12 P2RY12 P2RY12_H2 P2RY12 H2 PTGIS PTGIS PTGS2 PTGS2 SCN5A SCN5A SLC15A2 SLC15A2 SLC19A1 SLC19A1 SLC22A1 SLC22A1 SLC22A2 SLC22A2 SLC22A6 SLC22A6 SLCO1B1 SLCO1B1 SLCO1B3 SLCO1B3 SLCO2B1 SLCO2B1 SULT1A1 SULT1A1 SULT1A1_star_1 SULT1A1 *1 SULT1A1_star_2 SULT1A1 *2 SULT1A1_star_3 SULT1A1 *3 SULT1A1_star_5 SULT1A1 *5 Simvastatin A derivative of lovastatin and potent competitive inhibitor of 3-hydroxy-3-methylglutaryl coenzyme A reductase (hydroxymethylglutaryl COA reductases), which is the rate-limiting enzyme in cholesterol biosynthesis. It may also interfere with steroid hormone production. Due to the induction of hepatic LDL receptors, it increases breakdown of LDL cholesterol. [Adapted from PubChem and DrugBank] Simvastatin TPMT TPMT TPMT_star_1 TPMT *1 TPMT_star_10 TPMT *10 TPMT_star_11 TPMT *11 TPMT_star_12 TPMT *12 TPMT_star_13 TPMT *13 TPMT_star_14 TPMT *14 TPMT_star_15 TPMT *15 TPMT_star_16 TPMT *16 TPMT_star_17 TPMT *17 TPMT_star_18 TPMT *18 TPMT_star_2 TPMT *2 TPMT_star_20_PMID_16917910_ TPMT *20(PMID:16917910) TPMT_star_20_PMID_16946561_ TPMT *20(PMID:16946561) TPMT_star_21 TPMT *21 TPMT_star_22 TPMT *22 TPMT_star_23 TPMT *23 TPMT_star_24_PMID__18602085_ TPMT *24(PMID: 18602085) TPMT_star_24_PMID__18708949_ TPMT *24(PMID: 18708949) TPMT_star_25 TPMT *25 TPMT_star_3 TPMT *3 TPMT_star_3A TPMT *3A TPMT_star_3B TPMT *3B TPMT_star_3C TPMT *3C TPMT_star_3D TPMT *3D TPMT_star_4 TPMT *4 TPMT_star_5 TPMT *5 TPMT_star_6 TPMT *6 TPMT_star_7 TPMT *7 TPMT_star_8 TPMT *8 TPMT_star_9 TPMT *9 TYMS TYMS Thioguanine An antineoplastic compound which also has antimetabolite action. The drug is used in the therapy of acute leukemia. [Adapted from PubChem and DrugBank] Thioguanine UGT1A1 UGT1A1 UGT1A10 UGT1A10 UGT1A1_star_60 UGT1A1 *60 UGT1A1_star_60c UGT1A1 *60c UGT1A1_star_VIII UGT1A1 *VIII UGT1A3 UGT1A3 UGT1A4 UGT1A4 UGT1A5 UGT1A5 UGT1A6 UGT1A6 UGT1A7 UGT1A7 UGT1A8 UGT1A8 UGT1A9 UGT1A9 UGT2B15 UGT2B15 UGT2B7 UGT2B7 VKORC1 VKORC1 VKORC1_H1 VKORC1 H1 VKORC1_H2 VKORC1 H2 VKORC1_H3 VKORC1 H3 VKORC1_H4 VKORC1 H4 VKORC1_H5 VKORC1 H5 VKORC1_H6 VKORC1 H6 VKORC1_H7 VKORC1 H7 VKORC1_H8 VKORC1 H8 VKORC1_H9 VKORC1 H9 VKORC1_star_1 VKORC1 *1 VKORC1_star_2 VKORC1 *2 VKORC1_star_3 VKORC1 *3 VKORC1_star_4 VKORC1 *4 Warfarin An anticoagulant that acts by inhibiting the synthesis of vitamin K-dependent coagulation factors. Warfarin is indicated for the prophylaxis and/or treatment of venous thrombosis and its extension, pulmonary embolism, and atrial fibrillation with embolization. It is also used as an adjunct in the prophylaxis of systemic embolism after myocardial infarction. Warfarin is also used as a rodenticide. [Adapted from PubChem and DrugBank] Warfarin allele A specific variant of a gene, including the wild-type allele. Note that the Pharmacogenomc CDS ontology has no dedicated class for genes. Genes are considered as broad classes of alleles. Allele drug Drug 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 human Human human_triggering_CDS_rule Human triggering CDS rule 2 2 human_triggering_CDS_rule_1 5-7 mg warfarin per day should be considered as a starting dose range for a patient with this genotype according to the Warfarin drug label (Bristol-Myers Squibb). human triggering CDS rule 1 2 2 human_triggering_CDS_rule_10 3-4 mg warfarin per day should be considered as a starting dose range for a patient with this genotype according to the Warfarin drug label (Bristol-Myers Squibb). human triggering CDS rule 10 2 human_triggering_CDS_rule_11 3-4 mg warfarin per day should be considered as a starting dose range for a patient with this genotype according to the Warfarin drug label (Bristol-Myers Squibb). human triggering CDS rule 11 2 2 human_triggering_CDS_rule_12 0.5-2 mg warfarin per day should be considered as a starting dose range for a patient with this genotype according to the Warfarin drug label (Bristol-Myers Squibb). human triggering CDS rule 12 2 human_triggering_CDS_rule_13 3-4 mg warfarin per day should be considered as a starting dose range for a patient with this genotype according to the Warfarin drug label (Bristol-Myers Squibb). human triggering CDS rule 13 human_triggering_CDS_rule_14 0.5-2 mg warfarin per day should be considered as a starting dose range for a patient with this genotype according to the Warfarin drug label (Bristol-Myers Squibb). human triggering CDS rule 14 2 human_triggering_CDS_rule_15 0.5-2 mg warfarin per day should be considered as a starting dose range for a patient with this genotype according to the Warfarin drug label (Bristol-Myers Squibb). human triggering CDS rule 15 2 2 human_triggering_CDS_rule_16 0.5-2 mg warfarin per day should be considered as a starting dose range for a patient with this genotype according to the Warfarin drug label (Bristol-Myers Squibb). human triggering CDS rule 16 2 human_triggering_CDS_rule_17 0.5-2 mg warfarin per day should be considered as a starting dose range for a patient with this genotype according to the Warfarin drug label (Bristol-Myers Squibb). human triggering CDS rule 17 2 2 human_triggering_CDS_rule_18 0.5-2 mg warfarin per day should be considered as a starting dose range for a patient with this genotype according to the Warfarin drug label (Bristol-Myers Squibb). human triggering CDS rule 18 2 human_triggering_CDS_rule_19 Clopidogrel label-recommended dosage and administration human triggering CDS rule 19 2 human_triggering_CDS_rule_2 5-7 mg warfarin per day should be considered as a starting dose range for a patient with this genotype according to the Warfarin drug label (Bristol-Myers Squibb). human triggering CDS rule 2 human_triggering_CDS_rule_20 Prasugrel or other alternative therapy (if no contraindication) human triggering CDS rule 20 2 human_triggering_CDS_rule_21 Prasugrel or other alternative therapy (if no contraindication) human triggering CDS rule 21 2 human_triggering_CDS_rule_22 Poor metaboliser. Increased risk for reduced response to clopidogrel. Consider alternative drug. Prasugrel is not or to a much smaller extent metabolized by CYP2C19 but is associated with an increased bleeding risk compared to clopidogrel human triggering CDS rule 22 human_triggering_CDS_rule_23 Intermediate metaboliser. Increased risk for reduced response to clopidogrel. Consider alternative drug. Prasugrel is not or to a much smaller extent metabolized by CYP2C19 but is associated with an increased bleeding risk compared to clopidogrel human triggering CDS rule 23 2 human_triggering_CDS_rule_24 Ultrarapid metabolizer. No therapeutic dose recommendations available. human triggering CDS rule 24 2 human_triggering_CDS_rule_25 Start with normal starting dose (e.g., 2-3 mg/kg/d) and adjust doses of azathioprine based on disease-specific guidelines. Allow 2 weeks to reach steady state after each dose adjustment. human triggering CDS rule 25 human_triggering_CDS_rule_26 If disease treatment normally starts at the "full dose", consider starting at 30-70% of target dose (e.g., 1-1.5 mg/kg/d), and titrate based on tolerance. Allow 2-4 weeks to reach steady state after each dose adjustment. human triggering CDS rule 26 2 human_triggering_CDS_rule_27 Consider alternative agents. If using azathioprine start with drastically reduced doses (reduce daily dose by 10-fold and dose thrice weekly instead of daily) and adjust doses of azathioprine based on degree of myelosuppression and disease-specific guidelines. Allow 4-6 weeks to reach steady state after each dose adjustment. Azathioprine is the likely cause of myelosuppression. human triggering CDS rule 27 2 human_triggering_CDS_rule_28 Start with normal starting dose (e.g., 75 mg/m2/d or 1.5 mg/kg/d) and adjust doses of mercaptopurine (and of any other myelosuppressive therapy) without any special emphasis on mercaptopurine compared to other agents. Allow 2 weeks to reach steady state after each dose adjustment. human triggering CDS rule 28 human_triggering_CDS_rule_29 Start with reduced doses (start at 30-70% of full dose: e.g., at 50 mg/m2/d or 0.75 mg/kg/d) and adjust doses of MP based on degree of myelosuppression and disease-specific guidelines. Allow 2-4 weeks to reach steady state after each dose adjustment. In those who require a dosage reduction based on myelosuppression, the median dose may be ~40% lower (44 mg/m2) than that tolerated in wild-type patients (75 mg/m2). In setting of myelosuppression, and depending on other therapy, emphasis should be on reducing mercaptopurine over other agents. human triggering CDS rule 29 2 2 human_triggering_CDS_rule_3 3-4 mg warfarin per day should be considered as a starting dose range for a patient with this genotype according to the Warfarin drug label (Bristol-Myers Squibb). human triggering CDS rule 3 2 human_triggering_CDS_rule_30 For malignancy, start with drastically reduced doses (reduce daily dose by 10-fold and reduce frequency to thrice weekly instead of daily, e.g., 10 mg/m2/d given just 3 days/week) and adjust doses of MP based on degree of myelosuppression and disease-specific guidelines. Allow 4-6 weeks to reach steady state after each dose adjustment. In setting of myelosuppression, emphasis should be on reducing mercaptopurine over other agents. For nonmalignant conditions, consider alternative nonthiopurine immunosuppressant therapy. human triggering CDS rule 30 2 human_triggering_CDS_rule_31 Start with normal starting dose. Adjust doses of thioguanine and of other myelosuppressive therapy without any special emphasis on thioguanine . Allow 2 weeks to reach steady state after each dose adjustment. human triggering CDS rule 31 human_triggering_CDS_rule_32 Start with reduced doses (reduce by 30-50%) and adjust doses of thioguanine based on degree of myelosuppression and disease-specific guidelines. Allow 2-4 weeks to reach steady state after each dose adjustment. In setting of myelosuppression, and depending on other therapy, emphasis should be on reducing thioguanine over other agents. human triggering CDS rule 32 2 human_triggering_CDS_rule_33 Start with drastically reduced doses (reduce daily dose by 10-fold and dose thrice weekly instead of daily) and adjust doses of thioguanine based on degree of myelosuppression and disease-specific guidelines. Allow 4-6 weeks to reach steady state after each dose adjustment. In setting of myelosuppression, emphasis should be on reducing thioguanine over other agents. For nonmalignant conditions, consider alternative nonthiopurine immunosuppressant therapy. human triggering CDS rule 33 human_triggering_CDS_rule_34 Select alternative drug or reduce dose by 50%. Increase dose in response of hematologic monitoring and efficacy. human triggering CDS rule 34 2 human_triggering_CDS_rule_35 Select alternative drug or reduce dose by 90%. Increase dose in response of hematologic monitoring and efficacy. human triggering CDS rule 35 human_triggering_CDS_rule_36 Select alternative drug or reduce dose by 50%. Increase dose in response of hematologic monitoring and efficacy. human triggering CDS rule 36 2 human_triggering_CDS_rule_37 Select alternative drug or reduce dose by 90%. Increase dose in response of hematologic monitoring and efficacy. human triggering CDS rule 37 human_triggering_CDS_rule_38 Select alternative drug. Insufficient data to allow calculation of dose adjustment. human triggering CDS rule 38 2 human_triggering_CDS_rule_39 Select alternative drug. Insufficient data to allow calculation of dose adjustment. human triggering CDS rule 39 2 human_triggering_CDS_rule_4 5-7 mg warfarin per day should be considered as a starting dose range for a patient with this genotype according to the Warfarin drug label (Bristol-Myers Squibb). human triggering CDS rule 4 2 human_triggering_CDS_rule_47 Normal myopathy risk. FDA recommends against 80 mg (unless already tolerated 12 months). Prescribe desired starting dose and adjust doses of simvastatin based on disease-specific guidelines. human triggering CDS rule 47 human_triggering_CDS_rule_48 Intermediate myopathy risk. FDA recommends against 80 mg. Consider a lower dose; if suboptimal efficacy, consider an alternative statin. human triggering CDS rule 48 2 human_triggering_CDS_rule_49 High myopathy risk. FDA recommends against 80 mg. Prescribe a lower dose or consider an alternative statin; consider routine creatine kinase (CK) surveillance. human triggering CDS rule 49 human_triggering_CDS_rule_5 3-4 mg warfarin per day should be considered as a starting dose range for a patient with this genotype according to the Warfarin drug label (Bristol-Myers Squibb). human triggering CDS rule 5 2 human_triggering_CDS_rule_6 3-4 mg warfarin per day should be considered as a starting dose range for a patient with this genotype according to the Warfarin drug label (Bristol-Myers Squibb). human triggering CDS rule 6 2 human_triggering_CDS_rule_7 3-4 mg warfarin per day should be considered as a starting dose range for a patient with this genotype according to the Warfarin drug label (Bristol-Myers Squibb). human triggering CDS rule 7 human_triggering_CDS_rule_8 3-4 mg warfarin per day should be considered as a starting dose range for a patient with this genotype according to the Warfarin drug label (Bristol-Myers Squibb). human triggering CDS rule 8 2 human_triggering_CDS_rule_9 0.5-2 mg warfarin per day should be considered as a starting dose range for a patient with this genotype according to the Warfarin drug label (Bristol-Myers Squibb). human triggering CDS rule 9 human_triggering_phenotype_inference_rule Human triggering phenotype inference rule human_with_ABCB1_star_1 human with ABCB1 *1 human_with_ABCB1_star_13 human with ABCB1 *13 human_with_ABCB1_star_13__per_Kroetz_et_al._2003__PMID__12893986__ human with ABCB1 *13 (per Kroetz et al. 2003 [PMID: 12893986]) human_with_ABCB1_star_2__per_Kim_et_al._2001__PMID__11503014__ human with ABCB1 *2 (per Kim et al. 2001 [PMID: 11503014]) human_with_ABCB1_star_2__per_Kroetz_et_al._2003__PMID__12893986__ human with ABCB1 *2 (per Kroetz et al. 2003 [PMID: 12893986]) human_with_ADRB1_H1 human with ADRB1 H1 human_with_ADRB1_H2 human with ADRB1 H2 human_with_ADRB1_H3 human with ADRB1 H3 human_with_BRCA1_1 human with BRCA1 1 human_with_BRCA1_10 human with BRCA1 10 human_with_BRCA1_1_hash human with BRCA1 1# human_with_BRCA1_2 human with BRCA1 2 human_with_BRCA1_2_hash human with BRCA1 2# human_with_BRCA1_3 human with BRCA1 3 human_with_BRCA1_3_hash human with BRCA1 3# human_with_BRCA1_4 human with BRCA1 4 human_with_BRCA1_4_hash human with BRCA1 4# human_with_BRCA1_5 human with BRCA1 5 human_with_BRCA1_5_hash human with BRCA1 5# human_with_BRCA1_6 human with BRCA1 6 human_with_BRCA1_7 human with BRCA1 7 human_with_BRCA1_8 human with BRCA1 8 human_with_BRCA1_9 human with BRCA1 9 human_with_COMT_Haplotype_high_activity human with COMT Haplotype high activity human_with_COMT_Haplotype_intermediate_activity human with COMT Haplotype intermediate activity human_with_COMT_Haplotype_low_activity human with COMT Haplotype low activity human_with_CYP1A2_star_10 human with CYP1A2 *10 human_with_CYP1A2_star_11 human with CYP1A2 *11 human_with_CYP1A2_star_12 human with CYP1A2 *12 human_with_CYP1A2_star_13 human with CYP1A2 *13 human_with_CYP1A2_star_14 human with CYP1A2 *14 human_with_CYP1A2_star_15 human with CYP1A2 *15 human_with_CYP1A2_star_16 human with CYP1A2 *16 human_with_CYP1A2_star_17 human with CYP1A2 *17 human_with_CYP1A2_star_18 human with CYP1A2 *18 human_with_CYP1A2_star_19 human with CYP1A2 *19 human_with_CYP1A2_star_1A human with CYP1A2 *1A human_with_CYP1A2_star_1B human with CYP1A2 *1B human_with_CYP1A2_star_1C human with CYP1A2 *1C human_with_CYP1A2_star_1E human with CYP1A2 *1E human_with_CYP1A2_star_1F human with CYP1A2 *1F human_with_CYP1A2_star_1G human with CYP1A2 *1G human_with_CYP1A2_star_1H human with CYP1A2 *1H human_with_CYP1A2_star_1J human with CYP1A2 *1J human_with_CYP1A2_star_1K human with CYP1A2 *1K human_with_CYP1A2_star_2 human with CYP1A2 *2 human_with_CYP1A2_star_20 human with CYP1A2 *20 human_with_CYP1A2_star_21 human with CYP1A2 *21 human_with_CYP1A2_star_3 human with CYP1A2 *3 human_with_CYP1A2_star_4 human with CYP1A2 *4 human_with_CYP1A2_star_5 human with CYP1A2 *5 human_with_CYP1A2_star_6 human with CYP1A2 *6 human_with_CYP1A2_star_7 human with CYP1A2 *7 human_with_CYP1A2_star_8 human with CYP1A2 *8 human_with_CYP1A2_star_9 human with CYP1A2 *9 human_with_CYP2A6_star_10 human with CYP2A6 *10 human_with_CYP2A6_star_11 human with CYP2A6 *11 human_with_CYP2A6_star_12A human with CYP2A6 *12A human_with_CYP2A6_star_12B human with CYP2A6 *12B human_with_CYP2A6_star_12C human with CYP2A6 *12C human_with_CYP2A6_star_13 human with CYP2A6 *13 human_with_CYP2A6_star_14 human with CYP2A6 *14 human_with_CYP2A6_star_15 human with CYP2A6 *15 human_with_CYP2A6_star_16 human with CYP2A6 *16 human_with_CYP2A6_star_17 human with CYP2A6 *17 human_with_CYP2A6_star_18A human with CYP2A6 *18A human_with_CYP2A6_star_18B human with CYP2A6 *18B human_with_CYP2A6_star_18C human with CYP2A6 *18C human_with_CYP2A6_star_19 human with CYP2A6 *19 human_with_CYP2A6_star_1A human with CYP2A6 *1A human_with_CYP2A6_star_1B1 human with CYP2A6 *1B1 human_with_CYP2A6_star_1B10 human with CYP2A6 *1B10 human_with_CYP2A6_star_1B11 human with CYP2A6 *1B11 human_with_CYP2A6_star_1B12 human with CYP2A6 *1B12 human_with_CYP2A6_star_1B13 human with CYP2A6 *1B13 human_with_CYP2A6_star_1B14 human with CYP2A6 *1B14 human_with_CYP2A6_star_1B15 human with CYP2A6 *1B15 human_with_CYP2A6_star_1B16 human with CYP2A6 *1B16 human_with_CYP2A6_star_1B17 human with CYP2A6 *1B17 human_with_CYP2A6_star_1B2 human with CYP2A6 *1B2 human_with_CYP2A6_star_1B3 human with CYP2A6 *1B3 human_with_CYP2A6_star_1B4 human with CYP2A6 *1B4 human_with_CYP2A6_star_1B5 human with CYP2A6 *1B5 human_with_CYP2A6_star_1B6 human with CYP2A6 *1B6 human_with_CYP2A6_star_1B7 human with CYP2A6 *1B7 human_with_CYP2A6_star_1B8 human with CYP2A6 *1B8 human_with_CYP2A6_star_1B9 human with CYP2A6 *1B9 human_with_CYP2A6_star_1C human with CYP2A6 *1C human_with_CYP2A6_star_1D human with CYP2A6 *1D human_with_CYP2A6_star_1E human with CYP2A6 *1E human_with_CYP2A6_star_1F human with CYP2A6 *1F human_with_CYP2A6_star_1G human with CYP2A6 *1G human_with_CYP2A6_star_1H human with CYP2A6 *1H human_with_CYP2A6_star_1J human with CYP2A6 *1J human_with_CYP2A6_star_1K human with CYP2A6 *1K human_with_CYP2A6_star_1L human with CYP2A6 *1L human_with_CYP2A6_star_1X2A human with CYP2A6 *1X2A human_with_CYP2A6_star_1X2B human with CYP2A6 *1X2B human_with_CYP2A6_star_2 human with CYP2A6 *2 human_with_CYP2A6_star_3 human with CYP2A6 *3 human_with_CYP2A6_star_5 human with CYP2A6 *5 human_with_CYP2A6_star_6 human with CYP2A6 *6 human_with_CYP2A6_star_7 human with CYP2A6 *7 human_with_CYP2A6_star_8 human with CYP2A6 *8 human_with_CYP2A6_star_9A human with CYP2A6 *9A human_with_CYP2A6_star_9B human with CYP2A6 *9B human_with_CYP2B6_star_10 human with CYP2B6 *10 human_with_CYP2B6_star_11A human with CYP2B6 *11A human_with_CYP2B6_star_11B human with CYP2B6 *11B human_with_CYP2B6_star_12 human with CYP2B6 *12 human_with_CYP2B6_star_13A human with CYP2B6 *13A human_with_CYP2B6_star_13B human with CYP2B6 *13B human_with_CYP2B6_star_14 human with CYP2B6 *14 human_with_CYP2B6_star_15A human with CYP2B6 *15A human_with_CYP2B6_star_15B human with CYP2B6 *15B human_with_CYP2B6_star_16 human with CYP2B6 *16 human_with_CYP2B6_star_17A human with CYP2B6 *17A human_with_CYP2B6_star_17B human with CYP2B6 *17B human_with_CYP2B6_star_18 human with CYP2B6 *18 human_with_CYP2B6_star_19 human with CYP2B6 *19 human_with_CYP2B6_star_1A human with CYP2B6 *1A human_with_CYP2B6_star_1B human with CYP2B6 *1B human_with_CYP2B6_star_1C human with CYP2B6 *1C human_with_CYP2B6_star_1D human with CYP2B6 *1D human_with_CYP2B6_star_1E human with CYP2B6 *1E human_with_CYP2B6_star_1F human with CYP2B6 *1F human_with_CYP2B6_star_1G human with CYP2B6 *1G human_with_CYP2B6_star_1H human with CYP2B6 *1H human_with_CYP2B6_star_1J human with CYP2B6 *1J human_with_CYP2B6_star_1K human with CYP2B6 *1K human_with_CYP2B6_star_1L human with CYP2B6 *1L human_with_CYP2B6_star_1M human with CYP2B6 *1M human_with_CYP2B6_star_1N human with CYP2B6 *1N human_with_CYP2B6_star_20 human with CYP2B6 *20 human_with_CYP2B6_star_21 human with CYP2B6 *21 human_with_CYP2B6_star_22 human with CYP2B6 *22 human_with_CYP2B6_star_23 human with CYP2B6 *23 human_with_CYP2B6_star_24 human with CYP2B6 *24 human_with_CYP2B6_star_25 human with CYP2B6 *25 human_with_CYP2B6_star_26 human with CYP2B6 *26 human_with_CYP2B6_star_27 human with CYP2B6 *27 human_with_CYP2B6_star_28 human with CYP2B6 *28 human_with_CYP2B6_star_29 human with CYP2B6 *29 human_with_CYP2B6_star_2A human with CYP2B6 *2A human_with_CYP2B6_star_2B human with CYP2B6 *2B human_with_CYP2B6_star_3 human with CYP2B6 *3 human_with_CYP2B6_star_4A human with CYP2B6 *4A human_with_CYP2B6_star_4B human with CYP2B6 *4B human_with_CYP2B6_star_4C human with CYP2B6 *4C human_with_CYP2B6_star_4D human with CYP2B6 *4D human_with_CYP2B6_star_5A human with CYP2B6 *5A human_with_CYP2B6_star_5B human with CYP2B6 *5B human_with_CYP2B6_star_5C human with CYP2B6 *5C human_with_CYP2B6_star_6A human with CYP2B6 *6A human_with_CYP2B6_star_6B human with CYP2B6 *6B human_with_CYP2B6_star_6C human with CYP2B6 *6C human_with_CYP2B6_star_7A human with CYP2B6 *7A human_with_CYP2B6_star_7B human with CYP2B6 *7B human_with_CYP2B6_star_8 human with CYP2B6 *8 human_with_CYP2B6_star_9 human with CYP2B6 *9 human_with_CYP2C19_star_10 human with CYP2C19 *10 human_with_CYP2C19_star_11 human with CYP2C19 *11 human_with_CYP2C19_star_12 human with CYP2C19 *12 human_with_CYP2C19_star_13 human with CYP2C19 *13 human_with_CYP2C19_star_14 human with CYP2C19 *14 human_with_CYP2C19_star_15 human with CYP2C19 *15 human_with_CYP2C19_star_16 human with CYP2C19 *16 human_with_CYP2C19_star_17 human with CYP2C19 *17 human_with_CYP2C19_star_18 human with CYP2C19 *18 human_with_CYP2C19_star_19 human with CYP2C19 *19 human_with_CYP2C19_star_1A human with CYP2C19 *1A human_with_CYP2C19_star_1B human with CYP2C19 *1B human_with_CYP2C19_star_1C human with CYP2C19 *1C human_with_CYP2C19_star_22 human with CYP2C19 *22 human_with_CYP2C19_star_23 human with CYP2C19 *23 human_with_CYP2C19_star_24 human with CYP2C19 *24 human_with_CYP2C19_star_25 human with CYP2C19 *25 human_with_CYP2C19_star_26 human with CYP2C19 *26 human_with_CYP2C19_star_27 human with CYP2C19 *27 human_with_CYP2C19_star_2A human with CYP2C19 *2A human_with_CYP2C19_star_2B human with CYP2C19 *2B human_with_CYP2C19_star_2C human with CYP2C19 *2C human_with_CYP2C19_star_2D human with CYP2C19 *2D human_with_CYP2C19_star_3A human with CYP2C19 *3A human_with_CYP2C19_star_3B human with CYP2C19 *3B human_with_CYP2C19_star_4A human with CYP2C19 *4A human_with_CYP2C19_star_4B human with CYP2C19 *4B human_with_CYP2C19_star_5A human with CYP2C19 *5A human_with_CYP2C19_star_5B human with CYP2C19 *5B human_with_CYP2C19_star_6 human with CYP2C19 *6 human_with_CYP2C19_star_7 human with CYP2C19 *7 human_with_CYP2C19_star_8 human with CYP2C19 *8 human_with_CYP2C19_star_9 human with CYP2C19 *9 human_with_CYP2C9_star_1 human with CYP2C9 *1 human_with_CYP2C9_star_10 human with CYP2C9 *10 human_with_CYP2C9_star_11 human with CYP2C9 *11 human_with_CYP2C9_star_12 human with CYP2C9 *12 human_with_CYP2C9_star_13 human with CYP2C9 *13 human_with_CYP2C9_star_14 human with CYP2C9 *14 human_with_CYP2C9_star_15 human with CYP2C9 *15 human_with_CYP2C9_star_16 human with CYP2C9 *16 human_with_CYP2C9_star_17 human with CYP2C9 *17 human_with_CYP2C9_star_18 human with CYP2C9 *18 human_with_CYP2C9_star_19 human with CYP2C9 *19 human_with_CYP2C9_star_2 human with CYP2C9 *2 human_with_CYP2C9_star_20 human with CYP2C9 *20 human_with_CYP2C9_star_21 human with CYP2C9 *21 human_with_CYP2C9_star_22 human with CYP2C9 *22 human_with_CYP2C9_star_23 human with CYP2C9 *23 human_with_CYP2C9_star_26 human with CYP2C9 *26 human_with_CYP2C9_star_27 human with CYP2C9 *27 human_with_CYP2C9_star_28 human with CYP2C9 *28 human_with_CYP2C9_star_29 human with CYP2C9 *29 human_with_CYP2C9_star_3 human with CYP2C9 *3 human_with_CYP2C9_star_30 human with CYP2C9 *30 human_with_CYP2C9_star_31 human with CYP2C9 *31 human_with_CYP2C9_star_32 human with CYP2C9 *32 human_with_CYP2C9_star_33 human with CYP2C9 *33 human_with_CYP2C9_star_34 human with CYP2C9 *34 human_with_CYP2C9_star_4 human with CYP2C9 *4 human_with_CYP2C9_star_5 human with CYP2C9 *5 human_with_CYP2C9_star_7 human with CYP2C9 *7 human_with_CYP2C9_star_8 human with CYP2C9 *8 human_with_CYP2C9_star_9 human with CYP2C9 *9 human_with_CYP2D6_star_1 human with CYP2D6 *1 human_with_CYP2D6_star_10 human with CYP2D6 *10 human_with_CYP2D6_star_17 human with CYP2D6 *17 human_with_CYP2D6_star_2 human with CYP2D6 *2 human_with_CYP2D6_star_29 human with CYP2D6 *29 human_with_CYP2D6_star_4 human with CYP2D6 *4 human_with_CYP2D6_star_41 human with CYP2D6 *41 human_with_CYP3A4_star_6 human with CYP3A4 *6 human_with_G6PD_haplotype_A-_202A__376G human with G6PD haplotype A- 202A/ 376G human_with_G6PD_haplotype_A-_680T__376G human with G6PD haplotype A- 680T/ 376G human_with_G6PD_haplotype_A-_968C__376G human with G6PD haplotype A- 968C/ 376G human_with_G6PD_haplotype_B__wildtype_ human with G6PD haplotype B (wildtype) human_with_G6PD_haplotype_Mediterranean human with G6PD haplotype Mediterranean human_with_HMGCR_H2 human with HMGCR H2 human_with_HMGCR_H7 human with HMGCR H7 human_with_P2RY12_H2 human with P2RY12 H2 human_with_SULT1A1_star_1 human with SULT1A1 *1 human_with_SULT1A1_star_2 human with SULT1A1 *2 human_with_SULT1A1_star_3 human with SULT1A1 *3 human_with_SULT1A1_star_5 human with SULT1A1 *5 human_with_TPMT_star_1 human with TPMT *1 human_with_TPMT_star_10 human with TPMT *10 human_with_TPMT_star_11 human with TPMT *11 human_with_TPMT_star_12 human with TPMT *12 human_with_TPMT_star_13 human with TPMT *13 human_with_TPMT_star_14 human with TPMT *14 human_with_TPMT_star_15 human with TPMT *15 human_with_TPMT_star_16 human with TPMT *16 human_with_TPMT_star_17 human with TPMT *17 human_with_TPMT_star_18 human with TPMT *18 human_with_TPMT_star_2 human with TPMT *2 human_with_TPMT_star_20_PMID_16917910_ human with TPMT *20(PMID:16917910) human_with_TPMT_star_20_PMID_16946561_ human with TPMT *20(PMID:16946561) human_with_TPMT_star_21 human with TPMT *21 human_with_TPMT_star_22 human with TPMT *22 human_with_TPMT_star_23 human with TPMT *23 human_with_TPMT_star_24_PMID__18602085_ human with TPMT *24(PMID: 18602085) human_with_TPMT_star_24_PMID__18708949_ human with TPMT *24(PMID: 18708949) human_with_TPMT_star_25 human with TPMT *25 human_with_TPMT_star_3A human with TPMT *3A human_with_TPMT_star_3B human with TPMT *3B human_with_TPMT_star_3C human with TPMT *3C human_with_TPMT_star_3D human with TPMT *3D human_with_TPMT_star_4 human with TPMT *4 human_with_TPMT_star_5 human with TPMT *5 human_with_TPMT_star_6 human with TPMT *6 human_with_TPMT_star_7 human with TPMT *7 human_with_TPMT_star_8 human with TPMT *8 human_with_TPMT_star_9 human with TPMT *9 human_with_UGT1A1_star_60c human with UGT1A1 *60c human_with_UGT1A1_star_VIII human with UGT1A1 *VIII human_with_VKORC1_H1 human with VKORC1 H1 human_with_VKORC1_H2 human with VKORC1 H2 human_with_VKORC1_H3 human with VKORC1 H3 human_with_VKORC1_H4 human with VKORC1 H4 human_with_VKORC1_H5 human with VKORC1 H5 human_with_VKORC1_H6 human with VKORC1 H6 human_with_VKORC1_H7 human with VKORC1 H7 human_with_VKORC1_H8 human with VKORC1 H8 human_with_VKORC1_H9 human with VKORC1 H9 human_with_VKORC1_star_1 human with VKORC1 *1 human_with_VKORC1_star_2 human with VKORC1 *2 human_with_VKORC1_star_3 human with VKORC1 *3 human_with_VKORC1_star_4 human with VKORC1 *4 human_with_genetic_polymorphism Human with genetic polymorphism 2 human_with_homozygous_ABCB1_star_1 human with homozygous ABCB1 *1 2 2 2 2 2 2 human_with_homozygous_ABCB1_star_13 human with homozygous ABCB1 *13 2 2 2 2 2 2 human_with_homozygous_ABCB1_star_13__per_Kroetz_et_al._2003__PMID__12893986__ human with homozygous ABCB1 *13 (per Kroetz et al. 2003 [PMID: 12893986]) 2 2 2 2 human_with_homozygous_ABCB1_star_2__per_Kim_et_al._2001__PMID__11503014__ human with homozygous ABCB1 *2 (per Kim et al. 2001 [PMID: 11503014]) 2 2 2 human_with_homozygous_ABCB1_star_2__per_Kroetz_et_al._2003__PMID__12893986__ human with homozygous ABCB1 *2 (per Kroetz et al. 2003 [PMID: 12893986]) 2 human_with_homozygous_ADRB1_H1 human with homozygous ADRB1 H1 2 human_with_homozygous_ADRB1_H2 human with homozygous ADRB1 H2 2 human_with_homozygous_ADRB1_H3 human with homozygous ADRB1 H3 2 human_with_homozygous_BRCA1_1 human with homozygous BRCA1 1 2 human_with_homozygous_BRCA1_10 human with homozygous BRCA1 10 2 human_with_homozygous_BRCA1_1_hash human with homozygous BRCA1 1# 2 human_with_homozygous_BRCA1_2 human with homozygous BRCA1 2 2 human_with_homozygous_BRCA1_2_hash human with homozygous BRCA1 2# 2 human_with_homozygous_BRCA1_3 human with homozygous BRCA1 3 2 human_with_homozygous_BRCA1_3_hash human with homozygous BRCA1 3# 2 human_with_homozygous_BRCA1_4 human with homozygous BRCA1 4 2 human_with_homozygous_BRCA1_4_hash human with homozygous BRCA1 4# 2 2 human_with_homozygous_BRCA1_5 human with homozygous BRCA1 5 2 2 2 human_with_homozygous_BRCA1_5_hash human with homozygous BRCA1 5# 2 human_with_homozygous_BRCA1_6 human with homozygous BRCA1 6 2 human_with_homozygous_BRCA1_7 human with homozygous BRCA1 7 2 human_with_homozygous_BRCA1_8 human with homozygous BRCA1 8 2 human_with_homozygous_BRCA1_9 human with homozygous BRCA1 9 2 human_with_homozygous_COMT_Haplotype_high_activity human with homozygous COMT Haplotype high activity 2 human_with_homozygous_COMT_Haplotype_intermediate_activity human with homozygous COMT Haplotype intermediate activity 2 human_with_homozygous_COMT_Haplotype_low_activity human with homozygous COMT Haplotype low activity 2 2 human_with_homozygous_CYP1A2_star_10 human with homozygous CYP1A2 *10 2 2 human_with_homozygous_CYP1A2_star_11 human with homozygous CYP1A2 *11 2 human_with_homozygous_CYP1A2_star_12 human with homozygous CYP1A2 *12 2 2 human_with_homozygous_CYP1A2_star_13 human with homozygous CYP1A2 *13 2 2 human_with_homozygous_CYP1A2_star_14 human with homozygous CYP1A2 *14 2 2 2 human_with_homozygous_CYP1A2_star_15 human with homozygous CYP1A2 *15 2 2 2 human_with_homozygous_CYP1A2_star_16 human with homozygous CYP1A2 *16 2 2 2 2 human_with_homozygous_CYP1A2_star_17 human with homozygous CYP1A2 *17 2 human_with_homozygous_CYP1A2_star_18 human with homozygous CYP1A2 *18 2 human_with_homozygous_CYP1A2_star_19 human with homozygous CYP1A2 *19 2 human_with_homozygous_CYP1A2_star_1A human with homozygous CYP1A2 *1A 2 2 human_with_homozygous_CYP1A2_star_1B human with homozygous CYP1A2 *1B 2 2 human_with_homozygous_CYP1A2_star_1C human with homozygous CYP1A2 *1C 2 2 human_with_homozygous_CYP1A2_star_1E human with homozygous CYP1A2 *1E 2 2 human_with_homozygous_CYP1A2_star_1F human with homozygous CYP1A2 *1F 2 2 2 human_with_homozygous_CYP1A2_star_1G human with homozygous CYP1A2 *1G 2 human_with_homozygous_CYP1A2_star_1H human with homozygous CYP1A2 *1H 2 2 2 human_with_homozygous_CYP1A2_star_1J human with homozygous CYP1A2 *1J 2 2 2 2 human_with_homozygous_CYP1A2_star_1K human with homozygous CYP1A2 *1K 2 2 human_with_homozygous_CYP1A2_star_2 human with homozygous CYP1A2 *2 2 human_with_homozygous_CYP1A2_star_20 human with homozygous CYP1A2 *20 2 2 2 human_with_homozygous_CYP1A2_star_21 human with homozygous CYP1A2 *21 2 2 human_with_homozygous_CYP1A2_star_3 human with homozygous CYP1A2 *3 2 2 human_with_homozygous_CYP1A2_star_4 human with homozygous CYP1A2 *4 2 human_with_homozygous_CYP1A2_star_5 human with homozygous CYP1A2 *5 2 2 human_with_homozygous_CYP1A2_star_6 human with homozygous CYP1A2 *6 2 2 human_with_homozygous_CYP1A2_star_7 human with homozygous CYP1A2 *7 2 2 2 human_with_homozygous_CYP1A2_star_8 human with homozygous CYP1A2 *8 2 human_with_homozygous_CYP1A2_star_9 human with homozygous CYP1A2 *9 2 2 human_with_homozygous_CYP2A6_star_10 human with homozygous CYP2A6 *10 2 human_with_homozygous_CYP2A6_star_11 human with homozygous CYP2A6 *11 2 human_with_homozygous_CYP2A6_star_12A human with homozygous CYP2A6 *12A 2 human_with_homozygous_CYP2A6_star_12B human with homozygous CYP2A6 *12B 2 human_with_homozygous_CYP2A6_star_12C human with homozygous CYP2A6 *12C 2 2 2 human_with_homozygous_CYP2A6_star_13 human with homozygous CYP2A6 *13 2 human_with_homozygous_CYP2A6_star_14 human with homozygous CYP2A6 *14 2 2 human_with_homozygous_CYP2A6_star_15 human with homozygous CYP2A6 *15 2 human_with_homozygous_CYP2A6_star_16 human with homozygous CYP2A6 *16 2 2 human_with_homozygous_CYP2A6_star_17 human with homozygous CYP2A6 *17 2 2 human_with_homozygous_CYP2A6_star_18A human with homozygous CYP2A6 *18A 2 2 human_with_homozygous_CYP2A6_star_18B human with homozygous CYP2A6 *18B 2 2 human_with_homozygous_CYP2A6_star_18C human with homozygous CYP2A6 *18C 2 2 human_with_homozygous_CYP2A6_star_19 human with homozygous CYP2A6 *19 2 human_with_homozygous_CYP2A6_star_1A human with homozygous CYP2A6 *1A 2 human_with_homozygous_CYP2A6_star_1B1 human with homozygous CYP2A6 *1B1 2 human_with_homozygous_CYP2A6_star_1B10 human with homozygous CYP2A6 *1B10 2 human_with_homozygous_CYP2A6_star_1B11 human with homozygous CYP2A6 *1B11 2 human_with_homozygous_CYP2A6_star_1B12 human with homozygous CYP2A6 *1B12 2 human_with_homozygous_CYP2A6_star_1B13 human with homozygous CYP2A6 *1B13 2 human_with_homozygous_CYP2A6_star_1B14 human with homozygous CYP2A6 *1B14 2 human_with_homozygous_CYP2A6_star_1B15 human with homozygous CYP2A6 *1B15 2 human_with_homozygous_CYP2A6_star_1B16 human with homozygous CYP2A6 *1B16 2 human_with_homozygous_CYP2A6_star_1B17 human with homozygous CYP2A6 *1B17 2 human_with_homozygous_CYP2A6_star_1B2 human with homozygous CYP2A6 *1B2 2 human_with_homozygous_CYP2A6_star_1B3 human with homozygous CYP2A6 *1B3 2 human_with_homozygous_CYP2A6_star_1B4 human with homozygous CYP2A6 *1B4 2 human_with_homozygous_CYP2A6_star_1B5 human with homozygous CYP2A6 *1B5 2 human_with_homozygous_CYP2A6_star_1B6 human with homozygous CYP2A6 *1B6 2 human_with_homozygous_CYP2A6_star_1B7 human with homozygous CYP2A6 *1B7 2 human_with_homozygous_CYP2A6_star_1B8 human with homozygous CYP2A6 *1B8 2 human_with_homozygous_CYP2A6_star_1B9 human with homozygous CYP2A6 *1B9 2 human_with_homozygous_CYP2A6_star_1C human with homozygous CYP2A6 *1C 2 human_with_homozygous_CYP2A6_star_1D human with homozygous CYP2A6 *1D 2 human_with_homozygous_CYP2A6_star_1E human with homozygous CYP2A6 *1E 2 human_with_homozygous_CYP2A6_star_1F human with homozygous CYP2A6 *1F 2 human_with_homozygous_CYP2A6_star_1G human with homozygous CYP2A6 *1G 2 human_with_homozygous_CYP2A6_star_1H human with homozygous CYP2A6 *1H 2 human_with_homozygous_CYP2A6_star_1J human with homozygous CYP2A6 *1J 2 human_with_homozygous_CYP2A6_star_1K human with homozygous CYP2A6 *1K 2 human_with_homozygous_CYP2A6_star_1L human with homozygous CYP2A6 *1L 2 human_with_homozygous_CYP2A6_star_1X2A human with homozygous CYP2A6 *1X2A 2 human_with_homozygous_CYP2A6_star_1X2B human with homozygous CYP2A6 *1X2B 2 2 human_with_homozygous_CYP2A6_star_2 human with homozygous CYP2A6 *2 2 human_with_homozygous_CYP2A6_star_3 human with homozygous CYP2A6 *3 2 2 human_with_homozygous_CYP2A6_star_5 human with homozygous CYP2A6 *5 2 2 human_with_homozygous_CYP2A6_star_6 human with homozygous CYP2A6 *6 2 2 human_with_homozygous_CYP2A6_star_7 human with homozygous CYP2A6 *7 2 human_with_homozygous_CYP2A6_star_8 human with homozygous CYP2A6 *8 2 2 human_with_homozygous_CYP2A6_star_9A human with homozygous CYP2A6 *9A 2 2 human_with_homozygous_CYP2A6_star_9B human with homozygous CYP2A6 *9B 2 2 human_with_homozygous_CYP2B6_star_10 human with homozygous CYP2B6 *10 2 2 human_with_homozygous_CYP2B6_star_11A human with homozygous CYP2B6 *11A 2 2 human_with_homozygous_CYP2B6_star_11B human with homozygous CYP2B6 *11B 2 2 human_with_homozygous_CYP2B6_star_12 human with homozygous CYP2B6 *12 2 2 2 human_with_homozygous_CYP2B6_star_13A human with homozygous CYP2B6 *13A 2 2 2 2 human_with_homozygous_CYP2B6_star_13B human with homozygous CYP2B6 *13B 2 2 human_with_homozygous_CYP2B6_star_14 human with homozygous CYP2B6 *14 2 2 2 human_with_homozygous_CYP2B6_star_15A human with homozygous CYP2B6 *15A 2 2 2 2 human_with_homozygous_CYP2B6_star_15B human with homozygous CYP2B6 *15B 2 2 human_with_homozygous_CYP2B6_star_16 human with homozygous CYP2B6 *16 2 2 2 2 2 human_with_homozygous_CYP2B6_star_17A human with homozygous CYP2B6 *17A 2 2 2 2 human_with_homozygous_CYP2B6_star_17B human with homozygous CYP2B6 *17B 2 2 2 2 human_with_homozygous_CYP2B6_star_18 human with homozygous CYP2B6 *18 2 2 2 human_with_homozygous_CYP2B6_star_19 human with homozygous CYP2B6 *19 2 human_with_homozygous_CYP2B6_star_1A human with homozygous CYP2B6 *1A 2 human_with_homozygous_CYP2B6_star_1B human with homozygous CYP2B6 *1B 2 2 2 human_with_homozygous_CYP2B6_star_1C human with homozygous CYP2B6 *1C 2 2 human_with_homozygous_CYP2B6_star_1D human with homozygous CYP2B6 *1D 2 human_with_homozygous_CYP2B6_star_1E human with homozygous CYP2B6 *1E 2 human_with_homozygous_CYP2B6_star_1F human with homozygous CYP2B6 *1F 2 2 human_with_homozygous_CYP2B6_star_1G human with homozygous CYP2B6 *1G 2 2 human_with_homozygous_CYP2B6_star_1H human with homozygous CYP2B6 *1H 2 2 human_with_homozygous_CYP2B6_star_1J human with homozygous CYP2B6 *1J 2 2 human_with_homozygous_CYP2B6_star_1K human with homozygous CYP2B6 *1K 2 2 human_with_homozygous_CYP2B6_star_1L human with homozygous CYP2B6 *1L 2 human_with_homozygous_CYP2B6_star_1M human with homozygous CYP2B6 *1M 2 2 human_with_homozygous_CYP2B6_star_1N human with homozygous CYP2B6 *1N 2 2 human_with_homozygous_CYP2B6_star_20 human with homozygous CYP2B6 *20 2 2 human_with_homozygous_CYP2B6_star_21 human with homozygous CYP2B6 *21 2 2 human_with_homozygous_CYP2B6_star_22 human with homozygous CYP2B6 *22 2 human_with_homozygous_CYP2B6_star_23 human with homozygous CYP2B6 *23 2 human_with_homozygous_CYP2B6_star_24 human with homozygous CYP2B6 *24 2 human_with_homozygous_CYP2B6_star_25 human with homozygous CYP2B6 *25 2 human_with_homozygous_CYP2B6_star_26 human with homozygous CYP2B6 *26 2 2 2 human_with_homozygous_CYP2B6_star_27 human with homozygous CYP2B6 *27 2 2 2 2 2 2 2 human_with_homozygous_CYP2B6_star_28 human with homozygous CYP2B6 *28 2 human_with_homozygous_CYP2B6_star_29 human with homozygous CYP2B6 *29 2 2 human_with_homozygous_CYP2B6_star_2A human with homozygous CYP2B6 *2A 2 2 human_with_homozygous_CYP2B6_star_2B human with homozygous CYP2B6 *2B 2 2 human_with_homozygous_CYP2B6_star_3 human with homozygous CYP2B6 *3 2 2 human_with_homozygous_CYP2B6_star_4A human with homozygous CYP2B6 *4A 2 2 2 human_with_homozygous_CYP2B6_star_4B human with homozygous CYP2B6 *4B 2 2 human_with_homozygous_CYP2B6_star_4C human with homozygous CYP2B6 *4C 2 2 2 human_with_homozygous_CYP2B6_star_4D human with homozygous CYP2B6 *4D 2 2 human_with_homozygous_CYP2B6_star_5A human with homozygous CYP2B6 *5A 2 2 2 human_with_homozygous_CYP2B6_star_5B human with homozygous CYP2B6 *5B 2 2 human_with_homozygous_CYP2B6_star_5C human with homozygous CYP2B6 *5C 2 human_with_homozygous_CYP2B6_star_6A human with homozygous CYP2B6 *6A 2 2 human_with_homozygous_CYP2B6_star_6B human with homozygous CYP2B6 *6B 2 2 human_with_homozygous_CYP2B6_star_6C human with homozygous CYP2B6 *6C 2 2 human_with_homozygous_CYP2B6_star_7A human with homozygous CYP2B6 *7A 2 2 human_with_homozygous_CYP2B6_star_7B human with homozygous CYP2B6 *7B 2 2 human_with_homozygous_CYP2B6_star_8 human with homozygous CYP2B6 *8 2 2 human_with_homozygous_CYP2B6_star_9 human with homozygous CYP2B6 *9 2 2 human_with_homozygous_CYP2C19_star_10 human with homozygous CYP2C19 *10 2 2 human_with_homozygous_CYP2C19_star_11 human with homozygous CYP2C19 *11 2 2 human_with_homozygous_CYP2C19_star_12 human with homozygous CYP2C19 *12 2 2 human_with_homozygous_CYP2C19_star_13 human with homozygous CYP2C19 *13 2 2 human_with_homozygous_CYP2C19_star_14 human with homozygous CYP2C19 *14 2 2 human_with_homozygous_CYP2C19_star_15 human with homozygous CYP2C19 *15 2 human_with_homozygous_CYP2C19_star_16 human with homozygous CYP2C19 *16 2 2 human_with_homozygous_CYP2C19_star_17 human with homozygous CYP2C19 *17 2 human_with_homozygous_CYP2C19_star_18 human with homozygous CYP2C19 *18 2 human_with_homozygous_CYP2C19_star_19 human with homozygous CYP2C19 *19 2 human_with_homozygous_CYP2C19_star_1A human with homozygous CYP2C19 *1A 2 human_with_homozygous_CYP2C19_star_1B human with homozygous CYP2C19 *1B 2 human_with_homozygous_CYP2C19_star_1C human with homozygous CYP2C19 *1C 2 human_with_homozygous_CYP2C19_star_22 human with homozygous CYP2C19 *22 2 human_with_homozygous_CYP2C19_star_23 human with homozygous CYP2C19 *23 2 human_with_homozygous_CYP2C19_star_24 human with homozygous CYP2C19 *24 2 human_with_homozygous_CYP2C19_star_25 human with homozygous CYP2C19 *25 2 human_with_homozygous_CYP2C19_star_26 human with homozygous CYP2C19 *26 2 2 human_with_homozygous_CYP2C19_star_27 human with homozygous CYP2C19 *27 2 2 human_with_homozygous_CYP2C19_star_2A human with homozygous CYP2C19 *2A 2 2 human_with_homozygous_CYP2C19_star_2B human with homozygous CYP2C19 *2B 2 2 human_with_homozygous_CYP2C19_star_2C human with homozygous CYP2C19 *2C 2 2 human_with_homozygous_CYP2C19_star_2D human with homozygous CYP2C19 *2D 2 2 human_with_homozygous_CYP2C19_star_3A human with homozygous CYP2C19 *3A 2 2 human_with_homozygous_CYP2C19_star_3B human with homozygous CYP2C19 *3B 2 2 human_with_homozygous_CYP2C19_star_4A human with homozygous CYP2C19 *4A 2 2 human_with_homozygous_CYP2C19_star_4B human with homozygous CYP2C19 *4B 2 2 human_with_homozygous_CYP2C19_star_5A human with homozygous CYP2C19 *5A 2 2 human_with_homozygous_CYP2C19_star_5B human with homozygous CYP2C19 *5B 2 human_with_homozygous_CYP2C19_star_6 human with homozygous CYP2C19 *6 2 2 human_with_homozygous_CYP2C19_star_7 human with homozygous CYP2C19 *7 2 2 human_with_homozygous_CYP2C19_star_8 human with homozygous CYP2C19 *8 2 human_with_homozygous_CYP2C19_star_9 human with homozygous CYP2C19 *9 2 human_with_homozygous_CYP2C9_star_1 human with homozygous CYP2C9 *1 2 2 human_with_homozygous_CYP2C9_star_10 human with homozygous CYP2C9 *10 2 2 human_with_homozygous_CYP2C9_star_11 human with homozygous CYP2C9 *11 2 2 human_with_homozygous_CYP2C9_star_12 human with homozygous CYP2C9 *12 2 2 human_with_homozygous_CYP2C9_star_13 human with homozygous CYP2C9 *13 2 2 human_with_homozygous_CYP2C9_star_14 human with homozygous CYP2C9 *14 2 2 human_with_homozygous_CYP2C9_star_15 human with homozygous CYP2C9 *15 2 2 human_with_homozygous_CYP2C9_star_16 human with homozygous CYP2C9 *16 2 human_with_homozygous_CYP2C9_star_17 human with homozygous CYP2C9 *17 2 2 2 2 human_with_homozygous_CYP2C9_star_18 human with homozygous CYP2C9 *18 2 human_with_homozygous_CYP2C9_star_19 human with homozygous CYP2C9 *19 2 2 human_with_homozygous_CYP2C9_star_2 human with homozygous CYP2C9 *2 2 human_with_homozygous_CYP2C9_star_20 human with homozygous CYP2C9 *20 2 human_with_homozygous_CYP2C9_star_21 human with homozygous CYP2C9 *21 2 human_with_homozygous_CYP2C9_star_22 human with homozygous CYP2C9 *22 2 human_with_homozygous_CYP2C9_star_23 human with homozygous CYP2C9 *23 2 human_with_homozygous_CYP2C9_star_26 human with homozygous CYP2C9 *26 2 human_with_homozygous_CYP2C9_star_27 human with homozygous CYP2C9 *27 2 human_with_homozygous_CYP2C9_star_28 human with homozygous CYP2C9 *28 2 human_with_homozygous_CYP2C9_star_29 human with homozygous CYP2C9 *29 2 2 human_with_homozygous_CYP2C9_star_3 human with homozygous CYP2C9 *3 2 human_with_homozygous_CYP2C9_star_30 human with homozygous CYP2C9 *30 2 2 human_with_homozygous_CYP2C9_star_31 human with homozygous CYP2C9 *31 2 human_with_homozygous_CYP2C9_star_32 human with homozygous CYP2C9 *32 2 2 human_with_homozygous_CYP2C9_star_33 human with homozygous CYP2C9 *33 2 2 human_with_homozygous_CYP2C9_star_34 human with homozygous CYP2C9 *34 2 2 human_with_homozygous_CYP2C9_star_4 human with homozygous CYP2C9 *4 2 2 human_with_homozygous_CYP2C9_star_5 human with homozygous CYP2C9 *5 2 2 human_with_homozygous_CYP2C9_star_7 human with homozygous CYP2C9 *7 2 2 human_with_homozygous_CYP2C9_star_8 human with homozygous CYP2C9 *8 2 2 human_with_homozygous_CYP2C9_star_9 human with homozygous CYP2C9 *9 2 human_with_homozygous_CYP2D6_star_1 human with homozygous CYP2D6 *1 2 2 human_with_homozygous_CYP2D6_star_10 human with homozygous CYP2D6 *10 2 2 2 human_with_homozygous_CYP2D6_star_17 human with homozygous CYP2D6 *17 2 2 human_with_homozygous_CYP2D6_star_2 human with homozygous CYP2D6 *2 2 2 human_with_homozygous_CYP2D6_star_29 human with homozygous CYP2D6 *29 2 human_with_homozygous_CYP2D6_star_4 human with homozygous CYP2D6 *4 2 2 human_with_homozygous_CYP2D6_star_41 human with homozygous CYP2D6 *41 2 2 human_with_homozygous_CYP3A4_star_6 human with homozygous CYP3A4 *6 2 2 2 human_with_homozygous_G6PD_haplotype_A-_202A__376G human with homozygous G6PD haplotype A- 202A/ 376G 2 2 human_with_homozygous_G6PD_haplotype_A-_680T__376G human with homozygous G6PD haplotype A- 680T/ 376G 2 2 2 human_with_homozygous_G6PD_haplotype_A-_968C__376G human with homozygous G6PD haplotype A- 968C/ 376G 2 human_with_homozygous_G6PD_haplotype_B__wildtype_ human with homozygous G6PD haplotype B (wildtype) 2 2 2 human_with_homozygous_G6PD_haplotype_Mediterranean human with homozygous G6PD haplotype Mediterranean 2 2 2 2 2 2 2 2 2 2 2 2 human_with_homozygous_HMGCR_H2 human with homozygous HMGCR H2 2 2 2 human_with_homozygous_HMGCR_H7 human with homozygous HMGCR H7 2 2 2 2 2 human_with_homozygous_P2RY12_H2 human with homozygous P2RY12 H2 2 human_with_homozygous_SULT1A1_star_1 human with homozygous SULT1A1 *1 2 2 human_with_homozygous_SULT1A1_star_2 human with homozygous SULT1A1 *2 2 2 human_with_homozygous_SULT1A1_star_3 human with homozygous SULT1A1 *3 2 2 human_with_homozygous_SULT1A1_star_5 human with homozygous SULT1A1 *5 2 human_with_homozygous_TPMT_star_1 human with homozygous TPMT *1 2 human_with_homozygous_TPMT_star_10 human with homozygous TPMT *10 2 human_with_homozygous_TPMT_star_11 human with homozygous TPMT *11 2 human_with_homozygous_TPMT_star_12 human with homozygous TPMT *12 2 human_with_homozygous_TPMT_star_13 human with homozygous TPMT *13 2 human_with_homozygous_TPMT_star_14 human with homozygous TPMT *14 2 human_with_homozygous_TPMT_star_15 human with homozygous TPMT *15 2 human_with_homozygous_TPMT_star_16 human with homozygous TPMT *16 2 human_with_homozygous_TPMT_star_17 human with homozygous TPMT *17 2 human_with_homozygous_TPMT_star_18 human with homozygous TPMT *18 2 2 human_with_homozygous_TPMT_star_2 human with homozygous TPMT *2 2 human_with_homozygous_TPMT_star_20_PMID_16917910_ human with homozygous TPMT *20(PMID:16917910) 2 human_with_homozygous_TPMT_star_20_PMID_16946561_ human with homozygous TPMT *20(PMID:16946561) 2 human_with_homozygous_TPMT_star_21 human with homozygous TPMT *21 2 human_with_homozygous_TPMT_star_22 human with homozygous TPMT *22 2 human_with_homozygous_TPMT_star_23 human with homozygous TPMT *23 2 human_with_homozygous_TPMT_star_24_PMID__18602085_ human with homozygous TPMT *24(PMID: 18602085) 2 human_with_homozygous_TPMT_star_24_PMID__18708949_ human with homozygous TPMT *24(PMID: 18708949) 2 human_with_homozygous_TPMT_star_25 human with homozygous TPMT *25 2 2 2 human_with_homozygous_TPMT_star_3A human with homozygous TPMT *3A 2 2 human_with_homozygous_TPMT_star_3B human with homozygous TPMT *3B 2 2 human_with_homozygous_TPMT_star_3C human with homozygous TPMT *3C 2 2 2 human_with_homozygous_TPMT_star_3D human with homozygous TPMT *3D 2 2 human_with_homozygous_TPMT_star_4 human with homozygous TPMT *4 2 human_with_homozygous_TPMT_star_5 human with homozygous TPMT *5 2 human_with_homozygous_TPMT_star_6 human with homozygous TPMT *6 2 human_with_homozygous_TPMT_star_7 human with homozygous TPMT *7 2 human_with_homozygous_TPMT_star_8 human with homozygous TPMT *8 2 human_with_homozygous_TPMT_star_9 human with homozygous TPMT *9 2 human_with_homozygous_UGT1A1_star_60c human with homozygous UGT1A1 *60c 2 human_with_homozygous_UGT1A1_star_VIII human with homozygous UGT1A1 *VIII 2 2 2 2 2 2 2 2 2 2 2 human_with_homozygous_VKORC1_H1 human with homozygous VKORC1 H1 2 2 2 2 2 2 2 2 2 2 2 human_with_homozygous_VKORC1_H2 human with homozygous VKORC1 H2 2 2 2 2 2 2 2 2 2 2 2 human_with_homozygous_VKORC1_H3 human with homozygous VKORC1 H3 2 2 2 2 2 2 2 2 2 2 2 human_with_homozygous_VKORC1_H4 human with homozygous VKORC1 H4 2 2 2 2 2 2 2 2 2 2 2 human_with_homozygous_VKORC1_H5 human with homozygous VKORC1 H5 2 2 2 2 2 2 2 2 2 2 2 human_with_homozygous_VKORC1_H6 human with homozygous VKORC1 H6 2 2 2 2 2 2 2 2 2 2 2 human_with_homozygous_VKORC1_H7 human with homozygous VKORC1 H7 2 2 2 2 2 2 2 2 2 2 2 human_with_homozygous_VKORC1_H8 human with homozygous VKORC1 H8 2 2 2 2 2 2 2 2 2 2 2 human_with_homozygous_VKORC1_H9 human with homozygous VKORC1 H9 2 human_with_homozygous_VKORC1_star_1 human with homozygous VKORC1 *1 2 2 2 2 human_with_homozygous_VKORC1_star_2 human with homozygous VKORC1 *2 2 2 human_with_homozygous_VKORC1_star_3 human with homozygous VKORC1 *3 2 2 human_with_homozygous_VKORC1_star_4 human with homozygous VKORC1 *4 phenotype A phenotype is an observable characteristic of an organism. For example: characteristics of drug metabolism and response. Phenotype 1 polymorphism A small part of the genome of an individual where studies have shown that genetic sequences vary between individuals. For example: single nucleotide polymorphisms (SNPs), insertions, deletions, indels, microsatellites. All polymorphisms and sequences in the Genomic CDS ontology are reported using the forward orientation of the reference genome (the 'plus' strand). Polymorphism rs10038095 forward rs10038095 rs10038095 rs10038095_A rs10038095_A rs10038095_T rs10038095_T rs10264272 forward rs10264272 rs10264272 rs10264272_C rs10264272_C rs10264272_T rs10264272_T rs10276036 forward rs10276036 rs10276036 rs10276036_C rs10276036_C rs10276036_T rs10276036_T rs1041983 forward rs1041983 rs1041983 rs1041983_C rs1041983_C rs1041983_T rs1041983_T rs1042713 forward rs1042713 rs1042713 rs1042713_A rs1042713_A rs1042713_G rs1042713_G rs1042714 forward rs1042714 rs1042714 rs1042714_C rs1042714_C rs1042714_G rs1042714_G rs1045642 reverse rs1045642 rs1045642 rs1045642_A rs1045642_A rs1045642_G rs1045642_G rs1045642_T rs1045642_T rs1048943 reverse rs1048943 rs1048943 rs1048943_A rs1048943_A rs1048943_C rs1048943_C rs1048943_G rs1048943_G rs1048943_T rs1048943_T rs1050828 reverse rs1050828 rs1050828 rs1050828_C rs1050828_C rs1050828_T rs1050828_T rs1050829 reverse rs1050829 rs1050829 rs1050829_C rs1050829_C rs1050829_T rs1050829_T rs10509681 forward rs10509681 rs10509681 rs10509681_C rs10509681_C rs10509681_T rs10509681_T rs1051266 reverse rs1051266 rs1051266 rs1051266_C rs1051266_C rs1051266_T rs1051266_T rs1051296 reverse rs1051296 rs1051296 rs1051296_A rs1051296_A rs1051296_C rs1051296_C rs1051298 reverse rs1051298 rs1051298 rs1051298_A rs1051298_A rs1051298_G rs1051298_G rs1057910 forward rs1057910 rs1057910 rs1057910_A rs1057910_A rs1057910_C rs1057910_C rs1057910_G rs1057910_G rs1057910_T rs1057910_T rs1057911 forward rs1057911 rs1057911 rs1057911_A rs1057911_A rs1057911_T rs1057911_T rs1058930 reverse rs1058930 rs1058930 rs1058930_C rs1058930_C rs1058930_G rs1058930_G rs1060915 reverse rs1060915 rs1060915 rs1060915_A rs1060915_A rs1060915_G rs1060915_G rs1065411 reverse rs1065411 rs1065411 rs1065411_C rs1065411_C rs1065411_G rs1065411_G rs1065776 forward rs1065776 rs1065776 rs1065776_C rs1065776_C rs1065776_T rs1065776_T rs1065852 reverse rs1065852 rs1065852 rs1065852_A rs1065852_A rs1065852_G rs1065852_G rs1080985 reverse rs1080985 rs1080985 rs1080985_C rs1080985_C rs1080985_G rs1080985_G rs10929302 forward rs10929302 rs10929302 rs10929302_A rs10929302_A rs10929302_G rs10929302_G rs10935838 forward rs10935838 rs10935838 rs10935838_A rs10935838_A rs10935838_G rs10935838_G rs11045819 forward rs11045819 rs11045819 rs11045819_A rs11045819_A rs11045819_C rs11045819_C rs11045852 forward rs11045852 rs11045852 rs11045852_A rs11045852_A rs11045852_G rs11045852_G rs11045853 forward rs11045853 rs11045853 rs11045853_A rs11045853_A rs11045853_G rs11045853_G rs11188072 forward rs11188072 rs11188072 rs11188072_C rs11188072_C rs11188072_T rs11188072_T rs1128503 reverse rs1128503 rs1128503 rs1128503_A rs1128503_A rs1128503_G rs1128503_G rs1131596 reverse rs1131596 rs1131596 rs1131596_A rs1131596_A rs1131596_C rs1131596_C rs1131596_G rs1131596_G rs1131596_T rs1131596_T rs1135840 reverse rs1135840 rs1135840 rs1135840_C rs1135840_C rs1135840_G rs1135840_G rs1138272 forward rs1138272 rs1138272 rs1138272_C rs1138272_C rs1138272_T rs1138272_T rs1142345 reverse rs1142345 rs1142345 rs1142345_C rs1142345_C rs1142345_T rs1142345_T rs1143671 forward rs1143671 rs1143671 rs1143671_C rs1143671_C rs1143671_T rs1143671_T rs1143672 forward rs1143672 rs1143672 rs1143672_A rs1143672_A rs1143672_G rs1143672_G rs11568626 forward rs11568626 rs11568626 rs11568626_C rs11568626_C rs11568626_T rs11568626_T rs11568732 forward rs11568732 rs11568732 rs11568732_G rs11568732_G rs11568732_T rs11568732_T rs11572080 reverse rs11572080 rs11572080 rs11572080_C rs11572080_C rs11572080_T rs11572080_T rs11572103 reverse rs11572103 rs11572103 rs11572103_A rs11572103_A rs11572103_T rs11572103_T rs118203756 forward rs118203756 rs118203756 rs118203756_C rs118203756_C rs118203756_G rs118203756_G rs118203757 forward rs118203757 rs118203757 rs118203757_A rs118203757_A rs118203757_G rs118203757_G rs118203759 forward rs118203759 rs118203759 rs118203759_C rs118203759_C rs118203759_G rs118203759_G rs1208 forward rs1208 rs1208 rs1208_A rs1208_A rs1208_G rs1208_G rs12208357 forward rs12208357 rs12208357 rs12208357_A rs12208357_A rs12208357_C rs12208357_C rs12208357_G rs12208357_G rs12208357_T rs12208357_T rs12248560 forward rs12248560 rs12248560 rs12248560_A rs12248560_A rs12248560_C rs12248560_C rs12248560_T rs12248560_T rs12516 reverse rs12516 rs12516 rs12516_A rs12516_A rs12516_G rs12516_G rs12571421 forward rs12571421 rs12571421 rs12571421_A rs12571421_A rs12571421_G rs12571421_G rs12659 reverse rs12659 rs12659 rs12659_A rs12659_A rs12659_G rs12659_G rs12720441 reverse rs12720441 rs12720441 rs12720441_A rs12720441_A rs12720441_G rs12720441_G rs12720461 forward rs12720461 rs12720461 rs12720461_C rs12720461_C rs12720461_T rs12720461_T rs12721608 forward rs12721608 rs12721608 rs12721608_A rs12721608_A rs12721608_G rs12721608_G rs12721627 reverse rs12721627 rs12721627 rs12721627_C rs12721627_C rs12721627_G rs12721627_G rs12721629 reverse rs12721629 rs12721629 rs12721629_A rs12721629_A rs12721629_G rs12721629_G rs12721634 reverse rs12721634 rs12721634 rs12721634_A rs12721634_A rs12721634_G rs12721634_G rs12721649 forward rs12721649 rs12721649 rs12721649_A rs12721649_A rs12721649_G rs12721649_G rs12721655 forward rs12721655 rs12721655 rs12721655_A rs12721655_A rs12721655_G rs12721655_G rs12769205 forward rs12769205 rs12769205 rs12769205_A rs12769205_A rs12769205_G rs12769205_G rs12979860 forward rs12979860 rs12979860 rs12979860_C rs12979860_C rs12979860_T rs12979860_T rs13404099 forward rs13404099 rs13404099 rs13404099_A rs13404099_A rs13404099_G rs13404099_G rs137852328 reverse rs137852328 rs137852328 rs137852328_A rs137852328_A rs137852328_C rs137852328_C rs137852328_T rs137852328_T rs139257324 forward rs139257324 rs139257324 rs139257324_C rs139257324_C rs139257324_T rs139257324_T rs140790673 forward rs140790673 rs140790673 rs140790673_C rs140790673_C rs140790673_T rs140790673_T rs142965323 forward rs142965323 rs142965323 rs142965323_A rs142965323_A rs142965323_G rs142965323_G rs147545709 forward rs147545709 rs147545709 rs147545709_A rs147545709_A rs147545709_G rs147545709_G rs16940 reverse rs16940 rs16940 rs16940_A rs16940_A rs16940_G rs16940_G rs16941 reverse rs16941 rs16941 rs16941_C rs16941_C rs16941_T rs16941_T rs16942 reverse rs16942 rs16942 rs16942_C rs16942_C rs16942_T rs16942_T rs16947 forward rs16947 rs16947 rs16947_A rs16947_A rs16947_G rs16947_G rs1695 forward rs1695 rs1695 rs1695_A rs1695_A rs1695_G rs1695_G rs17238484 forward rs17238484 rs17238484 rs17238484_G rs17238484_G rs17238484_T rs17238484_T rs17238540 forward rs17238540 rs17238540 rs17238540_A rs17238540_A rs17238540_C rs17238540_C rs17238540_G rs17238540_G rs17238540_T rs17238540_T rs17244841 forward rs17244841 rs17244841 rs17244841_A rs17244841_A rs17244841_T rs17244841_T rs17599948 forward rs17599948 rs17599948 rs17599948_A rs17599948_A rs17599948_C rs17599948_C rs17599948_G rs17599948_G rs17599948_T rs17599948_T rs17708472 forward rs17708472 rs17708472 rs17708472_A rs17708472_A rs17708472_G rs17708472_G rs17861157 forward rs17861157 rs17861157 rs17861157_A rs17861157_A rs17861157_C rs17861157_C rs17861157_G rs17861157_G rs17861157_T rs17861157_T rs17878459 forward rs17878459 rs17878459 rs17878459_C rs17878459_C rs17878459_G rs17878459_G rs17878649 forward rs17878649 rs17878649 rs17878649_A rs17878649_A rs17878649_G rs17878649_G rs17879685 forward rs17879685 rs17879685 rs17879685_C rs17879685_C rs17879685_T rs17879685_T rs17879992 forward rs17879992 rs17879992 rs17879992_C rs17879992_C rs17879992_T rs17879992_T rs17880887 reverse rs17880887 rs17880887 rs17880887_G rs17880887_G rs17880887_T rs17880887_T rs17881535 reverse rs17881535 rs17881535 rs17881535_C rs17881535_C rs17881535_G rs17881535_G rs17882687 forward rs17882687 rs17882687 rs17882687_A rs17882687_A rs17882687_C rs17882687_C rs17884712 forward rs17884712 rs17884712 rs17884712_A rs17884712_A rs17884712_G rs17884712_G rs17884832 forward rs17884832 rs17884832 rs17884832_G rs17884832_G rs17884832_T rs17884832_T rs17885098 forward rs17885098 rs17885098 rs17885098_C rs17885098_C rs17885098_T rs17885098_T rs17886522 forward rs17886522 rs17886522 rs17886522_A rs17886522_A rs17886522_C rs17886522_C rs1799732 reverse rs1799732 rs1799732 rs1799732_- rs1799732_- rs1799732_G rs1799732_G rs1799752 forward rs1799752 rs1799752 rs1799752_- rs1799752_- rs1799752_ATACAGTCACTTTTTTTTTTTTTTTGAGACGGAGTCTCGCTCTGTCGCCC rs1799752_ATACAGTCACTTTTTTTTTTTTTTTGAGACGGAGTCTCGCTCTGTCGCCC rs1799814 reverse rs1799814 rs1799814 rs1799814_A rs1799814_A rs1799814_C rs1799814_C rs1799814_G rs1799814_G rs1799814_T rs1799814_T rs1799853 forward rs1799853 rs1799853 rs1799853_A rs1799853_A rs1799853_C rs1799853_C rs1799853_G rs1799853_G rs1799853_T rs1799853_T rs1799929 forward rs1799929 rs1799929 rs1799929_C rs1799929_C rs1799929_T rs1799929_T rs1799930 forward rs1799930 rs1799930 rs1799930_A rs1799930_A rs1799930_G rs1799930_G rs1799931 forward rs1799931 rs1799931 rs1799931_A rs1799931_A rs1799931_G rs1799931_G rs1799949 reverse rs1799949 rs1799949 rs1799949_A rs1799949_A rs1799949_G rs1799949_G rs1799966 reverse rs1799966 rs1799966 rs1799966_A rs1799966_A rs1799966_C rs1799966_C rs1799966_T rs1799966_T rs1800031 reverse rs1800031 rs1800031 rs1800031_A rs1800031_A rs1800031_G rs1800031_G rs1800460 reverse rs1800460 rs1800460 rs1800460_C rs1800460_C rs1800460_T rs1800460_T rs1800462 reverse rs1800462 rs1800462 rs1800462_C rs1800462_C rs1800462_G rs1800462_G rs1800497 reverse rs1800497 rs1800497 rs1800497_A rs1800497_A rs1800497_G rs1800497_G rs1800566 reverse rs1800566 rs1800566 rs1800566_A rs1800566_A rs1800566_G rs1800566_G rs1800584 reverse rs1800584 rs1800584 rs1800584_C rs1800584_C rs1800584_T rs1800584_T rs1800888 forward rs1800888 rs1800888 rs1800888_C rs1800888_C rs1800888_T rs1800888_T rs1801028 reverse rs1801028 rs1801028 rs1801028_C rs1801028_C rs1801028_G rs1801028_G rs1801030 reverse rs1801030 rs1801030 rs1801030_C rs1801030_C rs1801030_T rs1801030_T rs1801131 reverse rs1801131 rs1801131 rs1801131_G rs1801131_G rs1801131_T rs1801131_T rs1801133 reverse rs1801133 rs1801133 rs1801133_A rs1801133_A rs1801133_G rs1801133_G rs1801158 reverse rs1801158 rs1801158 rs1801158_C rs1801158_C rs1801158_T rs1801158_T rs1801159 reverse rs1801159 rs1801159 rs1801159_C rs1801159_C rs1801159_T rs1801159_T rs1801160 reverse rs1801160 rs1801160 rs1801160_C rs1801160_C rs1801160_T rs1801160_T rs1801252 forward rs1801252 rs1801252 rs1801252_A rs1801252_A rs1801252_G rs1801252_G rs1801253 forward rs1801253 rs1801253 rs1801253_C rs1801253_C rs1801253_G rs1801253_G rs1801265 reverse rs1801265 rs1801265 rs1801265_A rs1801265_A rs1801265_G rs1801265_G rs1801266 reverse rs1801266 rs1801266 rs1801266_A rs1801266_A rs1801266_G rs1801266_G rs1801267 reverse rs1801267 rs1801267 rs1801267_C rs1801267_C rs1801267_T rs1801267_T rs1801268 reverse rs1801268 rs1801268 rs1801268_A rs1801268_A rs1801268_C rs1801268_C rs1801272 reverse rs1801272 rs1801272 rs1801272_A rs1801272_A rs1801272_T rs1801272_T rs1801279 forward rs1801279 rs1801279 rs1801279_A rs1801279_A rs1801279_G rs1801279_G rs1801280 forward rs1801280 rs1801280 rs1801280_C rs1801280_C rs1801280_T rs1801280_T rs1805123 reverse rs1805123 rs1805123 rs1805123_A rs1805123_A rs1805123_C rs1805123_C rs1805123_G rs1805123_G rs1805123_T rs1805123_T rs1805124 reverse rs1805124 rs1805124 rs1805124_A rs1805124_A rs1805124_C rs1805124_C rs1805124_G rs1805124_G rs1805124_T rs1805124_T rs1805158 forward rs1805158 rs1805158 rs1805158_C rs1805158_C rs1805158_T rs1805158_T rs1809810 reverse rs1809810 rs1809810 rs1809810_A rs1809810_A rs1809810_T rs1809810_T rs1902023 reverse rs1902023 rs1902023 rs1902023_A rs1902023_A rs1902023_C rs1902023_C rs2032582 reverse rs2032582 rs2032582 rs2032582_A rs2032582_A rs2032582_C rs2032582_C rs2032582_T rs2032582_T rs20417 reverse rs20417 rs20417 rs20417_C rs20417_C rs20417_G rs20417_G rs2046934 reverse rs2046934 rs2046934 rs2046934_A rs2046934_A rs2046934_G rs2046934_G rs2066853 forward rs2066853 rs2066853 rs2066853_A rs2066853_A rs2066853_G rs2066853_G rs2069514 forward rs2069514 rs2069514 rs2069514_A rs2069514_A rs2069514_G rs2069514_G rs2069526 forward rs2069526 rs2069526 rs2069526_A rs2069526_A rs2069526_C rs2069526_C rs2069526_G rs2069526_G rs2069526_T rs2069526_T rs2115819 reverse rs2115819 rs2115819 rs2115819_A rs2115819_A rs2115819_G rs2115819_G rs2230037 reverse rs2230037 rs2230037 rs2230037_A rs2230037_A rs2230037_G rs2230037_G rs2231142 reverse rs2231142 rs2231142 rs2231142_A rs2231142_A rs2231142_C rs2231142_C rs2231142_G rs2231142_G rs2231142_T rs2231142_T rs2235013 reverse rs2235013 rs2235013 rs2235013_C rs2235013_C rs2235013_T rs2235013_T rs2235033 reverse rs2235033 rs2235033 rs2235033_A rs2235033_A rs2235033_G rs2235033_G rs2256871 reverse rs2256871 rs2256871 rs2256871_A rs2256871_A rs2256871_G rs2256871_G rs2257212 reverse rs2257212 rs2257212 rs2257212_C rs2257212_C rs2257212_T rs2257212_T rs2273697 forward rs2273697 rs2273697 rs2273697_A rs2273697_A rs2273697_G rs2273697_G rs2279341 forward rs2279341 rs2279341 rs2279341_C rs2279341_C rs2279341_G rs2279341_G rs2279342 forward rs2279342 rs2279342 rs2279342_A rs2279342_A rs2279342_T rs2279342_T rs2279343 forward rs2279343 rs2279343 rs2279343_A rs2279343_A rs2279343_G rs2279343_G rs2279344 forward rs2279344 rs2279344 rs2279344_A rs2279344_A rs2279344_G rs2279344_G rs2282143 forward rs2282143 rs2282143 rs2282143_C rs2282143_C rs2282143_T rs2282143_T rs2293616 reverse rs2293616 rs2293616 rs2293616_A rs2293616_A rs2293616_G rs2293616_G rs2306168 forward rs2306168 rs2306168 rs2306168_C rs2306168_C rs2306168_T rs2306168_T rs2306283 reverse rs2306283 rs2306283 rs2306283_A rs2306283_A rs2306283_G rs2306283_G rs2359612 forward rs2359612 rs2359612 rs2359612_A rs2359612_A rs2359612_G rs2359612_G rs2395029 forward rs2395029 rs2395029 rs2395029_G rs2395029_G rs2395029_T rs2395029_T rs2470890 forward rs2470890 rs2470890 rs2470890_C rs2470890_C rs2470890_T rs2470890_T rs2472304 forward rs2472304 rs2472304 rs2472304_A rs2472304_A rs2472304_C rs2472304_C rs2472304_G rs2472304_G rs2472304_T rs2472304_T rs2740574 reverse rs2740574 rs2740574 rs2740574_C rs2740574_C rs2740574_T rs2740574_T rs28365083 reverse rs28365083 rs28365083 rs28365083_G rs28365083_G rs28365083_T rs28365083_T rs28365085 reverse rs28365085 rs28365085 rs28365085_A rs28365085_A rs28365085_C rs28365085_C rs28365085_G rs28365085_G rs28365085_T rs28365085_T rs28371685 forward rs28371685 rs28371685 rs28371685_C rs28371685_C rs28371685_T rs28371685_T rs28371686 forward rs28371686 rs28371686 rs28371686_C rs28371686_C rs28371686_G rs28371686_G rs28371706 reverse rs28371706 rs28371706 rs28371706_A rs28371706_A rs28371706_G rs28371706_G rs28371725 reverse rs28371725 rs28371725 rs28371725_C rs28371725_C rs28371725_T rs28371725_T rs28371759 reverse rs28371759 rs28371759 rs28371759_A rs28371759_A rs28371759_G rs28371759_G rs28374453 forward rs28374453 rs28374453 rs28374453_A rs28374453_A rs28374453_G rs28374453_G rs28383468 reverse rs28383468 rs28383468 rs28383468_A rs28383468_A rs28383468_G rs28383468_G rs28383479 reverse rs28383479 rs28383479 rs28383479_C rs28383479_C rs28383479_T rs28383479_T rs28399424 forward rs28399424 rs28399424 rs28399424_C rs28399424_C rs28399424_T rs28399424_T rs28399433 reverse rs28399433 rs28399433 rs28399433_A rs28399433_A rs28399433_C rs28399433_C rs28399434 reverse rs28399434 rs28399434 rs28399434_C rs28399434_C rs28399434_T rs28399434_T rs28399435 reverse rs28399435 rs28399435 rs28399435_C rs28399435_C rs28399435_T rs28399435_T rs28399444 reverse rs28399444 rs28399444 rs28399444_- rs28399444_- rs28399444_TT rs28399444_TT rs28399447 reverse rs28399447 rs28399447 rs28399447_A rs28399447_A rs28399447_G rs28399447_G rs28399454 reverse rs28399454 rs28399454 rs28399454_C rs28399454_C rs28399454_T rs28399454_T rs28399468 reverse rs28399468 rs28399468 rs28399468_A rs28399468_A rs28399468_C rs28399468_C rs28399499 forward rs28399499 rs28399499 rs28399499_C rs28399499_C rs28399499_T rs28399499_T rs28399504 forward rs28399504 rs28399504 rs28399504_A rs28399504_A rs28399504_G rs28399504_G rs28399513 forward rs28399513 rs28399513 rs28399513_A rs28399513_A rs28399513_T rs28399513_T rs2844682 reverse rs2844682 rs2844682 rs2844682_A rs2844682_A rs2844682_G rs2844682_G rs2884737 forward rs2884737 rs2884737 rs2884737_A rs2884737_A rs2884737_C rs2884737_C rs3092995 reverse rs3092995 rs3092995 rs3092995_C rs3092995_C rs3092995_G rs3092995_G rs316019 reverse rs316019 rs316019 rs316019_A rs316019_A rs316019_C rs316019_C rs3211369 forward rs3211369 rs3211369 rs3211369_A rs3211369_A rs3211369_G rs3211369_G rs3211371 forward rs3211371 rs3211371 rs3211371_C rs3211371_C rs3211371_T rs3211371_T rs3213619 reverse rs3213619 rs3213619 rs3213619_A rs3213619_A rs3213619_G rs3213619_G rs33926104 forward rs33926104 rs33926104 rs33926104_A rs33926104_A rs33926104_C rs33926104_C rs33973337 forward rs33973337 rs33973337 rs33973337_A rs33973337_A rs33973337_T rs33973337_T rs33980385 forward rs33980385 rs33980385 rs33980385_A rs33980385_A rs33980385_G rs33980385_G rs34059508 forward rs34059508 rs34059508 rs34059508_A rs34059508_A rs34059508_C rs34059508_C rs34059508_G rs34059508_G rs34097093 forward rs34097093 rs34097093 rs34097093_C rs34097093_C rs34097093_T rs34097093_T rs34130495 forward rs34130495 rs34130495 rs34130495_A rs34130495_A rs34130495_G rs34130495_G rs34223104 forward rs34223104 rs34223104 rs34223104_C rs34223104_C rs34223104_T rs34223104_T rs34284776 forward rs34284776 rs34284776 rs34284776_C rs34284776_C rs34284776_G rs34284776_G rs34489327 forward rs34489327 rs34489327 rs34489327_- rs34489327_- rs34489327_TTAAAG rs34489327_TTAAAG rs34671512 forward rs34671512 rs34671512 rs34671512_A rs34671512_A rs34671512_C rs34671512_C rs34698757 forward rs34698757 rs34698757 rs34698757_C rs34698757_C rs34698757_G rs34698757_G rs34743033 forward rs34743033 rs34743033 rs34743033_3 rs34743033_3 rs34743033_4 rs34743033_4 rs34743033__CCGCGCCACTTCGCCTGCCTCCGTCCCG_2 rs34743033__CCGCGCCACTTCGCCTGCCTCCGTCCCG_2 rs34826503 forward rs34826503 rs34826503 rs34826503_C rs34826503_C rs34826503_T rs34826503_T rs34883432 forward rs34883432 rs34883432 rs34883432_A rs34883432_A rs34883432_T rs34883432_T rs34946978 forward rs34946978 rs34946978 rs34946978_C rs34946978_C rs34946978_T rs34946978_T rs34993780 forward rs34993780 rs34993780 rs34993780_A rs34993780_A rs34993780_G rs34993780_G rs34993780_T rs34993780_T rs35010098 forward rs35010098 rs35010098 rs35010098_A rs35010098_A rs35010098_C rs35010098_C rs35266616 forward rs35266616 rs35266616 rs35266616_C rs35266616_C rs35266616_T rs35266616_T rs35303484 forward rs35303484 rs35303484 rs35303484_A rs35303484_A rs35303484_G rs35303484_G rs35303484_T rs35303484_T rs35350960 forward rs35350960 rs35350960 rs35350960_A rs35350960_A rs35350960_C rs35350960_C rs35350960_T rs35350960_T rs35468935 forward rs35468935 rs35468935 rs35468935_C rs35468935_C rs35468935_T rs35468935_T rs35622401 forward rs35622401 rs35622401 rs35622401_C rs35622401_C rs35622401_G rs35622401_G rs35694136 forward rs35694136 rs35694136 rs35694136_- rs35694136_- rs35694136_T rs35694136_T rs35742686 reverse rs35742686 rs35742686 rs35742686_- rs35742686_- rs35742686_T rs35742686_T rs35773040 forward rs35773040 rs35773040 rs35773040_A rs35773040_A rs35773040_G rs35773040_G rs35796837 forward rs35796837 rs35796837 rs35796837_A rs35796837_A rs35796837_G rs35796837_G rs35979566 forward rs35979566 rs35979566 rs35979566_A rs35979566_A rs35979566_T rs35979566_T rs36056539 forward rs36056539 rs36056539 rs36056539_C rs36056539_C rs36056539_T rs36056539_T rs36060847 forward rs36060847 rs36060847 rs36060847_A rs36060847_A rs36060847_G rs36060847_G rs36079186 forward rs36079186 rs36079186 rs36079186_C rs36079186_C rs36079186_T rs36079186_T rs36103319 forward rs36103319 rs36103319 rs36103319_C rs36103319_C rs36103319_G rs36103319_G rs36103319_T rs36103319_T rs36210421 reverse rs36210421 rs36210421 rs36210421_A rs36210421_A rs36210421_C rs36210421_C rs3740066 reverse rs3740066 rs3740066 rs3740066_C rs3740066_C rs3740066_T rs3740066_T rs3745274 forward rs3745274 rs3745274 rs3745274_G rs3745274_G rs3745274_T rs3745274_T rs3758580 forward rs3758580 rs3758580 rs3758580_C rs3758580_C rs3758580_T rs3758580_T rs3758581 forward rs3758581 rs3758581 rs3758581_A rs3758581_A rs3758581_C rs3758581_C rs3758581_G rs3758581_G rs3758581_T rs3758581_T rs3761738 forward rs3761738 rs3761738 rs3761738_C rs3761738_C rs3761738_T rs3761738_T rs3761739 forward rs3761739 rs3761739 rs3761739_C rs3761739_C rs3761739_T rs3761739_T rs3807375 reverse rs3807375 rs3807375 rs3807375_C rs3807375_C rs3807375_T rs3807375_T rs3814055 forward rs3814055 rs3814055 rs3814055_C rs3814055_C rs3814055_T rs3814055_T rs3815459 reverse rs3815459 rs3815459 rs3815459_A rs3815459_A rs3815459_C rs3815459_C rs3815459_G rs3815459_G rs3815459_T rs3815459_T rs3826711 forward rs3826711 rs3826711 rs3826711_C rs3826711_C rs3826711_G rs3826711_G rs3846662 reverse rs3846662 rs3846662 rs3846662_A rs3846662_A rs3846662_C rs3846662_C rs3846662_G rs3846662_G rs3846662_T rs3846662_T rs3846663 forward rs3846663 rs3846663 rs3846663_C rs3846663_C rs3846663_T rs3846663_T rs3892097 reverse rs3892097 rs3892097 rs3892097_C rs3892097_C rs3892097_T rs3892097_T rs3909184 reverse rs3909184 rs3909184 rs3909184_C rs3909184_C rs3909184_G rs3909184_G rs3918290 reverse rs3918290 rs3918290 rs3918290_C rs3918290_C rs3918290_T rs3918290_T rs4124874 reverse rs4124874 rs4124874 rs4124874_G rs4124874_G rs4124874_T rs4124874_T rs41279854 forward rs41279854 rs41279854 rs41279854_A rs41279854_A rs41279854_G rs41279854_G rs41279857 forward rs41279857 rs41279857 rs41279857_C rs41279857_C rs41279857_G rs41279857_G rs41279857_T rs41279857_T rs41291556 forward rs41291556 rs41291556 rs41291556_C rs41291556_C rs41291556_T rs41291556_T rs41303343 reverse rs41303343 rs41303343 rs41303343_- rs41303343_- rs41303343_A rs41303343_A rs4148323 forward rs4148323 rs4148323 rs4148323_A rs4148323_A rs4148323_G rs4148323_G rs4149015 forward rs4149015 rs4149015 rs4149015_A rs4149015_A rs4149015_G rs4149015_G rs4149056 forward rs4149056 rs4149056 rs4149056_A rs4149056_A rs4149056_C rs4149056_C rs4149056_G rs4149056_G rs4149056_T rs4149056_T rs4149117 forward rs4149117 rs4149117 rs4149117_G rs4149117_G rs4149117_T rs4149117_T rs4244285 forward rs4244285 rs4244285 rs4244285_A rs4244285_A rs4244285_C rs4244285_C rs4244285_G rs4244285_G rs4417205 forward rs4417205 rs4417205 rs4417205_C rs4417205_C rs4417205_G rs4417205_G rs45482602 forward rs45482602 rs45482602 rs45482602_A rs45482602_A rs45482602_C rs45482602_C rs45482602_T rs45482602_T rs45486893 forward rs45486893 rs45486893 rs45486893_C rs45486893_C rs45486893_T rs45486893_T rs4629571 forward rs4629571 rs4629571 rs4629571_A rs4629571_A rs4629571_G rs4629571_G rs4633 forward rs4633 rs4633 rs4633_C rs4633_C rs4633_T rs4633_T rs4646277 forward rs4646277 rs4646277 rs4646277_C rs4646277_C rs4646277_T rs4646277_T rs4646278 forward rs4646278 rs4646278 rs4646278_C rs4646278_C rs4646278_G rs4646278_G rs4646438 reverse rs4646438 rs4646438 rs4646438_- rs4646438_- rs4646438_T rs4646438_T rs4680 forward rs4680 rs4680 rs4680_A rs4680_A rs4680_C rs4680_C rs4680_G rs4680_G rs4680_T rs4680_T rs4704209 forward rs4704209 rs4704209 rs4704209_A rs4704209_A rs4704209_C rs4704209_C rs4704209_G rs4704209_G rs4704209_T rs4704209_T rs4802101 forward rs4802101 rs4802101 rs4802101_C rs4802101_C rs4802101_T rs4802101_T rs4803418 forward rs4803418 rs4803418 rs4803418_C rs4803418_C rs4803418_G rs4803418_G rs4803419 forward rs4803419 rs4803419 rs4803419_C rs4803419_C rs4803419_T rs4803419_T rs4818 forward rs4818 rs4818 rs4818_C rs4818_C rs4818_G rs4818_G rs4818_T rs4818_T rs4917623 forward rs4917623 rs4917623 rs4917623_C rs4917623_C rs4917623_T rs4917623_T rs4986782 forward rs4986782 rs4986782 rs4986782_A rs4986782_A rs4986782_G rs4986782_G rs4986783 forward rs4986783 rs4986783 rs4986783_G rs4986783_G rs4986783_T rs4986783_T rs4986850 reverse rs4986850 rs4986850 rs4986850_C rs4986850_C rs4986850_T rs4986850_T rs4986852 reverse rs4986852 rs4986852 rs4986852_C rs4986852_C rs4986852_T rs4986852_T rs4986891 reverse rs4986891 rs4986891 rs4986891_A rs4986891_A rs4986891_C rs4986891_C rs4986891_T rs4986891_T rs4986893 forward rs4986893 rs4986893 rs4986893_A rs4986893_A rs4986893_G rs4986893_G rs4986894 forward rs4986894 rs4986894 rs4986894_C rs4986894_C rs4986894_T rs4986894_T rs4986907 reverse rs4986907 rs4986907 rs4986907_C rs4986907_C rs4986907_T rs4986907_T rs4986908 reverse rs4986908 rs4986908 rs4986908_C rs4986908_C rs4986908_G rs4986908_G rs4986908_T rs4986908_T rs4986909 reverse rs4986909 rs4986909 rs4986909_A rs4986909_A rs4986909_G rs4986909_G rs4986910 reverse rs4986910 rs4986910 rs4986910_A rs4986910_A rs4986910_G rs4986910_G rs4986913 reverse rs4986913 rs4986913 rs4986913_A rs4986913_A rs4986913_G rs4986913_G rs4987161 reverse rs4987161 rs4987161 rs4987161_A rs4987161_A rs4987161_G rs4987161_G rs5030655 reverse rs5030655 rs5030655 rs5030655_- rs5030655_- rs5030655_A rs5030655_A rs5030656 reverse rs5030656 rs5030656 rs5030656_- rs5030656_- rs5030656_TTC rs5030656_TTC rs5030839 forward rs5030839 rs5030839 rs5030839_C rs5030839_C rs5030839_T rs5030839_T rs5030862 reverse rs5030862 rs5030862 rs5030862_C rs5030862_C rs5030862_T rs5030862_T rs5030863 reverse rs5030863 rs5030863 rs5030863_C rs5030863_C rs5030863_G rs5030863_G rs5030865 forward rs5030865 rs5030865 rs5030865_C rs5030865_C rs5030865_G rs5030865_G rs5030865_T rs5030865_T rs5030867 reverse rs5030867 rs5030867 rs5030867_G rs5030867_G rs5030867_T rs5030867_T rs5030868 reverse rs5030868 rs5030868 rs5030868_A rs5030868_A rs5030868_G rs5030868_G rs5031016 reverse rs5031016 rs5031016 rs5031016_A rs5031016_A rs5031016_G rs5031016_G rs5031017 reverse rs5031017 rs5031017 rs5031017_A rs5031017_A rs5031017_C rs5031017_C rs5219 forward rs5219 rs5219 rs5219_A rs5219_A rs5219_C rs5219_C rs5219_G rs5219_G rs5219_T rs5219_T rs5275 reverse rs5275 rs5275 rs5275_A rs5275_A rs5275_G rs5275_G rs55640102 forward rs55640102 rs55640102 rs55640102_A rs55640102_A rs55640102_C rs55640102_C rs55640102_T rs55640102_T rs55737008 forward rs55737008 rs55737008 rs55737008_A rs55737008_A rs55737008_G rs55737008_G rs55750087 forward rs55750087 rs55750087 rs55750087_C rs55750087_C rs55750087_G rs55750087_G rs55752064 forward rs55752064 rs55752064 rs55752064_A rs55752064_A rs55752064_C rs55752064_C rs55752064_T rs55752064_T rs55785340 forward rs55785340 rs55785340 rs55785340_A rs55785340_A rs55785340_G rs55785340_G rs55793712 forward rs55793712 rs55793712 rs55793712_A rs55793712_A rs55793712_G rs55793712_G rs55793712_T rs55793712_T rs55817950 forward rs55817950 rs55817950 rs55817950_A rs55817950_A rs55817950_G rs55817950_G rs55886062 forward rs55886062 rs55886062 rs55886062_A rs55886062_A rs55886062_C rs55886062_C rs55886062_T rs55886062_T rs55901008 forward rs55901008 rs55901008 rs55901008_A rs55901008_A rs55901008_C rs55901008_C rs55901008_T rs55901008_T rs55918055 forward rs55918055 rs55918055 rs55918055_A rs55918055_A rs55918055_C rs55918055_C rs55918055_T rs55918055_T rs55965422 forward rs55965422 rs55965422 rs55965422_A rs55965422_A rs55965422_G rs55965422_G rs55965422_T rs55965422_T rs56061388 forward rs56061388 rs56061388 rs56061388_C rs56061388_C rs56061388_T rs56061388_T rs56101265 forward rs56101265 rs56101265 rs56101265_C rs56101265_C rs56101265_T rs56101265_T rs56107638 forward rs56107638 rs56107638 rs56107638_A rs56107638_A rs56107638_C rs56107638_C rs56107638_G rs56107638_G rs56160784 forward rs56160784 rs56160784 rs56160784_C rs56160784_C rs56160784_G rs56160784_G rs56161402 forward rs56161402 rs56161402 rs56161402_A rs56161402_A rs56161402_C rs56161402_C rs56161402_G rs56161402_G rs56161402_T rs56161402_T rs56165452 forward rs56165452 rs56165452 rs56165452_A rs56165452_A rs56165452_C rs56165452_C rs56165452_T rs56165452_T rs56172717 forward rs56172717 rs56172717 rs56172717_A rs56172717_A rs56172717_T rs56172717_T rs56199088 forward rs56199088 rs56199088 rs56199088_A rs56199088_A rs56199088_G rs56199088_G rs56199088_T rs56199088_T rs56199535 forward rs56199535 rs56199535 rs56199535_C rs56199535_C rs56199535_G rs56199535_G rs56199535_T rs56199535_T rs56220353 forward rs56220353 rs56220353 rs56220353_C rs56220353_C rs56220353_G rs56220353_G rs56220353_T rs56220353_T rs56244447 forward rs56244447 rs56244447 rs56244447_A rs56244447_A rs56244447_C rs56244447_C rs56276455 forward rs56276455 rs56276455 rs56276455_A rs56276455_A rs56276455_G rs56276455_G rs5629 reverse rs5629 rs5629 rs56296335 forward rs56296335 rs56296335 rs56296335_A rs56296335_A rs56296335_C rs56296335_C rs56296335_G rs56296335_G rs56296335_T rs56296335_T rs5629_G rs5629_G rs5629_T rs5629_T rs56313657 forward rs56313657 rs56313657 rs56313657_A rs56313657_A rs56313657_C rs56313657_C rs56313657_T rs56313657_T rs56318881 forward rs56318881 rs56318881 rs56318881_C rs56318881_C rs56318881_T rs56318881_T rs56337013 forward rs56337013 rs56337013 rs56337013_C rs56337013_C rs56337013_T rs56337013_T rs56379106 forward rs56379106 rs56379106 rs56379106_C rs56379106_C rs56379106_T rs56379106_T rs56387224 forward rs56387224 rs56387224 rs56387224_A rs56387224_A rs56387224_G rs56387224_G rs56387224_T rs56387224_T rs56411402 forward rs56411402 rs56411402 rs56411402_C rs56411402_C rs56411402_T rs56411402_T rs57505750 forward rs57505750 rs57505750 rs57505750_C rs57505750_C rs57505750_T rs57505750_T rs5853517 forward rs5853517 rs5853517 rs5853517_- rs5853517_- rs5853517_T rs5853517_T rs58973490 forward rs58973490 rs58973490 rs58973490_A rs58973490_A rs58973490_G rs58973490_G rs59113707 forward rs59113707 rs59113707 rs59113707_C rs59113707_C rs59113707_G rs59113707_G rs59421388 forward rs59421388 rs59421388 rs59421388_C rs59421388_C rs59421388_T rs59421388_T rs59502379 forward rs59502379 rs59502379 rs59502379_C rs59502379_C rs59502379_G rs59502379_G rs59710386 forward rs59710386 rs59710386 rs59710386_A rs59710386_A rs59710386_C rs59710386_C rs6025 reverse rs6025 rs6025 rs6025_C rs6025_C rs6025_T rs6025_T rs61736512 forward rs61736512 rs61736512 rs61736512_C rs61736512_C rs61736512_T rs61736512_T rs6269 forward rs6269 rs6269 rs6269_A rs6269_A rs6269_G rs6269_G rs6277 reverse rs6277 rs6277 rs6277_A rs6277_A rs6277_G rs6277_G rs628031 forward rs628031 rs628031 rs628031_A rs628031_A rs628031_C rs628031_C rs628031_G rs628031_G rs628031_T rs628031_T rs6413438 forward rs6413438 rs6413438 rs6413438_C rs6413438_C rs6413438_T rs6413438_T rs6453131 forward rs6453131 rs6453131 rs6453131_A rs6453131_A rs6453131_C rs6453131_C rs6453131_G rs6453131_G rs6453131_T rs6453131_T rs67807361 forward rs67807361 rs67807361 rs67807361_A rs67807361_A rs67807361_C rs67807361_C rs6791924 forward rs6791924 rs6791924 rs6791924_A rs6791924_A rs6791924_G rs6791924_G rs6809699 forward rs6809699 rs6809699 rs6809699_A rs6809699_A rs6809699_C rs6809699_C rs689466 reverse rs689466 rs689466 rs689466_C rs689466_C rs689466_T rs689466_T rs701265 forward rs701265 rs701265 rs701265_A rs701265_A rs701265_G rs701265_G rs7088784 forward rs7088784 rs7088784 rs7088784_A rs7088784_A rs7088784_G rs7088784_G rs717620 reverse rs717620 rs717620 rs717620_A rs717620_A rs717620_C rs717620_C rs717620_G rs717620_G rs717620_T rs717620_T rs7196161 forward rs7196161 rs7196161 rs7196161_A rs7196161_A rs7196161_G rs7196161_G rs72547511 forward rs72547511 rs72547511 rs72547511_C rs72547511_C rs72547511_G rs72547511_G rs72547512 forward rs72547512 rs72547512 rs72547512_C rs72547512_C rs72547512_G rs72547512_G rs72547513 forward rs72547513 rs72547513 rs72547513_A rs72547513_A rs72547513_C rs72547513_C rs72547515 reverse rs72547515 rs72547515 rs72547515_A rs72547515_A rs72547515_G rs72547515_G rs72547516 forward rs72547516 rs72547516 rs72547516_A rs72547516_A rs72547516_G rs72547516_G rs72547516_T rs72547516_T rs72547517 forward rs72547517 rs72547517 rs72547517_A rs72547517_A rs72547517_G rs72547517_G rs72549303 reverse rs72549303 rs72549303 rs72549303_- rs72549303_- rs72549303_G rs72549303_G rs72549306 forward rs72549306 rs72549306 rs72549306_A rs72549306_A rs72549306_C rs72549306_C rs72549309 forward rs72549309 rs72549309 rs72549309_- rs72549309_- rs72549309_ATGA rs72549309_ATGA rs72552267 forward rs72552267 rs72552267 rs72552267_A rs72552267_A rs72552267_G rs72552267_G rs72552791 reverse rs72552791 rs72552791 rs72552791_C rs72552791_C rs72552791_T rs72552791_T rs72558184 forward rs72558184 rs72558184 rs72558184_A rs72558184_A rs72558184_G rs72558184_G rs72558186 forward rs72558186 rs72558186 rs72558186_A rs72558186_A rs72558186_T rs72558186_T rs72558187 forward rs72558187 rs72558187 rs72558187_C rs72558187_C rs72558187_T rs72558187_T rs72558188 forward rs72558188 rs72558188 rs72558188_- rs72558188_- rs72558188_AGAAATGGAA rs72558188_AGAAATGGAA rs72558189 forward rs72558189 rs72558189 rs72558189_A rs72558189_A rs72558189_G rs72558189_G rs72558190 forward rs72558190 rs72558190 rs72558190_A rs72558190_A rs72558190_C rs72558190_C rs72558192 forward rs72558192 rs72558192 rs72558192_A rs72558192_A rs72558192_G rs72558192_G rs72558193 forward rs72558193 rs72558193 rs72558193_A rs72558193_A rs72558193_C rs72558193_C rs72559745 forward rs72559745 rs72559745 rs72559745_A rs72559745_A rs72559745_G rs72559745_G rs72559748 forward rs72559748 rs72559748 rs72559748_A rs72559748_A rs72559748_G rs72559748_G rs7294 reverse rs7294 rs7294 rs7294_C rs7294_C rs7294_T rs7294_T rs7311358 forward rs7311358 rs7311358 rs7311358_A rs7311358_A rs7311358_G rs7311358_G rs7439366 forward rs7439366 rs7439366 rs7439366_C rs7439366_C rs7439366_T rs7439366_T rs762551 forward rs762551 rs762551 rs762551_A rs762551_A rs762551_C rs762551_C rs762551_G rs762551_G rs762551_T rs762551_T rs7626962 forward rs7626962 rs7626962 rs7626962_A rs7626962_A rs7626962_C rs7626962_C rs7626962_G rs7626962_G rs7626962_T rs7626962_T rs76293380 forward rs76293380 rs76293380 rs76293380_- rs76293380_- rs76293380_A rs76293380_A rs76723693 reverse rs76723693 rs76723693 rs76723693_A rs76723693_A rs76723693_G rs76723693_G rs776746 reverse rs776746 rs776746 rs776746_C rs776746_C rs776746_T rs776746_T rs78060119 forward rs78060119 rs78060119 rs78060119_A rs78060119_A rs78060119_C rs78060119_C rs7900194 forward rs7900194 rs7900194 rs7900194_A rs7900194_A rs7900194_G rs7900194_G rs7902257 forward rs7902257 rs7902257 rs7902257_A rs7902257_A rs7902257_G rs7902257_G rs79135870 forward rs79135870 rs79135870 rs79135870_A rs79135870_A rs79135870_G rs79135870_G rs7916649 forward rs7916649 rs7916649 rs7916649_A rs7916649_A rs7916649_G rs7916649_G rs799912 forward rs799912 rs799912 rs799912_C rs799912_C rs799912_T rs799912_T rs799917 reverse rs799917 rs799917 rs799917_A rs799917_A rs799917_G rs799917_G rs799917_T rs799917_T rs80081766 forward rs80081766 rs80081766 rs80081766_C rs80081766_C rs80081766_T rs80081766_T rs8050894 forward rs8050894 rs8050894 rs8050894_C rs8050894_C rs8050894_G rs8050894_G rs8175347 forward rs8175347 rs8175347 rs8175347_6 rs8175347_6 rs8175347_7 rs8175347_7 rs8175347_8 rs8175347_8 rs8175347__TA_5 rs8175347__TA_5 rs8176318 reverse rs8176318 rs8176318 rs8176318_A rs8176318_A rs8176318_C rs8176318_C rs8177504 reverse rs8177504 rs8177504 rs8177504_A rs8177504_A rs8177504_G rs8177504_G rs8177507 forward rs8177507 rs8177507 rs8177507_C rs8177507_C rs8177507_G rs8177507_G rs8177507_T rs8177507_T rs8177516 reverse rs8177516 rs8177516 rs8177516_A rs8177516_A rs8177516_G rs8177516_G rs8177517 reverse rs8177517 rs8177517 rs8177517_G rs8177517_G rs8177517_T rs8177517_T rs8192709 forward rs8192709 rs8192709 rs8192709_C rs8192709_C rs8192709_T rs8192709_T rs8192719 forward rs8192719 rs8192719 rs8192719_C rs8192719_C rs8192719_T rs8192719_T rs873478 reverse rs873478 rs873478 rs873478_C rs873478_C rs873478_G rs873478_G rs887829 reverse rs887829 rs887829 rs887829_A rs887829_A rs887829_C rs887829_C rs887829_G rs887829_G rs887829_T rs887829_T rs890293 reverse rs890293 rs890293 rs890293_A rs890293_A rs890293_C rs890293_C rs9282861 reverse rs9282861 rs9282861 rs9282861_C rs9282861_C rs9282861_T rs9282861_T rs9332130 forward rs9332130 rs9332130 rs9332130_A rs9332130_A rs9332130_G rs9332130_G rs9332131 forward rs9332131 rs9332131 rs9332131_- rs9332131_- rs9332131_A rs9332131_A rs9332239 forward rs9332239 rs9332239 rs9332239_C rs9332239_C rs9332239_T rs9332239_T rs9908805 forward rs9908805 rs9908805 rs9908805_C rs9908805_C rs9908805_T rs9908805_T rs9911630 forward rs9911630 rs9911630 rs9911630_A rs9911630_A rs9911630_G rs9911630_G rs9923231 forward rs9923231 rs9923231 rs9923231_A rs9923231_A rs9923231_C rs9923231_C rs9923231_G rs9923231_G rs9923231_T rs9923231_T rs9934438 forward rs9934438 rs9934438 rs9934438_A rs9934438_A rs9934438_G rs9934438_G 0.8.0 Contributors are those that engage in discussions in the context of the Genomic CDS ontology: Bob Freimuth, Michel Dumontier, Bob Powers, Simon Lin, Scott Marshall, Joanne Luciano, Richard Boyce, Eric Prud'Hommeaux Matthias Samwald, http://samwald.info/ Creative Commons 3.0 CC-by license If you want to contribute or report a bug, please write an e-mail to Matthias Samwald, samwald@gmx.at Pharmacogenomic Clinical Decision Support ontology ('Genomic CDS') 0.8.0