en BFO 2 Reference: BFO does not claim to provide complete coverage of entities of all types. It seeks only to provide coverage of those entities studied by empirical science together with those entities which affect or are involved in human activities such as data processing and planning - coverage that is sufficiently broad to provide assistance to those engaged in building domain ontologies for purposes of data annotation. BFO 2 Reference: BFO's treatment of continuants and occurrents - as also its treatment of regions, rests on a dichotomy between space and time, and on the view that there are two perspectives on reality - earlier called the 'SNAP' and 'SPAN' perspectives, both of which are essential to the non-reductionist representation of reality as we understand it from the best available science. BFO 2 Reference: For both terms and relational expressions in BFO, we distinguish between primitive and defined. 'Entity' is an example of a primitive term. Primitive terms in a highest-level ontology such as BFO are terms that are so basic to our understanding of reality that there is no way of defining them in a non-circular fashion. For these, therefore, we can provide only elucidations, supplemented by examples and by axioms. Adam Goldstein Alan Ruttenberg Alan Ruttenberg Albert Goldfain Albert Goldfain Asiyah Yu Lin Barry Smith Barry Smith Bill Duncan Bjoern Peters Bjoern Peters Carlo Torniai Chris Mungall Chris Mungall Chris Stoeckert Christian A. Boelling Darren Natale David Osumi-Sutherland David Osumi-Sutherland Fabian Neuhaus Gwen Frishkoff Harrison Strachan He Zhang Holger Stenzhorn Holger Stenzhorn James A. Overton James A. Overton James Malone Janna Hastings Jennifer Fostel Jie Zheng Jie Zheng Jingshan Huang Jonathan Bona Jonathan Rees Larisa Soldatova Larry Hunter Lawrence Hunter Leonard Jacuzzo Ludger Jansen Mark Ressler Mathias Brochhausen Mathias Brochhausen Matt Brush Mauricio Almeida Melanie Courtot Melanie Courtot Michel Dumontier Paolo Ciccarese Pat Hayes Philippe Rocca-Serra Pierre Grenon Randall Dipert Randy Dipert Ron Rudnicki Ron Rudnicki Satya Sahoo Selja Seppälä Sivaram Arabandi Stefan Schulz Thomas Bittner Werner Ceusters Werner Ceusters William Duncan William Hogan Yongqun "Oliver" He Yongqun (Oliver) He 2015-12-10 December 2015: This ontology is currently undergoing changes. ID deprecation policies will start in the next couple of months. In the mean time, identifiers may be deleted and not marked obsolete. Please see the project site https://github.com/BFO-ontology/BFO, the bfo2 owl discussion group http://groups.google.com/group/bfo-owl-devel, the bfo2 discussion group http://groups.google.com/group/bfo-devel, the tracking google doc http://goo.gl/IlrEE, and the current version of the bfo2 reference http://purl.obolibrary.org/obo/bfo/dev/bfo2-reference.docx. This ontology is generated from a specification at https://github.com/BFO-ontology/BFO/tree/master/src/ontology/owl-group/specification/ and with the code that generates the OWL version in https://github.com/BFO-ontology/BFO/tree/master/src/tools/. A very early version of BFO version 2 in CLIF is at http://purl.obolibrary.org/obo/bfo/dev/bfo.clif. The BSD license on the BFO project site refers to code used to build BFO. This BFO 2.0 version represents a major update to BFO and is not strictly backwards compatible with BFO 1.1. The previous OWL version of BFO, version 1.1.1 will remain available at http://ifomis.org/bfo/1.1 and will no longer be updated. The BFO 2.0 OWL is a classes-only specification. The incorporation of core relations has been held over for a later version. This is the release of December 12, 2015. It will always be available at http://purl.obolibrary.org/ncro/2015-12-10/ncro.owl. While current, this ontology is also available at http://purl.obolibrary.org/obo/ncro.owl This file is a merge of NCRO and any imported ontologies or terms. You can access the ontology that existed before the merge, with imports intact, at http://purl.obolibrary.org/obo/ncro/YYYY-MM-DD/ncro.owl or, for the current version, http://purl.obolibrary.org/obo/ncro/prebuild/ncro.owl This ontology is currently undergoing changes. ID deprecation policies will start in the next couple of months. In the mean time, identifiers may be deleted and not marked obsolete. d Relates an entity in the ontology to the name of the variable that is used to represent it in the code that generates the BFO OWL file from the lispy specification. Really of interest to developers only BFO OWL specification label Relates an entity in the ontology to the term that is used to represent it in the the CLIF specification of BFO2 Person:Alan Ruttenberg Really of interest to developers only BFO CLIF specification label editor preferred label editor preferred term The concise, meaningful, and human-friendly name for a class or property preferred by the ontology developers. (US-English) PERSON:Daniel Schober GROUP:OBI:<http://purl.obolibrary.org/obo/obi> editor preferred label editor preferred term editor preferred term example example of usage A phrase describing how a class name should be used. May also include other kinds of examples that facilitate immediate understanding of a class semantics, such as widely known prototypical subclasses or instances of the class. Although essential for high level terms, examples for low level terms (e.g., Affymetrix HU133 array) are not A phrase describing how a term should be used and/or a citation to a work which uses it. May also include other kinds of examples that facilitate immediate understanding, such as widely know prototypes or instances of a class, or cases where a relation is said to hold. PERSON:Daniel Schober GROUP:OBI:<http://purl.obolibrary.org/obo/obi> example of usage in branch An annotation property indicating which module the terms belong to. This is currently experimental and not implemented yet. GROUP:OBI OBI_0000277 in branch has curation status PERSON:Alan Ruttenberg PERSON:Bill Bug PERSON:Melanie Courtot OBI_0000281 has curation status definition definition The official OBI definition, explaining the meaning of a class or property. Shall be Aristotelian, formalized and normalized. Can be augmented with colloquial definitions. The official definition, explaining the meaning of a class or property. Shall be Aristotelian, formalized and normalized. Can be augmented with colloquial definitions. 2012-04-05: Barry Smith The official OBI definition, explaining the meaning of a class or property: 'Shall be Aristotelian, formalized and normalized. Can be augmented with colloquial definitions' is terrible. Can you fix to something like: A statement of necessary and sufficient conditions explaining the meaning of an expression referring to a class or property. Alan Ruttenberg Your proposed definition is a reasonable candidate, except that it is very common that necessary and sufficient conditions are not given. Mostly they are necessary, occasionally they are necessary and sufficient or just sufficient. Often they use terms that are not themselves defined and so they effectively can't be evaluated by those criteria. On the specifics of the proposed definition: We don't have definitions of 'meaning' or 'expression' or 'property'. For 'reference' in the intended sense I think we use the term 'denotation'. For 'expression', I think we you mean symbol, or identifier. For 'meaning' it differs for class and property. For class we want documentation that let's the intended reader determine whether an entity is instance of the class, or not. For property we want documentation that let's the intended reader determine, given a pair of potential relata, whether the assertion that the relation holds is true. The 'intended reader' part suggests that we also specify who, we expect, would be able to understand the definition, and also generalizes over human and computer reader to include textual and logical definition. Personally, I am more comfortable weakening definition to documentation, with instructions as to what is desirable. We also have the outstanding issue of how to aim different definitions to different audiences. A clinical audience reading chebi wants a different sort of definition documentation/definition from a chemistry trained audience, and similarly there is a need for a definition that is adequate for an ontologist to work with. PERSON:Daniel Schober GROUP:OBI:<http://purl.obolibrary.org/obo/obi> definition definition textual definition editor note An administrative note intended for its editor. It may not be included in the publication version of the ontology, so it should contain nothing necessary for end users to understand the ontology. PERSON:Daniel Schober GROUP:OBI:<http://purl.obfoundry.org/obo/obi> editor note editor note IAO:0000116 term editor Name of editor entering the term in the file. The term editor is a point of contact for information regarding the term. The term editor may be, but is not always, the author of the definition, which may have been worked upon by several people 20110707, MC: label update to term editor and definition modified accordingly. See http://code.google.com/p/information-artifact-ontology/issues/detail?id=115. 20110707, MC: label update to term editor and definition modified accordingly. See https://github.com/information-artifact-ontology/IAO/issues/115. PERSON:Daniel Schober GROUP:OBI:<http://purl.obolibrary.org/obo/obi> term editor alternative term An alternative name for a class or property which means the same thing as the preferred name (semantically equivalent) PERSON:Daniel Schober GROUP:OBI:<http://purl.obolibrary.org/obo/obi> alternative term definition source formal citation, e.g. identifier in external database to indicate / attribute source(s) for the definition. Free text indicate / attribute source(s) for the definition. EXAMPLE: Author Name, URI, MeSH Term C04, PUBMED ID, Wiki uri on 31.01.2007 PERSON:Daniel Schober Discussion on obo-discuss mailing-list, see http://bit.ly/hgm99w GROUP:OBI:<http://purl.obolibrary.org/obo/obi> definition source has obsolescence reason Relates an annotation property to an obsolescence reason. The values of obsolescence reasons come from a list of predefined terms, instances of the class obsolescence reason specification. PERSON:Alan Ruttenberg PERSON:Melanie Courtot has obsolescence reason curator note An administrative note of use for a curator but of no use for a user PERSON:Alan Ruttenberg curator note term tracker item the URI for an OBI Terms ticket at sourceforge, such as https://sourceforge.net/p/obi/obi-terms/772/ An IRI or similar locator for a request or discussion of an ontology term. Person: Jie Zheng, Chris Stoeckert, Alan Ruttenberg Person: Jie Zheng, Chris Stoeckert, Alan Ruttenberg The 'tracker item' can associate a tracker with a specific ontology term. term tracker item The name of the person, project, or organization that motivated inclusion of an ontology term by requesting its addition. Person: Jie Zheng, Chris Stoeckert, Alan Ruttenberg Person: Jie Zheng, Chris Stoeckert, Alan Ruttenberg The 'term requester' can credit the person, organization or project who request the ontology term. ontology term requester is denotator type relates an class defined in an ontology, to the type of it's denotator In OWL 2 add AnnotationPropertyRange('is denotator type' 'denotator type') Alan Ruttenberg is denotator type imported from For external terms/classes, the ontology from which the term was imported PERSON:Alan Ruttenberg PERSON:Melanie Courtot GROUP:OBI:<http://purl.obolibrary.org/obo/obi> imported from expand expression to ObjectProperty: RO_0002104 Label: has plasma membrane part Annotations: IAO_0000424 "http://purl.obolibrary.org/obo/BFO_0000051 some (http://purl.org/obo/owl/GO#GO_0005886 and http://purl.obolibrary.org/obo/BFO_0000051 some ?Y)" A macro expansion tag applied to an object property (or possibly a data property) which can be used by a macro-expansion engine to generate more complex expressions from simpler ones Chris Mungall expand expression to expand assertion to ObjectProperty: RO??? Label: spatially disjoint from Annotations: expand_assertion_to "DisjointClasses: (http://purl.obolibrary.org/obo/BFO_0000051 some ?X) (http://purl.obolibrary.org/obo/BFO_0000051 some ?Y)" A macro expansion tag applied to an annotation property which can be expanded into a more detailed axiom. Chris Mungall expand assertion to first order logic expression PERSON:Alan Ruttenberg first order logic expression antisymmetric property part_of antisymmetric property xsd:true use boolean value xsd:true to indicate that the property is an antisymmetric property Alan Ruttenberg antisymmetric property antisymmetric property OBO foundry unique label An alternative name for a class or property which is unique across the OBO Foundry. The intended usage of that property is as follow: OBO foundry unique labels are automatically generated based on regular expressions provided by each ontology, so that SO could specify unique label = 'sequence ' + [label], etc. , MA could specify 'mouse + [label]' etc. Upon importing terms, ontology developers can choose to use the 'OBO foundry unique label' for an imported term or not. The same applies to tools . PERSON:Alan Ruttenberg PERSON:Bjoern Peters PERSON:Chris Mungall PERSON:Melanie Courtot GROUP:OBO Foundry <http://obofoundry.org/> OBO foundry unique label Ontology: <http://purl.obolibrary.org/obo/ro/idrange/> Annotations: 'has ID prefix': "http://purl.obolibrary.org/obo/RO_" 'has ID digit count' : 7, rdfs:label "RO id policy" 'has ID policy for': "RO" Relates an ontology used to record id policy to the number of digits in the URI. The URI is: the 'has ID prefix" annotation property value concatenated with an integer in the id range (left padded with "0"s to make this many digits) Person:Alan Ruttenberg has ID digit count Datatype: idrange:1 Annotations: 'has ID range allocated to': "Chris Mungall" EquivalentTo: xsd:integer[> 2151 , <= 2300] Relates a datatype that encodes a range of integers to the name of the person or organization who can use those ids constructed in that range to define new terms Person:Alan Ruttenberg has ID range allocated to Ontology: <http://purl.obolibrary.org/obo/ro/idrange/> Annotations: 'has ID prefix': "http://purl.obolibrary.org/obo/RO_" 'has ID digit count' : 7, rdfs:label "RO id policy" 'has ID policy for': "RO" Relating an ontology used to record id policy to the ontology namespace whose policy it manages Person:Alan Ruttenberg has ID policy for Ontology: <http://purl.obolibrary.org/obo/ro/idrange/> Annotations: 'has ID prefix': "http://purl.obolibrary.org/obo/RO_" 'has ID digit count' : 7, rdfs:label "RO id policy" 'has ID policy for': "RO" Relates an ontology used to record id policy to a prefix concatenated with an integer in the id range (left padded with "0"s to make this many digits) to construct an ID for a term being created. Person:Alan Ruttenberg has ID prefix elucidation person:Alan Ruttenberg Person:Barry Smith Primitive terms in a highest-level ontology such as BFO are terms which are so basic to our understanding of reality that there is no way of defining them in a non-circular fashion. For these, therefore, we can provide only elucidations, supplemented by examples and by axioms elucidation has associated axiom(nl) Person:Alan Ruttenberg Person:Alan Ruttenberg An axiom associated with a term expressed using natural language has associated axiom(nl) has associated axiom(fol) Person:Alan Ruttenberg Person:Alan Ruttenberg An axiom expressed in first order logic using CLIF syntax has associated axiom(fol) is allocated id range Add as annotation triples in the granting ontology Relates an ontology IRI to an (inclusive) range of IRIs in an OBO name space. The range is give as, e.g. "IAO_0020000-IAO_0020999" PERSON:Alan Ruttenberg is allocated id range A annotation relationship between two terms in an ontology that may refer to the same (natural) type but where more evidence is required before terms are merged. David Osumi-Sutherland #40 VFB 2018-09-21T16:43:39Z Edges asserting this should be annotated with to record evidence supporting the assertion and its provenance. may be identical to Used when the class or object is scheduled for obsoletion/deprecation on or after a particular date. Chris Mungall, Jie Zheng https://github.com/geneontology/go-ontology/issues/15532 https://github.com/information-artifact-ontology/ontology-metadata/issues/32 GO ontology scheduled for obsoletion on or after has axiom id Person:Alan Ruttenberg Person:Alan Ruttenberg A URI that is intended to be unique label for an axiom used for tracking change to the ontology. For an axiom expressed in different languages, each expression is given the same URI has axiom label term replaced by Add as annotation triples in the granting ontology Use on obsolete terms, relating the term to another term that can be used as a substitute Person:Alan Ruttenberg Person:Alan Ruttenberg term replaced by a core relation that holds between a part and its whole part_of part of is realized by realized_in realized in realizes x is preceded by y if and only if the time point at which y ends is before or equivalent to the time point at which x starts. Formally: x preceded by y iff ω(y) <= α(x), where α is a function that maps a process to a start point, and ω is a function that maps a process to an end point. is preceded by preceded_by preceded by b occurs_in c =def b is a process and c is a material entity or immaterial entity& there exists a spatiotemporal region r and b occupies_spatiotemporal_region r.& forall(t) if b exists_at t then c exists_at t & there exist spatial regions s and s’ where & b spatially_projects_onto s at t& c is occupies_spatial_region s’ at t& s is a proper_continuant_part_of s’ at t occurs_in unfolds in unfolds_in occurs in He_Zhang 2015-05-17T07:52:46Z is_predicted_target_of regulate_miRNA_transcription 2015-05-17T07:51:13Z has_predicted_target a relation between a specifically dependent continuant (the dependent) and an independent continuant (the bearer), in which the dependent specifically depends on the bearer for its existence inheres_in inheres in x regulates y if and only if the x is the realization of a function to exert an effect on the frequency, rate or extent of y Chris Mungall David Hill Tanya Berardini GO regulates x negatively regulates y if and only if the progression of x reduces the frequency, rate or extent of y Chris Mungall negatively regulates x positively regulates y if and only if the progression of x increases the frequency, rate or extent of y Chris Mungall positively regulates is member of is a mereological relation between a item and a collection. is member of member part of SIO member of has member is a mereological relation between a collection and an item. SIO has member Relation between biological objects that resemble or are related to each other sufficiently to warrant a comparison. sameness similar to in similarity relationship with ECO:0000041 SO:similar_to Similarity that results from common evolutionary origin. homologous to in homology relationship with Structural homology that involves a pseudogenic feature and its functional ancestor. non functional homologous to in non functional homology relationship with SO:non_functional_homolog_of A pre-miRNA processed from the primary transcript of a C.elegans ortholog of human gene MIRLET7I let-7 is found on chromosome X in Caenorhabditis elegans [1] and pairs to sites within the 3' untranslated region (UTR) of target mRNAs, specifying the translational repression of these mRNAs and triggering the transition to late-larval and adult stages [2]. MI0000001 Caenorhabditis elegans let-7 stem-loop A pre-miRNA processed from the primary transcript of a C.elegans ortholog of human gene MIR1-1 miR-1 was independently identified in C. elegans [1,2] and Drosophila melanogaster (MIR:MI0000116) [3]. The sequence is also conserved in C. briggsae (MIR:MI0000493). MI0000003 Caenorhabditis elegans miR-1 stem-loop A pre-miRNA processed from the primary transcript of a C.elegans ortholog of human gene MIR34C MI0000005 Caenorhabditis elegans miR-34 stem-loop A pre-miRNA processed from the primary transcript of a C.elegans ortholog of human gene MIR9-3 MI0000050 Caenorhabditis elegans miR-79 stem-loop A pre-miRNA processed from the primary transcript of human gene MIRLET7A1 let-7a-3p cloned in [6] has a 1 nt 3' extension (U), which is incompatible with the genome sequence. MI0000060 Homo sapiens let-7a-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIRLET7A2 MI0000061 Homo sapiens let-7a-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIRLET7A3 let-7a-3p cloned in [6] has a 1 nt 3' extension (U), which is incompatible with the genome sequence. MI0000062 Homo sapiens let-7a-3 stem-loop A pre-miRNA processed from the primary transcript of human gene MIRLET7B MI0000063 Homo sapiens let-7b stem-loop A pre-miRNA processed from the primary transcript of human gene MIRLET7C MI0000064 Homo sapiens let-7c stem-loop A pre-miRNA processed from the primary transcript of human gene MIRLET7D The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. MI0000065 Homo sapiens let-7d stem-loop A pre-miRNA processed from the primary transcript of human gene MIRLET7E The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. MI0000066 Homo sapiens let-7e stem-loop A pre-miRNA processed from the primary transcript of human gene MIRLET7F1 MI0000067 Homo sapiens let-7f-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIRLET7F2 MI0000068 Homo sapiens let-7f-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR15A Reference [1] named this sequence miR-15. This is renamed miR-15a here to avoid confusion with miR-15b (MIR:MI0000438) identified later by others. This gene and miR-16 are clustered within 0.5 kb at 13q14. This region has been shown to be deleted in more than half of B cell chronic lymphocytic leukemias (CLL). Both miR-15a and miR-16 are deleted or down-regulated in more than two thirds of CLL cases [2]. MI0000069 Homo sapiens miR-15a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR16-1 Human miR-16 has been cloned by independent groups [1,2]. This precursor sequence maps to chromosome 13, and was named mir-16 in [1] and mir-16-precursor-13 in [2]. Lim et al. reported 2 identical chromosome 13 loci, which appear to map to the same locus in subsequent genome assemblies. This gene and miR-15a are clustered within 0.5 kb at 13q14. This region has been shown to be deleted in more than half of B cell chronic lymphocytic leukemias (CLL). Both miR-15a and miR-16 are deleted or down-regulated in more than two thirds of CLL cases [3]. A second putative mir-16 hairpin precursor is located on chromosome 3 (MIR:MI0000738). MI0000070 Homo sapiens miR-16-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR17 MI0000071 Homo sapiens miR-17 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR18A This sequence maps to chromosome 13 and is named miR-18 precursor-13 in reference [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5]. MI0000072 Homo sapiens miR-18a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR19A This sequence maps to chromosome 13 and is named miR-19a precursor-13 in reference [2]. MI0000073 Homo sapiens miR-19a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR19B1 MI0000074 Homo sapiens miR-19b-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR19B2 MI0000075 Homo sapiens miR-19b-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR20A MI0000076 Homo sapiens miR-20a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR21 Mourelatos et al. named this sequence miR-21 precursor-17 and also reported the exact reverse complement of this predicted stem-loop sequence and erroneously assigned the name miR-104 [2]. MI0000077 Homo sapiens miR-21 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR22 MI0000078 Homo sapiens miR-22 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR23A This miRNA was previously named miR-23 [1,2] but is renamed here to avoid confusion with the more recently described miR-23b (MIR:MI0000439). Kawasaki and Taira reported that miR-23 regulates the transcriptional repressor Hairy enhancer of split (HES1) [3]. This finding was later retracted after the discovery that the regulated gene was human homolog of ES1 (HES1), whose function is unknown. MI0000079 Homo sapiens miR-23a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR24-1 MI0000080 Homo sapiens miR-24-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR24-2 mir-24-2 was identified independently by two groups. This sequence was named miR-24 precursor-19 in reference [2]. MI0000081 Homo sapiens miR-24-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR25 MI0000082 Homo sapiens miR-25 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR26A1 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [6]. MI0000083 Homo sapiens miR-26a-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR26B The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. MI0000084 Homo sapiens miR-26b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR27A This miRNA was previously named miR-27 [1,2] but is renamed here to avoid confusion with the more recently described miR-27b (MIR:MI0000440). MI0000085 Homo sapiens miR-27a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR28 MI0000086 Homo sapiens miR-28 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR29A miR-29a was previously know as miR-29 here and in [1]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [6]. MI0000087 Homo sapiens miR-29a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR30A The mature sequences miR-30 [1] and miR-97 [2] appear to originate from the same precursor. Subsequent data confirm that both arms of the precursor appear to give rise to mature miRNA sequences (Pfeffer S, pers. comm.). Landgraf et al. later showed that the 5' product is the predominant one [5]. Related miRNAs are processed from the 5' arms of other precursor loci (mir-30b, MIR:MI0000441; mir-30c-1, MIR:MI0000736; mir-30c-2, MIR:MI0000254; mir-30d, MIR:MI0000255; mir-30e, MI0000749). MI0000088 Homo sapiens miR-30a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR31 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations. MI0000089 Homo sapiens miR-31 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR32 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0000090 Homo sapiens miR-32 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR33A The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0000091 Homo sapiens miR-33a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR92A1 Human miR-92a (previously named miR-92 here) has two predicted hairpin precursor sequences: mir-92a-1 (MIR:MI0000093) on chromosome 13 (named mir-92-13 in [1]) and mir-92a-2 (MIR:MI0000094) on chromosome X (named mir-92-X in [1]). miR-92a has also been cloned from mouse embryonic stem cells [2] and is predicted to be expressed from two closely related precursor hairpins (MIR:MI0000719 and MIR:MI0000580). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [7]. MI0000093 Homo sapiens miR-92a-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR92A2 Human miR-92a (previously named miR-92 here) has two predicted hairpin precursor sequences: mir-92a-1 (MIR:MI0000093) on chromosome 13 (named mir-92-13 in [1]) and mir-92a-2 (MIR:MI0000094) on chromosome X (named mir-92-X in [1]). miR-92a has also been cloned from mouse embryonic stem cells [2] and is predicted to be expressed from two closely related precursor hairpins (MIR:MI0000719 and MIR:MI0000580). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [7]. MI0000094 Homo sapiens miR-92a-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR93 Mourelatos et al. identified two copies of this sequence mapping to chromosome 7, and assigned the names mir-93-7.1 and mir-93-7.2 [1]. Subsequent genome assemblies suggest the presence of only one miR-93 locus on chromosome 7. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5]. The 5' end of the miRNA may be offset with respect to previous annotations. MI0000095 Homo sapiens miR-93 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR95 This sequence is localised to chromosome 4 and was named mir-95-4 in reference [1]. MI0000097 Homo sapiens miR-95 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR96 This sequence is localised to chromosome 7 and was named mir-96-7 in reference [1]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0000098 Homo sapiens miR-96 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR98 This sequence is localised to chromosome X and was named mir-98-X in reference [1]. The predicted stem-loop precursor sequence is clearly related to let-7. MI0000100 Homo sapiens miR-98 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR99A This sequence is localised to chromosome 21 and was named mir-99-21 in reference [1]. MI0000101 Homo sapiens miR-99a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR100 This sequence is localised to chromosome 11 and was named mir-100-11 in reference [1]. MI0000102 Homo sapiens miR-100 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR101-1 Reference [1] reports two miR-101 precursor hairpin structures in human, on chromosome 1 (MIR:MI0000103) and 9 (MIR:MI0000739, named mir-101-precursor-9 in [1]). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. MI0000103 Homo sapiens miR-101-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR29B1 Mourelatos et al. identified two copies of this sequence mapping to chromosome 7, and assigned the names mir-102-7.1 and mir-102-7.2 [1]. Subsequent genome assemblies suggest the presence of only one miR-102 locus on chromosome 7. Human miR-102 is a homologue of mouse miR-29b (MIR:MI0000143) and so has been renamed here for consistency. MI0000105 Homo sapiens miR-29b-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR29B2 This sequence was named mir-102-1 in reference [1]. Human miR-102 is a homologue of mouse miR-29b (MIR:MI0000143) and so has been renamed here for consistency. MI0000107 Homo sapiens miR-29b-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR103A2 This sequence was localised to chromosome 20 and named mir-103-20 in reference [1]. MI0000108 Homo sapiens miR-103a-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR103A1 This sequence was localised to chromosome 5 and named mir-103-5 in reference [1]. MI0000109 Homo sapiens miR-103a-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR105-1 Mourelatos et al. [1] reported two identical predicted stem loop sequences located on chromosome X, which they named mir-105-X.1 and mir-105-X.2. These sequences have been renamed mir-105-1 (MIR:MI0000111) and mir-105-2 (MIR:MI0000112) here. mir-105-2 differs slightly from that published in [1] and deposited in EMBL (EMBL:AF480548). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0000111 Homo sapiens miR-105-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR105-2 Mourelatos et al. [1] reported two identical predicted stem loop sequences located on chromosome X, which they named mir-105-X.1 and mir-105-X.2. These sequences have been renamed mir-105-1 (MIR:MI0000111) and mir-105-2 (MIR:MI0000112) here. mir-105-2 differs slightly from that published in [1] and deposited in EMBL (EMBL:AF480548). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0000112 Homo sapiens miR-105-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR106A This miRNA was not cloned in reference [1], rather it was identified by homology to miR-91 (MIR:MI0000071). This sequence is localised to chromosome X and was named mir-106-X in [1]. Mouse and human miR-106a (MIR:MI0000406 and MIR:MI0000113) differ at two positions but the precursor sequences are clearly closely related. The sequences are also related to mir-17 (MIR:MI0000071 and MIR:MI0000687). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. MI0000113 Homo sapiens miR-106a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR107 This miRNA was identified by homology to miR-103 [1], and later verified by cloning in human [2]. MI0000114 Homo sapiens miR-107 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR16-2 This entry represents a second putative hairpin precursor sequence for miR-16, located on chromosome 3 (see also MIR:MI0000070). The sequence was previously named mir-16-3 here and in references [1] and [2]. MI0000115 Homo sapiens miR-16-2 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIRLET7I The mature sequence reported in [1] has a 3' terminal A residue, which is incompatible with the reported precursor sequence from [1] and in this entry. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. MI0000137 Mus musculus let-7g stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIRLET7I The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. MI0000138 Mus musculus let-7i stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR1-1 Lagos-Quintana et al. [1] reported the cloning of miR-1b, miR-1c and miR-1d. The mature processed miR sequences are identical apart from the 3' residues (A in mir-1b, C in mir-1c and UU in mir-1d). The 3' residues of both miR-1b and miR-1c conflict with the predicted stem-loop precursor sequence shown here and these sequences are not found in current assemblies of human and mouse genomes. It is suggested that polyA polymerase may add 1-3 nts to the 3' end of the mature transcript (Tom Tuschl, pers. comm.). The common 21 nts of the 3 reported miR sequences have been rationalised here and named miR-1. There are 2 pairs of orthologous putative hairpin precursor structures named mir-1-1 (human MIR:MI0000651, mouse MIR:MI0000139), and mir-1-2 (human MIR:MI0000437, mouse MIR:MI0000652). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0000139 Mus musculus miR-1a-1 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR195 MI0000140 Mus musculus miR-15b stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR23B MI0000141 Mus musculus miR-23b stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR27B MI0000142 Mus musculus miR-27b stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR29C MI0000143 Mus musculus miR-29b-1 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR30E Landgraf et al. confirm that the 5' mature miRNA product is the predominant one [4]. MI0000144 Mus musculus miR-30a stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR30E MI0000145 Mus musculus miR-30b stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR99B The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The 5' end of the miRNA may be offset with respect to previous annotations. MI0000146 Mus musculus miR-99a stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR99B Expression of this miRNA in mouse was independently verified in the brain [1], embryonic stem cells [2] and testes [3]. MI0000147 Mus musculus miR-99b stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR101-2 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. MI0000148 Mus musculus miR-101a stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR124-3 miR-124 was cloned from mouse brain [1] and embryonic stem cells [2] by independent groups. There are 3 predicted precursor hairpin sequences: mir-124-1 (MIR:MI0000716) on chromosome 14, mir-124-2 (MIR:MI0000717) on chromosome 3, and mir-124-3 (previously known as miR-124a here, MIR:MI0000150) on chromosome 2. All have closely related predicted human homologues (MIR:MI0000443, MIR:MI0000444 and MIR:MI0000445). Lagos-Quintana et al. also report a mature miRNA sequence miR-124b, with a G insertion at position 12 [1]. miR-124b is not found in either the mouse or human genome assemblies. MI0000150 Mus musculus miR-124-3 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR99B The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0000151 Mus musculus miR-125a stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR99B Mouse miR-125b was cloned from mouse brain tissues in [1]. There are 2 predicted hairpin precursor structures in the mouse genome, each has a closely related human homologue [2] (mir-125b-1, MIR:MI0000725; mir-125b-2, MIR:MI0000152; the latter was previously named mir-125b here). MI0000152 Mus musculus miR-125b-2 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR126 miR-123 identified in [1] was later found to originate from the same precursor as miR-126 and was hence renamed miR-126-5p. MI0000153 Mus musculus miR-126a stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR127 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [6]. MI0000154 Mus musculus miR-127 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR128-2 The most commonly cloned mature sequences derived from the previously annotated mir-128a and mir-128b were shown by Landgraf et al to be identical [3]. The sequences are therefore renamed mir-128-1 and mir-128-2. MI0000155 Mus musculus miR-128-1 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR301B This sequence was named miR-130 in reference [1], but is renamed here to avoid confusion with miR-130b (MIR:MI0000408). MI0000156 Mus musculus miR-130a stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR9-3 MI0000157 Mus musculus miR-9-2 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR132 MI0000158 Mus musculus miR-132 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR133B This mature miRNA sequence was named miR-133 in reference [1], and renamed miR-133a on subsequent identification of a homologue differing at the terminal 3' position (MIR:MI0000821). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The 5' end of the miRNA may be offset with respect to previous annotations. MI0000159 Mus musculus miR-133a-1 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR134 MI0000160 Mus musculus miR-134 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR135B MI0000161 Mus musculus miR-135a-1 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR136 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. MI0000162 Mus musculus miR-136 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR137 MI0000163 Mus musculus miR-137 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR138-1 Mouse miR-138 was cloned from mouse brain tissue in [1]. There are 2 predicted hairpin precursor structures in the mouse genome, each has a closely related human homologue [2]. mir-138-1 (MIR:MI0000722) is found on mouse chromosome 8, and mir-138-2 (MIR:MI0000164, previously named mir-138 here) on chromosome 9. Kim et al. and Obernosterer et al. independently show that the mature product is a 23mer [3,4]. MI0000164 Mus musculus miR-138-2 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR140 MI0000165 Mus musculus miR-140 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR429 MI0000166 Mus musculus miR-141 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR142 Expression of miRNAs from both 5' and 3' arms of this precursor have been independently verified in the mouse gut tissue [1] and in embryonic stem cells [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. MI0000167 Mus musculus miR-142 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR144 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0000168 Mus musculus miR-144 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR145 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0000169 Mus musculus miR-145 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR146B MI0000170 Mus musculus miR-146a stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR149 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0000171 Mus musculus miR-149 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR150 MI0000172 Mus musculus miR-150 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR151B MI0000173 Mus musculus miR-151 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR148B The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. MI0000174 Mus musculus miR-152 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR153-2 MI0000175 Mus musculus miR-153 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR323B MI0000176 Mus musculus miR-154 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR155 Mouse mir-155 resides in the non-coding BIC transcript (EMBL:AY096003), located on chromosome 16 [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. MI0000177 Mus musculus miR-155 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR99B The sequence of mouse miR-10b, as reported by Lagos-Quintana et al. [1], is offset by 2 nt in the 3' direction with respect to sequences cloned from human (MIR:MI0000267) and zebrafish (MIR:MI0001364). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations. MI0000221 Mus musculus miR-10b stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR129-2 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. MI0000222 Mus musculus miR-129-1 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR181D Mouse miR-181a (previously named miR-181 here and in [1]) was cloned from various mouse tissues in [1]. Expression has also been validated in zebrafish [2]. MI0000223 Mus musculus miR-181a-2 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR182 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. MI0000224 Mus musculus miR-182 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR183 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. MI0000225 Mus musculus miR-183 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR184 MI0000226 Mus musculus miR-184 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR185 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0000227 Mus musculus miR-185 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR186 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. MI0000228 Mus musculus miR-186 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR187 MI0000229 Mus musculus miR-187 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR660 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. MI0000230 Mus musculus miR-188 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR24-2 MI0000231 Mus musculus miR-24-1 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR190B MI0000232 Mus musculus miR-190 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR191 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. MI0000233 Mus musculus miR-191 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR192 Lagos-Quintana et al. validated the presence of an 18 nt excised sequence by cloning [1]. Lim et al. predicted the miR by computational methods using conservation with mouse and Fugu rubripes sequences. Expression of the excised miR was validated in zebrafish, and the 5' end mapped by PCR [2]. The 3' ends of the reported sequences differ by 3 nt - this entry contains the longer sequence. Lim et al. report three separate copies of this gene named mir-192-1, -2 and -3 based on 2001 human genome assemblies [2]. Subsequent assemblies suggest the presence of only one gene located on chromosome 11. MI0000234 Homo sapiens miR-192 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR193B The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. MI0000235 Mus musculus miR-193 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR194-2 Lagos-Quintana cloned miR-194 from mouse kidney tissue [1]. Michael et al. subsequently verified expression of miR-194 in human [2]. Two putative pairs of orthologous hairpin precursors structures are found in mouse (mir-194-1 (MIR:MI0000236) on chromosome 1, and mir-194-2 (MIR:MI0000733) on chromosome 19) and human (mir-194-1 (MIR:MI0000488) on chromosome 1, and mir-194-2 (MIR:MI0000732) on chromosome 11). MI0000236 Mus musculus miR-194-1 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR195 MI0000237 Mus musculus miR-195 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR196A1 Lagos-Quintana et al. [1] cloned this miRNA from human osteoblast sarcoma cells. Lim et al [2] independently predicted this miRNA by computational methods using conservation with mouse and Fugu rubripes sequences [2]. Expression of the excised miR was validated in zebrafish. The sequence maps to human chromosome 17. Yekta et al. report that miR-196 miRNAs are expressed from HOX gene clusters in mammals, and that HOX genes in these clusters are targets of miR-196. Indeed, HOXB8 mRNA was shown to be a natural target for miR-196-directed cleavage through a perfectly complementary miR-target site. Other HOX genes have imperfect miR-196 complementary sites indicative of regulation by translational repression [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. MI0000238 Homo sapiens miR-196a-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR197 MI0000239 Homo sapiens miR-197 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR198 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0000240 Homo sapiens miR-198 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR199B The hairpin precursor sequence mir-199 maps to two loci within 50 kb on mouse chromosome 9. This sequence was named mir-199 in [1] and [2], but is renamed here to avoid overlap with the predicted homologues of human mir-199a-2 and mir-199b. Landgraf et al. demonstrate comparable expression for products from both arms of the hairpin, which are therefore renamed miR-199a-5p and miR-199a-3p here [4]. The mature sequences shown here represent the most commonly cloned forms from large-scale cloning studies [4]. The 5' end of the miRNA may be offset with respect to previous annotations. MI0000241 Mus musculus miR-199a-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR199A1 Lagos-Quintana et al. [1] cloned miR-199 from human osteoblast sarcoma cells. They also reported identification of a miRNA from the opposite arm in mouse cells. This sequence was named miR-199-s and the sequence from the 3' arm of the homologous mouse precursor miR-199-as. Lim et al. [2] independently predicted this miRNA computationally using conservation with mouse and Fugu rubripes sequences [2]. Expression of the miR excised from the 5' arm was validated in zebrafish, and the ends mapped by cloning. The excised miR sequences are renamed miR-199a (to avoid confusion with the subsequently identified miR-199b (MIR:MI0000282)) and miR-199a* (from the 3' arm) here. The two putative hairpin precursors in human map to chromosome 19 (mir-199a-1, MIR:MI0000242) and chromosome 1 (mir-199a-2, MIR:MI0000281). Landgraf et al. show that both mature products are expressed, prompting the renaming to miR-199a-5p and miR-199a-3p [4]. MI0000242 Homo sapiens miR-199a-1 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR429 MI0000243 Mus musculus miR-200b stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene NIL MI0000244 Mus musculus miR-201 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR202 MI0000245 Mus musculus miR-202 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR3545 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations. MI0000246 Mus musculus miR-203 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR211 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. MI0000247 Mus musculus miR-204 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR205 MI0000248 Mus musculus miR-205 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR1-1 MI0000249 Mus musculus miR-206 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR208A MI0000251 Homo sapiens miR-208a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR129-1 This miRNA sequence was predicted based on homology to a verified miRNA cloned from mouse cerebellum [1]. Expression of this miRNA was subsequently verified in a human osteoblast sarcoma cell line [2]. Reference [2] named the human/mouse conserved sequence miR-129b, but subsequent genome searches suggest that the same mature sequence may be expressed from two predicted hairpin precursors in both human (this entry and MIR:MI0000473) and mouse (MIR:MI0000222 and MIR:MI0000585). Landgraf et al. show that the 5' product of mir-129-1 (this entry) is the predominant one, whereas both 5' and 3' products are significantly expressed from mir-129-2 (MIR:MI0000585) [3]. MI0000252 Homo sapiens miR-129-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR148A MI0000253 Homo sapiens miR-148a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR30C2 miR-30c was cloned from mouse heart and brain tissues by Lagos-Quintana et al. [1]. Two human hairpin precursor sequences are predicted based on homology with the mouse sequences, on chromosomes 1 (MIR:MI0000736) and 6 (MIR:MI0000254) [3]. Expression of miR-30c was later independently verified in human HL-60 leukemia cells [2]. MI0000254 Homo sapiens miR-30c-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR30D MI0000255 Homo sapiens miR-30d stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR3591 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0000256 Mus musculus miR-122 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR143 Expression of this miRNA in mouse was independently verified in heart and brain [1], embryonic stem cells [2] and testes [3]. The predominant miRNA cloned by Langraf et al. has a 3' terminal U residue, which is incompatible with the genome sequence [4]. MI0000257 Mus musculus miR-143 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR30E The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5]. MI0000259 Mus musculus miR-30e stem-loop A pre-miRNA processed from the primary transcript of human gene MIR139 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0000261 Homo sapiens miR-139 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR147 Lagos-Quintana et al. cloned miR-147 from mouse spleen tissue [1], but the sequence is not present in the mouse genome assembly (NCBI32). The human genome sequence contains a predicted precursor hairpin for miR-147 shown in [1] (supplementary information) and represented here. The expression of miR-147 has not been verified in human. MI0000262 Homo sapiens miR-147a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR7-1 This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. Landgraf et al. confirm expression in human [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0000263 Homo sapiens miR-7-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR7-2 This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. Landgraf et al. confirm expression in human [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0000264 Homo sapiens miR-7-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR7-3 This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. Expression in human was later verified by cloning [1,2]. MI0000265 Homo sapiens miR-7-3 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR10A This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Mature products were later verified in human [2]. MI0000266 Homo sapiens miR-10a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR10B This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Michael et al. subsequently verified expression of miR-10b in human [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. MI0000267 Homo sapiens miR-10b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR34A This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Dostie et al. independently cloned this sequence in human but misnamed the sequence miR-172 (the sequence is unrelated to MIR172 from Arabidopsis) [2]. The sequence maps to human chromosome 1. Human miR-34a was previously named miR-34 here and in [1], but is renamed to clarify homology with the alternatively named mouse sequence (MIR:MI0000584). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. MI0000268 Homo sapiens miR-34a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR181A2 This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Landgraf et al. and Lui et al. later verify expression in human [4-5]. MI0000269 Homo sapiens miR-181a-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR181B1 This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Its expression was later verified in human BC-1 cells [3]. There are two predicted hairpin precursor sequences in the human genome; mir-181b-1 (MIR:MI0000270) is found on chromosome 1 [1], and mir-181b-2 (MIR:MI0000683) on chromosome 9 [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. MI0000270 Homo sapiens miR-181b-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR181C This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Landgraf et al. confirm the expression of miR-181c in human [2]. MI0000271 Homo sapiens miR-181c stem-loop A pre-miRNA processed from the primary transcript of human gene MIR182 MI0000272 Homo sapiens miR-182 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR183 This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. Expression was later confirmed in human [2,3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. MI0000273 Homo sapiens miR-183 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR187 This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. Landgraf et al. confirm expression in human [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0000274 Homo sapiens miR-187 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR196A2 This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. miR-196a was later validated in human [3,4]. Yekta et al. report that miR-196 miRNAs are expressed from HOX gene clusters in mammals, and that HOX genes in these clusters are targets of miR-196. Indeed, HOXB8 mRNA was shown to be a natural target for miR-196-directed cleavage through a perfectly complementary miR-target site. Other HOX genes have imperfect miR-196 complementary sites indicative of regulation by translational repression [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. MI0000279 Homo sapiens miR-196a-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR199A2 Lagos-Quintana et al. [1] cloned miR-199 from human osteoblast sarcoma cells. They also reported identification of a miRNA from the opposite arm in mouse cells. This sequence was named miR-199-s and the sequence from the 3' arm of the homologous mouse precursor miR-199-as. Lim et al. [2] independently predicted this miRNA computationally using conservation with mouse and Fugu rubripes sequences [2]. Expression of the miR excised from the 5' arm was validated in zebrafish, and the ends mapped by cloning. The excised miR sequences are renamed miR-199a (to avoid confusion with the subsequently identified miR-199b (MIR:MI0000282)) and miR-199a* (from the 3' arm) here. The two putative hairpin precursors in human map to chromosome 19 (mir-199a-1, MIR:MI0000242) and chromosome 1 (mir-199a-2, MIR:MI0000281). Landgraf et al. show that both mature products are expressed, prompting the renaming to miR-199a-5p and miR-199a-3p [4]. MI0000281 Homo sapiens miR-199a-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR199B This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised 5' miR has been validated in zebrafish, the ends mapped by cloning [2], and later verified in human [3]. MI0000282 Homo sapiens miR-199b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR203 This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Landgraf et al. confirm expression in human [2]. MI0000283 Homo sapiens miR-203a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR204 This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Landgraf et al. confirm expression in human [2]. MI0000284 Homo sapiens miR-204 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR205 This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Landgraf et al. confirm expression in human [2]. MI0000285 Homo sapiens miR-205 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR210 This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Its expression was later verified in human BC-1 cells [2]. MI0000286 Homo sapiens miR-210 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR211 This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. The sequence maps to human chromosome 15. MI0000287 Homo sapiens miR-211 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR212 This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. The 3' end was not experimentally determined. The sequence maps to human chromosome 17, but its expression has not been experimentally verified in human. MI0000288 Homo sapiens miR-212 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR181A1 MI0000289 Homo sapiens miR-181a-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR214 This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Landgraf et al. confirm expression in human [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0000290 Homo sapiens miR-214 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR215 This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. Landgraf et al. confirm expression in human [2]. MI0000291 Homo sapiens miR-215 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR216A This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0000292 Homo sapiens miR-216a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR217 This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. The sequence maps to human chromosome 2. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0000293 Homo sapiens miR-217 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR218-1 This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. Landgraf et al. later verified the expression of miR-218 in human [2]. MI0000294 Homo sapiens miR-218-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR218-2 This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. Landgraf et al. confirm expression in human [2]. MI0000295 Homo sapiens miR-218-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR219-1 This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the 5' excised miR has been validated in zebrafish, and the 5' end mapped by PCR [2]. The mature products were later validated in human [3]. Two hairpin precursor structures are predicted, mir-219-1 on chromosome 6 (MIR:MI0000296) and mir-219-2 on chromosome 9 (MIR:MI0000740) [2]. MI0000296 Homo sapiens miR-219a-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR221 This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and later validated in human HL-60 leukemia cells [2]. MI0000298 Homo sapiens miR-221 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR222 This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR was validated in zebrafish, and the ends mapped by cloning. Subsequent cloning studies have also verified the expression of miR-222 in human ES cells. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. MI0000299 Homo sapiens miR-222 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR223 This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. Landgraf et al. confirm expression in human [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0000300 Homo sapiens miR-223 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR224 This miR was identified and ends mapped by cloning from Weri cells in human. The sequence maps to chromosome X. An erratum corrected the originally published name miR-175 to miR-224. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. MI0000301 Homo sapiens miR-224 stem-loop A pre-miRNA processed from the primary transcript of a C.elegans ortholog of human gene MIR124-3 MI0000302 Caenorhabditis elegans miR-124 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR200B The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. MI0000342 Homo sapiens miR-200b stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR371B MI0000388 Mus musculus miR-290a stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR371B The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0000389 Mus musculus miR-291a stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR371B The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations. MI0000390 Mus musculus miR-292 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR371B MI0000391 Mus musculus miR-293 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR371B MI0000392 Mus musculus miR-294 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR371B MI0000393 Mus musculus miR-295 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR296 MI0000394 Mus musculus miR-296 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR297 Houbaviy et al. report that the cloned sequence of miR-297 is found over 20 times in the mouse genomic sequence [1]. This sequence appears to match several low complexity repetitive regions. Confidence in which loci actually express miR-297 is low because of the low complexity nature of the sequence. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations. MI0000395 Mus musculus miR-297a-1 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR297 Houbaviy et al. report that the cloned sequence of miR-297 is found over 20 times in the mouse genomic sequence [1]. This sequence appears to match several low complexity repetitive regions. Confidence in which loci actually express miR-297 is low because of the low complexity nature of the sequence. MI0000397 Mus musculus miR-297a-2 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR298 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0000398 Mus musculus miR-298 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR299 MI0000399 Mus musculus miR-299 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR323B MI0000400 Mus musculus miR-300 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR301B MI0000401 Mus musculus miR-301a stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR302F MI0000402 Mus musculus miR-302a stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR34C Houbaviy et al. cloned 3 closely related sequences from mouse embryonic stem cells [1], and named them miR-34a, miR-34b and miR-172. These names have been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) and miR-34a (MIR:MI0000584) to clarify homology with human sequences. MI0000403 Mus musculus miR-34c stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR34C Houbaviy et al. cloned 3 closely related sequences from mouse embryonic stem cells [1], and named them miR-34a, miR-34b and miR-172. These names have been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) and miR-34a (MIR:MI0000584) to clarify homology with human sequences. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations. MI0000404 Mus musculus miR-34b stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIRLET7I MI0000405 Mus musculus let-7d stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR20B Mouse and human miR-106a (MIR:MI0000406 and MIR:MI0000113) differ at two positions but the precursor sequences are clearly closely related. The sequences are also related to mir-17 (MIR:MI0000071 and MIR:MI0000687). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0000406 Mus musculus miR-106a stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR20B Reference [1] reported the same miRNA sequence with two different identifiers - miR-106b and miR-94. MI0000407 Mus musculus miR-106b stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR301B MI0000408 Mus musculus miR-130b stem-loop A pre-miRNA processed from the primary transcript of human gene MIRLET7G let-7g-3p cloned in [2] has a 1 nt 3' extension (U), which is incompatible with the genome sequence. MI0000433 Homo sapiens let-7g stem-loop A pre-miRNA processed from the primary transcript of human gene MIRLET7I This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2]. MI0000434 Homo sapiens let-7i stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1-2 Lagos-Quintana et al. [1] reported the cloning of miR-1b, miR-1c and miR-1d. The mature processed miR sequences are identical apart from the 3' residues (A in mir-1b, C in mir-1c and UU in mir-1d). The 3' residues of both miR-1b and miR-1c conflict with the predicted stem-loop precursor sequence shown here and these sequences are not found in current assemblies of human and mouse genomes. It is suggested that polyA polymerase may add 1-3 nts to the 3' end of the mature transcript (Tom Tuschl, pers. comm.). The common 21 nts of the 3 reported miR sequences have been rationalised here and named miR-1. There are 2 pairs of orthologous putative hairpin precursor structures named mir-1-1 (human MIR:MI0000651, mouse MIR:MI0000139), and mir-1-2 (human MIR:MI0000437, mouse MIR:MI0000652). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0000437 Homo sapiens miR-1-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR15B This miRNA sequence was predicted based on homology to a verified miRNA from mouse [1]. Michael et al. subsequently verified expression of miR-15b in human [2]. MI0000438 Homo sapiens miR-15b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR23B This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2]. MI0000439 Homo sapiens miR-23b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR27B Lagos-Quintana et al. determined the expression of miR-27b in mouse [1] - a human sequence was predicted based on homology. Michael et al. subsequently verified the expression of this miRNA in human cells [2]. MI0000440 Homo sapiens miR-27b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR30B This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2]. MI0000441 Homo sapiens miR-30b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR122 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. MI0000442 Homo sapiens miR-122 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR124-1 miR-124 was first identified by cloning studies in mouse [1]. Its expression was later verified in human embryonic stem cells [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5]. The 5' end of the miRNA may be offset with respect to previous annotations. MI0000443 Homo sapiens miR-124-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR124-2 miR-124 was first identified by cloning studies in mouse [1]. Its expression was later verified in human embryonic stem cells [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5]. The 5' end of the miRNA may be offset with respect to previous annotations. MI0000444 Homo sapiens miR-124-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR124-3 miR-124 was first identified by cloning studies in mouse [1]. Its expression was later verified in human embryonic stem cells [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5]. The 5' end of the miRNA may be offset with respect to previous annotations. MI0000445 Homo sapiens miR-124-3 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR125B1 This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. Its expression was later verified in human BC-1 cells [2]. MI0000446 Homo sapiens miR-125b-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR128-1 The most commonly cloned mature sequences derived from the previously annotated mir-128a and mir-128b were shown by Landgraf et al to be identical [3]. The sequences are therefore renamed mir-128-1 and mir-128-2. MI0000447 Homo sapiens miR-128-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR130A miR-130a was first identified by cloning studies in mouse [1]. Its expression was later verified in human embryonic stem cells [2]. MI0000448 Homo sapiens miR-130a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR132 This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2]. MI0000449 Homo sapiens miR-132 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR133A1 This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2]. MI0000450 Homo sapiens miR-133a-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR133A2 This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1] later verified in human [2]. MI0000451 Homo sapiens miR-133a-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR135A1 miR-135a was first identified by cloning studies in mouse [1]. Its expression was later verified in human embryonic stem cells [2]. MI0000452 Homo sapiens miR-135a-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR135A2 miR-135a was first identified by cloning studies in mouse [1]. Its expression was later verified in human embryonic stem cells [2]. MI0000453 Homo sapiens miR-135a-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR137 This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2]. MI0000454 Homo sapiens miR-137 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR138-2 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0000455 Homo sapiens miR-138-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR140 This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. Its expression was later verified in human [2,3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The 5' end of the miRNA may be offset with respect to previous annotations. MI0000456 Homo sapiens miR-140 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR141 This miRNA sequence was predicted based on homology to a verified miRNA from mouse [1]. Michael et al. subsequently verified expression of miR-141 in human [2]. MI0000457 Homo sapiens miR-141 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR142 This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. Michael et al. verified the expression of a sequence from the 3' arm of this stem-loop (named miR-142-3p here) [2], and both miR-142-5p (from the 5' arm) and miR-142-3p ware later detected in human HL-60 leukemia cells [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. MI0000458 Homo sapiens miR-142 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR143 This miRNA sequence was predicted based on homology to a verified miRNA from mouse [1]. Michael et al. subsequently verified expression of miR-143 in human, and demonstrated significantly reduced levels of the miRNA in precancerous and neoplastic colorectal tissue [2]. miR-143 cloned in [3] has a 1 nt 3' extension (A), which is incompatible with the genome sequence. MI0000459 Homo sapiens miR-143 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR144 This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. The expression of this miRNA has not been verified in human. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0000460 Homo sapiens miR-144 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR145 This miRNA sequence was predicted based on homology to a verified miRNA from mouse [1]. Michael et al. subsequently verified expression of miR-145 in human, and demonstrated significantly reduced levels of the miRNA in precancerous and neoplastic colorectal tissue [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. MI0000461 Homo sapiens miR-145 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR152 This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2]. MI0000462 Homo sapiens miR-152 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR153-1 This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2]. MI0000463 Homo sapiens miR-153-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR153-2 This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2]. MI0000464 Homo sapiens miR-153-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR191 This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. The expression of this miRNA was later confirmed in human HL-60 leukemia cells [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. MI0000465 Homo sapiens miR-191 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR9-1 MI0000466 Homo sapiens miR-9-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR9-2 MI0000467 Homo sapiens miR-9-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR9-3 MI0000468 Homo sapiens miR-9-3 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR125A This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2]. MI0000469 Homo sapiens miR-125a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR125B2 This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. Its expression was later verified in human BC-1 cells [2]. MI0000470 Homo sapiens miR-125b-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR126 MI0000471 Homo sapiens miR-126 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR127 This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. The expression of this miRNA was later confirmed by cloning in human cells [2,3]. MI0000472 Homo sapiens miR-127 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR129-2 This miRNA sequence was predicted based on homology to a verified miRNA cloned from mouse cerebellum [1]. Expression of this miRNA was subsequently verified in a human osteoblast sarcoma cell line [2]. Reference [2] named the human/mouse conserved sequence miR-129b, but subsequent genome searches suggest that the same mature sequence may be expressed from two predicted hairpin precursors in both human (this entry and MIR:MI0000252) and mouse (MIR:MI0000222 and MIR:MI0000585). Landgraf et al. show that the 5' product of mir-129-1 (MIR:MI0000222) is the predominant one, whereas both 5' and 3' products are significantly expressed from mir-129-2 (this entry) [3]. MI0000473 Homo sapiens miR-129-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR134 miR-134 was first identified by cloning studies in mouse [1]. Its expression was later verified in human embryonic stem cells [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. MI0000474 Homo sapiens miR-134 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR136 miR-136 was first identified by cloning studies in mouse [1]. Its expression was later verified in human embryonic stem cells [2]. MI0000475 Homo sapiens miR-136 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR138-1 This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. Expression in human was later validated by cloning [2]. MI0000476 Homo sapiens miR-138-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR146A This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. Its expression was later verified in human [2,3]. MI0000477 Homo sapiens miR-146a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR149 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0000478 Homo sapiens miR-149 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR150 This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2]. MI0000479 Homo sapiens miR-150 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR154 MI0000480 Homo sapiens miR-154 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR184 This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2]. MI0000481 Homo sapiens miR-184 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR185 This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. Its expression was later verified in human BC-1 cells [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. MI0000482 Homo sapiens miR-185 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR186 This miRNA sequence is predicted based on homology to a verified miRNA from mouse. Expression of this miRNA was also verified in a human osteoblast sarcoma cell line [1]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0000483 Homo sapiens miR-186 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR188 This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0000484 Homo sapiens miR-188 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR190 This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2]. MI0000486 Homo sapiens miR-190a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR193A This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2]. MI0000487 Homo sapiens miR-193a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR194-1 This miRNA sequence was predicted based on homology to a verified miRNA from mouse [1]. Michael et al. subsequently verified expression of miR-194 in human [2]. Two putative pairs of orthologous hairpin precursors structures are found in mouse (mir-194-1 (MIR:MI0000236) on chromosome 1, and mir-194-2 (MIR:MI0000733) on chromosome 19) and human (mir-194-1 (MIR:MI0000488) on chromosome 1, and mir-194-2 (MIR:MI0000732) on chromosome 11). MI0000488 Homo sapiens miR-194-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR195 This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2]. MI0000489 Homo sapiens miR-195 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR206 This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2]. MI0000490 Homo sapiens miR-206 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR320A The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. MI0000542 Homo sapiens miR-320a stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR19B2 Mouse miR-19b was cloned from mouse tissues by independent groups [1,2]. There are two predicted hairpin precursors, with closely related human homologues [4]: mir-19b-1 (MIR:MI0000718) on chromosome 14, and mir-19b-2 (previously named mir-19b here, MIR:MI0000546) on mouse chromosome X. MI0000546 Mus musculus miR-19b-2 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR30E MI0000547 Mus musculus miR-30c-1 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR30E miR-30c was cloned and mapped to chromosome 4 in reference [1] (MIR:MI0000547). A search of more recent mouse genome assemblies suggests the presence of a second locus encoding miR-30c on chromosome 1, represented by this entry. MI0000548 Mus musculus miR-30c-2 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR30E MI0000549 Mus musculus miR-30d stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR148B This sequence was previsouly named mir-148 here and in [1], but is renamed to avoid confusion with mir-148b (MIR:MI0000617). This sequence maps to mouse chromosome 6. MI0000550 Mus musculus miR-148a stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR215 MI0000551 Mus musculus miR-192 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR196B Yekta et al. report that miR-196 miRNAs are expressed from HOX gene clusters in mammals, and that HOX genes in these clusters are targets of miR-196. Indeed, HOXB8 mRNA was shown to be a natural target for miR-196-directed cleavage through a perfectly complementary miR-target site. Other HOX genes have imperfect miR-196 complementary sites indicative of regulation by translational repression [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. MI0000552 Mus musculus miR-196a-1 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR196B Yekta et al. report that miR-196 miRNAs are expressed from HOX gene clusters in mammals, and that HOX genes in these clusters are targets of miR-196. Indeed, HOXB8 mRNA was shown to be a natural target for miR-196-directed cleavage through a perfectly complementary miR-target site. Other HOX genes have imperfect miR-196 complementary sites indicative of regulation by translational repression [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. MI0000553 Mus musculus miR-196a-2 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR429 MI0000554 Mus musculus miR-200a stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR208B MI0000555 Mus musculus miR-208a stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIRLET7I The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. MI0000556 Mus musculus let-7a-1 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIRLET7I The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. MI0000557 Mus musculus let-7a-2 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIRLET7I MI0000558 Mus musculus let-7b stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIRLET7I MI0000559 Mus musculus let-7c-1 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIRLET7I MI0000560 Mus musculus let-7c-2 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIRLET7I The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. MI0000561 Mus musculus let-7e stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIRLET7I The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. MI0000562 Mus musculus let-7f-1 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIRLET7I The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. MI0000563 Mus musculus let-7f-2 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR195 MI0000564 Mus musculus miR-15a stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR195 MI0000565 Mus musculus miR-16-1 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR195 MI0000566 Mus musculus miR-16-2 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR20B The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations. MI0000567 Mus musculus miR-18a stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR20B MI0000568 Mus musculus miR-20a stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR21 MI0000569 Mus musculus miR-21 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR22 MI0000570 Mus musculus miR-22 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR23B MI0000571 Mus musculus miR-23a stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR24-2 MI0000572 Mus musculus miR-24-2 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR26A2 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. MI0000573 Mus musculus miR-26a-1 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR26A2 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [6]. MI0000575 Mus musculus miR-26b stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR29C The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5]. MI0000576 Mus musculus miR-29a stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR29C The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. MI0000577 Mus musculus miR-29c stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR27B MI0000578 Mus musculus miR-27a stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR31 MI0000579 Mus musculus miR-31 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR92B MI0000580 Mus musculus miR-92a-2 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR20B MI0000581 Mus musculus miR-93 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR96 MI0000583 Mus musculus miR-96 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR34C Houbaviy et al. cloned this miRNA from embryonic stem cells and named it miR-172 [1]. This sequence is homologous to human miR-34a (MIR:MI0000268), and so is renamed miR-34a here. This sequence is not related to miR172 from plants (MIR:MI0000215 and MIR:MI0000216). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. MI0000584 Mus musculus miR-34a stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR129-2 The miRNA from the 5' arm of this precursor was verified by cloning in mouse [1]. Reference [2] named the human/mouse conserved sequence miR-129b, but subsequent genome searches suggest that the same mature sequence may be expressed from two predicted hairpin precursors in both mouse (this entry and MIR:MI0000222) and human (MIR:MI0000252 and MIR:MI0000473). Poy et al. independently cloned a mature miRNA from the 3' arm of the precursor, called mmu-miR-129-3p [3]. This sequence is not perfectly conserved in the other predicted mouse miR-129 precursor (MIR:MI0000222). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. MI0000585 Mus musculus miR-129-2 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIRLET7I MI0000586 Mus musculus miR-98 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR103-2AS This miRNA sequence was predicted based on homology to a verified miRNA from human [1], and subsequently verified by cloning [2-4]. MI0000587 Mus musculus miR-103-1 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR103-2AS This miRNA sequence was predicted based on homology to a verified miRNA from human [1], and subsequently verified by cloning [2,3]. MI0000588 Mus musculus miR-103-2 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR424 Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. The miR-322 locus has an orthologous sequence in human (MIR:MI0001446), which expresses an experimentally validated mature miRNA sequence from its 5' arm, named miR-424. The human mir-424 locus does not appear to contain a homolog of the miR-322 sequence. The mouse ortholog (MIR:MI0000590) appears able to express both miR-322 and miR-424. Both miR-322 and miR-424 have been experimentally verified in rat. Landgraf et al. show that the 5' product is the predominant one [3]. The 5' product is therefore renamed miR-322 and the 3' product renamed miR-322*. MI0000589 Rattus norvegicus miR-322-1 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR424 The mir-322 locus appears able to express two mature miRNA sequences. Poy et al. cloned a sequence originating from the 5' arm from mouse pancreatic beta cells [2]. This sequence is orthologous to the experimentally validated miR-424 sequence from human (MIR:MI0001446), but was named miR-322-5p in [2]. The mature product from the 3' arm of this precursor sequence is the predicted mouse homologue of miR-322, experimentally verified in rat (MIR:MI0000589) [1], and later in mouse [3]. The orthologous human locus does not appear to contain the miR-322 sequence. Landgraf et al. confirm that the 5' product is the predominant one [4]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. MI0000590 Mus musculus miR-322 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR323B The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations. MI0000591 Rattus norvegicus miR-323 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR323B Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This mouse miRNA is predicted based on homology to the verified rat sequence (MIR:MI0000591). Seitz et al. independently predicted the miRNA hairpin precursor sequence by conservation between mouse and human [2]. Landgraf et al. later cloned and sequenced mature products from both arms of the predicted hairpin [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The 5' end of the miRNA may be offset with respect to previous annotations. MI0000592 Mus musculus miR-323 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR301B Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This rat miRNA has an independently verified homologue in mouse (MIR:MI0000401). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations. MI0000593 Rattus norvegicus miR-301a stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR324 MI0000594 Rattus norvegicus miR-324 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR324 Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This mouse miRNA is predicted based on homology to the verified rat sequence (MIR:MI0000594) - expression of miRNAs from both arms was later independently verified in mouse [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The predominant miR-324-3p clone has a 3' terminal U residue, which is incompatible with the genome sequence [3]. MI0000595 Mus musculus miR-324 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR325 MI0000596 Rattus norvegicus miR-325 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR325 MI0000597 Mus musculus miR-325 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR326 MI0000598 Mus musculus miR-326 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR326 MI0000599 Rattus norvegicus miR-326 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIRLET7I Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons, including the sequence identical to the miRNA cloned from the reverse strand of mouse let-7d (MIR:MI0000405), named let-7* [1]. The predicted precursor sequence from a newer assembly of the rat genome also contains the let-7d sequence in the 5' arm. The let-7d* sequence published in [1] had an extra 3' A residue, which conflicts with the sequence of the precursor shown here. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The ends of the miRNA may be offset with respect to previous annotations. MI0000601 Rattus norvegicus let-7d stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR328 MI0000602 Rattus norvegicus miR-328a stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR328 Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This mouse miRNA is predicted based on homology to the verified rat sequence (MIR:MI0000602) - its expression was later independently verified in mouse [2]. MI0000603 Mus musculus miR-328 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR543 Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This rat miRNA has a predicted homologue in mouse (MIR:MI0000605). MI0000604 Rattus norvegicus miR-329 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR543 Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This mouse miRNA is predicted based on homology to the verified rat sequence (MIR:MI0000604). Seitz et al. independently predicted the miRNA hairpin precursor sequence by conservation between mouse and human [2]. Landgraf et al. verified expression by cloining [3]. MI0000605 Mus musculus miR-329 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR330 The mature miRNA originating from the 3' arm reported in [1] contains an extra 3' A residue, which conflicts with the precursor sequence shown here. Landgraf et al. show that the 5' miRNA is the predominant one [2]. The 3' mature sequence is renamed miR-300* here. MI0000606 Rattus norvegicus miR-330 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR330 MI0000607 Mus musculus miR-330 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR331 Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This rat miRNA has a predicted homologue in mouse (MIR:MI0000609). MI0000608 Rattus norvegicus miR-331 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR331 MI0000609 Mus musculus miR-331 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR140 Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. The cloned miRNA appears to be expressed from the 3' strand of the precursor, and is therefore named miR-140* here. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The ends of the miRNA may be offset with respect to previous annotations. MI0000611 Rattus norvegicus miR-140 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR335 MI0000612 Rattus norvegicus miR-335 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR337 MI0000614 Rattus norvegicus miR-337 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR337 Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This mouse miRNA is predicted based on homology to the verified rat sequence (MIR:MI0000614). Seitz et al. later predicted a cluster of 40 miRNAs in the imprinted human 14q32 domain, and confirmed the expression of a subset by Northern blot or primer extension in mouse [2]. Landgraf et al. later cloned and sequenced mature products from both arms of the hairpin, named here miR-337-5p and miR-337-3p [3]. MI0000615 Mus musculus miR-337 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR148B MI0000616 Rattus norvegicus miR-148b stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR148B MI0000617 Mus musculus miR-148b stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR338 MI0000618 Rattus norvegicus miR-338 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR338 MI0000619 Mus musculus miR-338 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR339 Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. The miR-339-5p sequence reported in [1] contains two 3' terminal U residues, which conflict with the precursor sequence shown here. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations. MI0000620 Rattus norvegicus miR-339 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR339 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [1]. MI0000621 Mus musculus miR-339 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR340 MI0000622 Rattus norvegicus miR-340-1 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR340 MI0000623 Mus musculus miR-340 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR342 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The ends of the miRNA may be offset with respect to previous annotations. MI0000626 Rattus norvegicus miR-342 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR342 Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This mouse miRNA is predicted based on homology to the verified rat sequence (MIR:MI0000626). Seitz et al. independently predicted the miRNA hairpin precursor sequence by conservation between mouse and human [2]. Landgraf et al. later cloned and sequenced mature products from both arms of the predicted hairpin [3]. The mature sequences shown here represent the most commonly cloned forms from large-scale cloning studies [3]. MI0000627 Mus musculus miR-342 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR345 MI0000631 Rattus norvegicus miR-345 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR345 Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This mouse miRNA was predicted based on homology to the verified rat sequence (MIR:MI0000631). Seitz et al. independently predicted the miRNA hairpin precursor sequence by conservation between mouse and human [2]. Landgraf et al. later verified mature miRNA expression from both arms of the hairpin precursor [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The 5' end of the miRNA may be offset with respect to previous annotations. MI0000632 Mus musculus miR-345 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR346 Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. The sequence reported in [1] contains two 3' terminal A residues, which conflict with the precursor sequence shown here. MI0000633 Rattus norvegicus miR-346 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR346 Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This mouse miRNA is predicted based on homology to the verified rat sequence (MIR:MI0000633) - its expression has not been verified in mouse. The sequence reported in [1] contains two 3' terminal A residues, which conflict with the precursor sequence shown here. MI0000634 Mus musculus miR-346 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR129-2 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations. Kim et al [1] and He et al [4] both identify the mature product from the 3' arm, named miR-129* here. MI0000637 Rattus norvegicus miR-129-2 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR20B MI0000638 Rattus norvegicus miR-20a stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR7-3 Landgraf et al. show that the 5' product is the predominant one [3]. The 3' product is renamed miR-7a*. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations. MI0000641 Rattus norvegicus miR-7a-1 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR135B Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations. MI0000645 Rattus norvegicus miR-135b stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR135B MI0000646 Mus musculus miR-135b stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR151B Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. Landgraf et al show that the 5' product is the predominant one [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations. MI0000647 Rattus norvegicus miR-151 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR101-2 Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The ends of the miRNA may be offset with respect to previous annotations. MI0000648 Rattus norvegicus miR-101b stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR101-2 Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This mouse miRNA is predicted based on homology to the verified rat sequence (MIR:MI0000648) -- expression in mouse was verified independently [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. MI0000649 Mus musculus miR-101b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR200C The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. MI0000650 Homo sapiens miR-200c stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1-1 Lagos-Quintana et al. [1] reported the cloning of miR-1b, miR-1c and miR-1d. The mature processed miR sequences are identical apart from the 3' residues (A in mir-1b, C in mir-1c and UU in mir-1d). The 3' residues of both miR-1b and miR-1c conflict with the predicted stem-loop precursor sequence shown here and these sequences are not found in current assemblies of human and mouse genomes. It is suggested that polyA polymerase may add 1-3 nts to the 3' end of the mature transcript (Tom Tuschl, pers. comm.). The common 21 nts of the 3 reported miR sequences have been rationalised here and named miR-1. There are 2 pairs of orthologous putative hairpin precursor structures named mir-1-1 (human MIR:MI0000651, mouse MIR:MI0000139), and mir-1-2 (human MIR:MI0000437, mouse MIR:MI0000652). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0000651 Homo sapiens miR-1-1 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR1-1 Lagos-Quintana et al. [1] reported the cloning of miR-1b, miR-1c and miR-1d. The mature processed miR sequences are identical apart from the 3' residues (A in mir-1b, C in mir-1c and UU in mir-1d). The 3' residues of both miR-1b and miR-1c conflict with the predicted stem-loop precursor sequence shown here and these sequences are not found in current assemblies of human and mouse genomes. It is suggested that polyA polymerase may add 1-3 nts to the 3' end of the mature transcript (Tom Tuschl, pers. comm.). The common 21 nts of the 3 reported miR sequences have been rationalised here and named miR-1. There are 2 pairs of orthologous putative hairpin precursor structures named mir-1-1 (human MIR:MI0000651, mouse MIR:MI0000139), and mir-1-2 (human MIR:MI0000437, mouse MIR:MI0000652). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0000652 Mus musculus miR-1a-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR155 Human mir-155 is predicted based on homology to a cloned miR from mouse (MIR:MI0000177) [1], and later experimentally validated in human HL-60 leukemia cells [2]. Like the mouse miRNA, human mir-155 resides in the non-coding BIC transcript (EMBL:AF402776), located on chromosome 21 [3]. The mature form differs from that in mouse at a single position. Eis et al. confirm that miR-155 is processed from the BIC transcript in human, and demonstrate elevated expression of miR-155 in lymphoma samples [4]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5]. MI0000681 Homo sapiens miR-155 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR181B2 This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Its expression was later verified in human BC-1 cells [3]. There are two predicted hairpin precursor sequences in the human genome; mir-181b-1 (MIR:MI0000270) is found on chromosome 1 [1], and mir-181b-2 (MIR:MI0000683) on chromosome 9 [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. MI0000683 Homo sapiens miR-181b-2 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR103-2AS Mouse mir-107 is predicted [2] based on homology to a cloned miR from human (MIR:MI0000114) [1], and later verified in mouse [3,4]. MI0000684 Mus musculus miR-107 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR99B MI0000685 Mus musculus miR-10a stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR20B Mouse mir-17 is predicted [4] based on homology to a cloned miR from human (MIR:MI0000071) [1,2]. miRNAs derived from the 5' [1] and 3' [2] arms of the human mir-17 precursor have been reported. Landgraf et al. show that the 5' product is the predominant one [5]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5]. MI0000687 Mus musculus miR-17 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR19B2 MI0000688 Mus musculus miR-19a stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR92B Mouse mir-25 is predicted [3] based on homology to a cloned miR from human (MIR:MI0000082) [1]. Its expression has been later independently verified in mouse [2,4]. MI0000689 Mus musculus miR-25 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR151B Mouse mir-28 is predicted [2] based on homology to a cloned miR from human (MIR:MI0000086) [1]. Its expression was later verified by cloning [3]. MI0000690 Mus musculus miR-28 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR32 Mouse mir-32 is predicted [3] based on homology to a cloned miR from human (MIR:MI0000090) [1]. Its expression in mouse was later independently verified [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. MI0000691 Mus musculus miR-32 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR99B Mouse mir-100 is predicted [2] based on homology to a cloned miR from human (MIR:MI0000102) [1]. Its expression was later verified in mouse [3]. MI0000692 Mus musculus miR-100 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR139 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0000693 Mus musculus miR-139 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR429 Mouse mir-200c is predicted [3] based on homology to a cloned miR from human (MIR:MI0000650) [1]. Its expression in mouse was later verified independently [2,4]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. MI0000694 Mus musculus miR-200c stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR210 Mouse mir-210 is predicted [3] based on homology to a reported miR from human (MIR:MI0000286) [1]. Its expression in mouse was later verified independently [2,4]. MI0000695 Mus musculus miR-210 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR132 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. MI0000696 Mus musculus miR-212 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR181D MI0000697 Mus musculus miR-181a-1 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR3120 Mouse mir-214 is predicted [2] based on homology to a reported miR from human (MIR:MI0000290) [1]. Its expression was later verified by cloning [3]. MI0000698 Mus musculus miR-214 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR216B Mouse mir-216 is predicted [2] based on homology to a reported miR from human (MIR:MI0000292) [1]. Its expression was later verified by cloning [3]. MI0000699 Mus musculus miR-216a stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR218-2 Mouse miR-218 is predicted [2] based on homology to a reported miR from human (MIR:MI0000294) [1]. Its expression was later verified by cloning [3]. MI0000700 Mus musculus miR-218-1 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR218-2 Mouse miR-218 is predicted [2] based on homology to a reported miR from human (MIR:MI0000295) [1]. Its expression was later verified by cloning [3]. MI0000701 Mus musculus miR-218-2 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene NIL MI0000702 Mus musculus miR-219a-1 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR223 Mouse mir-223 is predicted [2] based on homology to a reported miR from human (MIR:MI0000300) [1]. Its expression was later verified by cloning [3]. MI0000703 Mus musculus miR-223 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR320E Mouse mir-320 is predicted [2] based on homology to a cloned miR from human (MIR:MI0000542) [1]. Its expression was later verified in mouse [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. MI0000704 Mus musculus miR-320 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR26A2 This sequence is a second predicted hairpin precursor for miR-26a (MIR:MI0000573), conserved in human [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5]. MI0000706 Mus musculus miR-26a-2 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR33B Mouse mir-33 is predicted [2] based on homology to a cloned miR from human (MIR:MI0000091) [1]. Its expression was later verified by cloning [3]. MI0000707 Mus musculus miR-33 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR211 Mouse mir-211 is predicted [2] based on homology to a reported miR from human (MIR:MI0000287) [1]. Its expression has not been verified in mouse. The mature miR differs from the human sequence at a single base. This sequence maps to mouse chromosome 7. MI0000708 Mus musculus miR-211 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR222 Mouse mir-221 is predicted [2] based on homology to a reported miR from human (MIR:MI0000298) [1]. Its expression was later verified by cloning [3]. MI0000709 Mus musculus miR-221 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR222 Mouse mir-222 is predicted [2] based on homology to a reported miR from human (MIR:MI0000299) [1]. Its expression was later verified in mouse by cloning [3]. MI0000710 Mus musculus miR-222 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR224 Mouse mir-224 is predicted [2] based on homology to a cloned miR from human (MIR:MI0000301) [1]. Its expression was later verified by cloning [3]. MI0000711 Mus musculus miR-224 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR29C MI0000712 Mus musculus miR-29b-2 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR199B The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5]. The 5' end of the miRNA may be offset with respect to previous annotations. MI0000713 Mus musculus miR-199a-2 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR199B Mouse miR-199b is predicted based on homology with the previously identified human miR-199b (MIR:MI0000282) [1,2]. Landgraf et al. later showed that the 3' product is the predominant one [3]. MI0000714 Mus musculus miR-199b stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR135B MI0000715 Mus musculus miR-135a-2 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR124-3 miR-124 was cloned from mouse brain [1] and embryonic stem cells [2] by independent groups. There are 3 predicted precursor hairpin sequences: mir-124-1 (MIR:MI0000716) on chromosome 14, mir-124-2 (MIR:MI0000717) on chromosome 3, and mir-124-3 (previously known as miR-124 here, MIR:MI0000150) on chromosome 2. All have closely related predicted human homologues (MIR:MI0000443, MIR:MI0000444 and MIR:MI0000445). Lagos-Quintana et al. also report a mature miRNA sequence miR-124b, with a G insertion at position 12 [1]. miR-124b is not found in either the mouse or human genome assemblies. MI0000716 Mus musculus miR-124-1 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR124-3 miR-124 was cloned from mouse brain [1] and embryonic stem cells [2] by independent groups. There are 3 predicted precursor hairpin sequences: mir-124-1 (MIR:MI0000716) on chromosome 14, mir-124-2 (MIR:MI0000717) on chromosome 3, and mir-124-3 (previously known as miR-124 here, MIR:MI0000150) on chromosome 2. All have closely related predicted human homologues (MIR:MI0000443, MIR:MI0000444 and MIR:MI0000445). Lagos-Quintana et al. also report a mature miRNA sequence miR-124b, with a G insertion at position 12 [1]. miR-124b is not found in either the mouse or human genome assemblies. MI0000717 Mus musculus miR-124-2 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR19B2 MI0000718 Mus musculus miR-19b-1 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR92B The predominant miR-92 form cloned by Landgraf et al. has a additional 3' U residue, which is compatible with this precursor sequence, but not with that of mir-92-2 (MIR:MI0000580) [4]. MI0000719 Mus musculus miR-92a-1 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR9-3 MI0000720 Mus musculus miR-9-1 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR9-3 MI0000721 Mus musculus miR-9-3 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR138-1 Mouse miR-138 was cloned from mouse brain tissue in [1]. There are 2 predicted hairpin precursor structures in the mouse genome, each has a closely related human homologue [2]. mir-138-1 (MIR:MI0000722) is found on mouse chromosome 8, and mir-138-2 (MIR:MI0000164, previously named mir-138 here) on chromosome 9. Kim et al. and Obernosterer et al. independently show that the mature product is a 23mer [3,4]. MI0000722 Mus musculus miR-138-1 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR181D Mouse miR-181b was predicted by computational methods using conservation with human and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and independently in mouse [2,3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. MI0000723 Mus musculus miR-181b-1 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR181D Mouse miR-181c was predicted by computational methods using conservation with human and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish and independently in mouse [2,3]. MI0000724 Mus musculus miR-181c stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR99B MI0000725 Mus musculus miR-125b-1 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR128-2 The most commonly cloned mature sequences derived from the previously annotated mir-128a and mir-128b were shown by Landgraf et al to be identical [3]. The sequences are therefore renamed mir-128-1 and mir-128-2. MI0000726 Mus musculus miR-128-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR128-2 The most commonly cloned mature sequences derived from the previously annotated mir-128a and mir-128b were shown by Landgraf et al to be identical [3]. The sequences are therefore renamed mir-128-1 and mir-128-2. MI0000727 Homo sapiens miR-128-2 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR7-3 miR-7a (previously named miR-7) was predicted by computational methods using conservation between mouse, human and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and later independently verified in mouse [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The ends of the miRNA may be offset with respect to previous annotations. MI0000728 Mus musculus miR-7a-1 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR7-3 miR-7a (previously named miR-7) was predicted by computational methods using conservation between mouse, human and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and later independently verified in mouse [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The ends of the miRNA may be offset with respect to previous annotations. MI0000729 Mus musculus miR-7a-2 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR7-3 miR-7 was predicted by computational methods using conservation between mouse, human and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. This sequence represents the mouse homologue of human mir-7-3 -- the derived mature form differs at a single position from that expressed from mir-7-1 (MIR:MI0000728) and mir-7-2 (MIR:MI0000729) in mouse, and mir-7-1 (MIR:MI0000263), mir-7-2 (MIR:MI0000264) and mir-7-3 (MIR:MI0000265) in human. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies in mouse [2]. MI0000730 Mus musculus miR-7b stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR217 This miRNA was predicted by computational methods using conservation in with human, mouse and Fugu rubripes [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. The mature mouse and human (MIR:MI0000293) sequences differ at a single position [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies in mouse [3]. MI0000731 Mus musculus miR-217 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR194-2 This miRNA sequence was predicted based on homology to a verified miRNA from mouse [1]. Michael et al. subsequently verified expression of miR-194 in human [2]. Two putative pairs of orthologous hairpin precursors structures are found in mouse (mir-194-1 (MIR:MI0000236) on chromosome 1, and mir-194-2 (MIR:MI0000733) on chromosome 19) and human (mir-194-1 (MIR:MI0000488) on chromosome 1, and mir-194-2 (MIR:MI0000732) on chromosome 11). MI0000732 Homo sapiens miR-194-2 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR194-2 Lagos-Quintana cloned miR-194 from mouse kidney tissue [1]. Michael et al. subsequently verified expression of miR-194 in human [2]. Two putative pairs of orthologous hairpin precursors structures are found in mouse (mir-194-1 (MIR:MI0000236) on chromosome 1, and mir-194-2 (MIR:MI0000733) on chromosome 19) and human (mir-194-1 (MIR:MI0000488) on chromosome 1, and mir-194-2 (MIR:MI0000732) on chromosome 11). MI0000733 Mus musculus miR-194-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR106B MI0000734 Homo sapiens miR-106b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR29C The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. MI0000735 Homo sapiens miR-29c stem-loop A pre-miRNA processed from the primary transcript of human gene MIR30C1 miR-30c was cloned from mouse heart and brain tissues by Lagos-Quintana et al. [1]. Two human hairpin precursor sequences are predicted based on homology with the mouse sequences, on chromosomes 1 (MIR:MI0000736) and 6 (MIR:MI0000254) [3]. Expression of miR-30c was later validated in human HL-60 leukemia cells [2]. MI0000736 Homo sapiens miR-30c-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR200A miR-200a was cloned from mouse kidney tissue [1], and expression later confirmed by cloning in human [3]. MI0000737 Homo sapiens miR-200a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR302A MI0000738 Homo sapiens miR-302a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR101-2 Reference [1] reports two miR-101 precursor hairpin structures in human, on chromosome 1 (MIR:MI0000103) and 9 (MIR:MI0000739, named mir-101-precursor-9 in [1]). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. MI0000739 Homo sapiens miR-101-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR219-2 This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR [2]. The mature products were later verified in human [3]. Two hairpin precursor structures are predicted, mir-219-1 on chromosome 6 (MIR:MI0000296) and mir-219-2 on chromosome 9 (MIR:MI0000740) [2]. MI0000740 Homo sapiens miR-219a-2 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene NIL MI0000741 Mus musculus miR-219a-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR34B Houbaviy et al. cloned 3 closely related sequences from mouse embryonic stem cells [1], and named them miR-34a, miR-34b and miR-172. These names have been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) and miR-34a (MIR:MI0000584) to clarify homology with human sequences. The predominant mature miRNA in human is expressed from the 3' arm (in contrast to previous annotation) [2]. Both arms express mature products in mouse. MI0000742 Homo sapiens miR-34b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR34C Houbaviy et al. cloned 3 closely related sequences from mouse embryonic stem cells [1], and named them miR-34a, miR-34b and miR-172. These names have been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) and miR-34a (MIR:MI0000584) to clarify homology with human sequences. MI0000743 Homo sapiens miR-34c stem-loop A pre-miRNA processed from the primary transcript of human gene MIR299 The sequence from the 5' arm of this miRNA precursor is the predicted human homologue of mouse miR-299, cloned from mouse embryonic stem cells [1,2], later validated in human [4]. Altuvia et al [3] report the cloning of a miRNA sequence from the 3' arm of the same precursor in human. MI0000744 Homo sapiens miR-299 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR301A This sequence is the predicted human homologue of mouse miR-301, cloned from mouse embryonic stem cells [1,3]. Its expression has also been confirmed in human ES cells [2]. MI0000745 Homo sapiens miR-301a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR99B This sequence is the predicted human homologue of mouse miR-99b, cloned from mouse brain [1] and embryonic stem cells [2,3]. Its expression was later validated in human [4-6]. MI0000746 Homo sapiens miR-99b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR296 This sequence is the predicted human homologue of mouse miR-296 cloned from mouse embryonic stem cells [1,3]. Its expression has also been verified in human ES cells [2]. MI0000747 Homo sapiens miR-296 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR130B This sequence is the predicted human homologue of mouse miR-130b cloned from mouse embryonic stem cells [1,2]. Its expression was later verified in human BC-1 cells [3]. MI0000748 Homo sapiens miR-130b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR30E This sequence is the predicted human homologue of mouse miR-30e [1,2,4]. Mature products from both arms of the precursor (hsa-miR-30e-5p and hsa-miR-30e-3p) were later independently verified in human myelocytic leukemia (HL-60) cells [3]. Landgraf et al. later showed that the 5' product is the predominant one [5]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5]. MI0000749 Homo sapiens miR-30e stem-loop A pre-miRNA processed from the primary transcript of human gene MIR26A2 miR-26a was cloned from HeLa cells [1]. Two predicted hairpin precursor sequences are present on chromosome 3 (MIR:MI0000083) and 12 (MIR:MI0000750), each with homologues in mouse (MIR:MI0000573 and MIR:MI0000706). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [6]. MI0000750 Homo sapiens miR-26a-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR361 MI0000760 Homo sapiens miR-361 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR361 MI0000761 Mus musculus miR-361 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR362 MI0000762 Homo sapiens miR-362 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR362 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. MI0000763 Mus musculus miR-362 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR363 MI0000764 Homo sapiens miR-363 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR363 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations. MI0000765 Mus musculus miR-363 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR365-1 Xie et al. [1] refer to this sequence by the internal identifier MIR245. The sequence is unrelated to C. elegans mir-245 (MIR:MI0000321). MI0000767 Homo sapiens miR-365a stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR365-2 Xie et al. [1] refer to this sequence by the internal identifier MIR245. The sequence is unrelated to C. elegans mir-245 (MIR:MI0000321). MI0000768 Mus musculus miR-365-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR365-2 Xie et al. [1] refer to this sequence by the internal identifier MIR190. The sequence is unrelated to mammalian mir-190 (MIR:MI0000486). MI0000769 Homo sapiens miR-365b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR302B MI0000772 Homo sapiens miR-302b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR302C MI0000773 Homo sapiens miR-302c stem-loop A pre-miRNA processed from the primary transcript of human gene MIR302D Human miR-302a (MIR:MI0000738), miR-302b (MIR:MI0000772), miR-302c (MIR:MI0000773), miR-302d (MIR:MI0000774) and miR-367 (MIR:MI0000775) are clustered on chromosome 4. MI0000774 Homo sapiens miR-302d stem-loop A pre-miRNA processed from the primary transcript of human gene MIR367 MI0000775 Homo sapiens miR-367 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR376C This miRNA has been named both miR-368 and miR376c in the literature, and previously here. The mature miR-376c product has been shown to be modified by A to I edits [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The 5' end of the miRNA may be offset with respect to previous annotations. MI0000776 Homo sapiens miR-376c stem-loop A pre-miRNA processed from the primary transcript of human gene MIR369 MI0000777 Homo sapiens miR-369 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR370 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. MI0000778 Homo sapiens miR-370 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR371 Human miR-371 (MIR:MI0000779), miR-372 (MIR:MI0000780) and miR-373 (MIR:MI0000781) are clustered within 1.1kb on chromosome 19. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations. MI0000779 Homo sapiens miR-371a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR372 MI0000780 Homo sapiens miR-372 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR373 MI0000781 Homo sapiens miR-373 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR374A MI0000782 Homo sapiens miR-374a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR375 MI0000783 Homo sapiens miR-375 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR376A1 The mature miR-376a products have been shown to be modified by A to I edits [3]. MI0000784 Homo sapiens miR-376a-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR377 MI0000785 Homo sapiens miR-377 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR378 miR-422b was the most abundant miRNA cloned from human promyelocytic leukemia (HL-60) cells [2]. The sequence originates from the opposite arm of the human homologue of previously identified mouse mir-378 [1]. Landgraf et al. show that the 3' product (previously called miR-422b) is the predominant one [3]. Further, mir-378 and mir-422a loci are unrelated. miR-422b is thus renamed miR-378 here. MI0000786 Homo sapiens miR-378a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR379 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. MI0000787 Homo sapiens miR-379 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR380 Landgraf et al. confirm that the 3' product is the predominant one [3]. MI0000788 Homo sapiens miR-380 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR381 MI0000789 Homo sapiens miR-381 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR382 MI0000790 Homo sapiens miR-382 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR383 MI0000791 Homo sapiens miR-383 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR375 MI0000792 Mus musculus miR-375 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR376A2 Seitz et al. predicted a cluster of 40 miRNAs in the imprinted human 14q32 domain, and confirmed the expression of a subset by Northern blot or primer extension in mouse [1]. The expression of miR-376a was independently verified by Poy et al. [2]. The mature miR-376a products have been shown to be modified by A to I edits [4]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5]. MI0000793 Mus musculus miR-376a stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR323B MI0000794 Mus musculus miR-377 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR378E MI0000795 Mus musculus miR-378 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR1197 MI0000796 Mus musculus miR-379 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR1197 Seitz et al. predicted a cluster of 40 miRNAs in the imprinted human 14q32 domain, and confirmed the expression of a subset by Northern blot or primer extension in mouse, including a sequence from the 3' arm of this precursor [1]. Poy et al. cloned a sequence from the 5' arm from mouse pancreatic beta cell line MIN6 [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The 5' end of the miRNA may be offset with respect to previous annotations. MI0000797 Mus musculus miR-380 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR323B MI0000798 Mus musculus miR-381 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR323B MI0000799 Mus musculus miR-382 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR383 MI0000800 Mus musculus miR-383 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR340 This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2]. Landgraf et al. show that the 5' product is the predominant one in human, mouse and rat [3], in contrast to the previous annotation. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. MI0000802 Homo sapiens miR-340 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR330 This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2], later verified in human [3]. MI0000803 Homo sapiens miR-330 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR328 This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2], later verified in human [3]. MI0000804 Homo sapiens miR-328 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR342 This sequence was predicted by homology to a rat miRNA [1,2] and later verified in human [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. MI0000805 Homo sapiens miR-342 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR337 This sequence was predicted based on homology with a verified rat miRNA [1,2], and later confirmed in human [3]. MI0000806 Homo sapiens miR-337 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR323 This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2], later verified in human [3]. MI0000807 Homo sapiens miR-323a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR326 This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2], later verified in human [3]. miR-326 cloned in [3] has a 1 nt 3' extension (U), which is incompatible with the genome sequence. MI0000808 Homo sapiens miR-326 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR151 This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2], later verified in human [3,4]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The 5' end of the miRNA may be offset with respect to previous annotations. MI0000809 Homo sapiens miR-151a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR135B This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2], later verified in human [3]. MI0000810 Homo sapiens miR-135b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR148B This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2]. Its expression was later verified in human [3,4]. MI0000811 Homo sapiens miR-148b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR331 This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2], later verified in human [3]. MI0000812 Homo sapiens miR-331 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR324 This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2]. Expression of the miRNA from the 3' arm of the hairpin was later verified in human BC-1 cells [3]. The 5' end of the miRNA may be offset with respect to previous annotations. miR-324-3p cloned in [4] has a 1 nt 3' extension (U), which is incompatible with the genome sequence. MI0000813 Homo sapiens miR-324 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR338 This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2], later verified in human [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. MI0000814 Homo sapiens miR-338 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR339 This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,3]. Expression of mature miRNA was later verified in human [2,4]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. MI0000815 Homo sapiens miR-339 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR335 This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2], later verified in human [3]. MI0000816 Homo sapiens miR-335 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR335 MI0000817 Mus musculus miR-335 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR133B This mature miRNA sequence was named miR-133 in reference [1], and renamed miR-133a on subsequent identification of a homologue differing at the terminal 3' position (MIR:MI0000821). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The 5' end of the miRNA may be offset with respect to previous annotations. MI0000820 Mus musculus miR-133a-2 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR133B miR-133b was predicted based on comparative analysis of human, mouse and Fugu [1]. It is homologous to miR-133a (MIR:MI0000159 and MIR:MI0000820). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The 5' end of the miRNA may be offset with respect to previous annotations. MI0000821 Mus musculus miR-133b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR133B miR-133b was predicted based on comparative analysis of human, mouse and Fugu [1], and later verified in human [2]. MI0000822 Homo sapiens miR-133b stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR181D Mouse miR-181b was predicted by computational methods using conservation with human and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and independently in mouse [2,3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. MI0000823 Mus musculus miR-181b-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR325 This sequence is the predicted human homologue [2] of a sequence cloned from rat neuronal tissue [1]. The mature miRNA differs from the rat sequence at two positions, and its expression has not been verified in human. MI0000824 Homo sapiens miR-325 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR345 This sequence is the predicted human homologue [2] of a sequence cloned from rat neuronal tissue [1], later validated in human [3,4]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The 5' end of the miRNA may be offset with respect to previous annotations. MI0000825 Homo sapiens miR-345 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR346 This sequence is the predicted human homologue [2] of a sequence cloned from rat neuronal tissue [1]. The mature miRNA differs from the rat sequence at two positions, and its expression has not been verified in human. MI0000826 Homo sapiens miR-346 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIRLET7I MI0000827 Rattus norvegicus let-7a-1 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIRLET7I MI0000828 Rattus norvegicus let-7a-2 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIRLET7I MI0000829 Rattus norvegicus let-7b stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIRLET7I MI0000830 Rattus norvegicus let-7c-1 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIRLET7I MI0000831 Rattus norvegicus let-7c-2 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIRLET7I The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations. MI0000832 Rattus norvegicus let-7e stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIRLET7I MI0000833 Rattus norvegicus let-7f-1 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIRLET7I MI0000834 Rattus norvegicus let-7f-2 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIRLET7I The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The ends of the miRNA may be offset with respect to previous annotations. MI0000835 Rattus norvegicus let-7i stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR7-3 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations. MI0000836 Rattus norvegicus miR-7a-2 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR7-3 MI0000837 Rattus norvegicus miR-7b stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR9-3 MI0000838 Rattus norvegicus miR-9a-1 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR9-3 MI0000839 Rattus norvegicus miR-9a-3 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR9-3 MI0000840 Rattus norvegicus miR-9a-2 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR99B MI0000841 Rattus norvegicus miR-10a stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR99B MI0000842 Rattus norvegicus miR-10b stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR195 MI0000843 Rattus norvegicus miR-15b stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR195 MI0000844 Rattus norvegicus miR-16 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR20B The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations. MI0000845 Rattus norvegicus miR-17-1 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR20B This miRNA was predicted based on homology to a verified miRNA from mouse [1]. Its expression in rat was later verified by cloning [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations. MI0000846 Rattus norvegicus miR-18a stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR19B2 MI0000847 Rattus norvegicus miR-19b-1 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR19B2 MI0000848 Rattus norvegicus miR-19b-2 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR19B2 MI0000849 Rattus norvegicus miR-19a stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR21 MI0000850 Rattus norvegicus miR-21 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR22 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations. MI0000851 Rattus norvegicus miR-22 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR23B MI0000852 Rattus norvegicus miR-23a stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR23B MI0000853 Rattus norvegicus miR-23b stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR24-2 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations. MI0000854 Rattus norvegicus miR-24-1 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR24-2 MI0000855 Rattus norvegicus miR-24-2 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR92B MI0000856 Rattus norvegicus miR-25 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR26A2 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations. MI0000857 Rattus norvegicus miR-26a stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR26A2 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations. MI0000858 Rattus norvegicus miR-26b stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR27B MI0000859 Rattus norvegicus miR-27b stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR27B MI0000860 Rattus norvegicus miR-27a stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR151B MI0000861 Rattus norvegicus miR-28 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR29C MI0000862 Rattus norvegicus miR-29b-2 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR29C The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The ends of the miRNA may be offset with respect to previous annotations. MI0000863 Rattus norvegicus miR-29a stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR29C MI0000864 Rattus norvegicus miR-29b-1 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR29C The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations. MI0000865 Rattus norvegicus miR-29c-1 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR30E MI0000866 Rattus norvegicus miR-30c-1 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR30E The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations. MI0000867 Rattus norvegicus miR-30e stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR30E Landgraf et al. show that miRNA sequences from both arms of this hairpin precursor are similarly expressed [4]. MI0000868 Rattus norvegicus miR-30b stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR30E MI0000869 Rattus norvegicus miR-30d stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR30E MI0000870 Rattus norvegicus miR-30a stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR30E MI0000871 Rattus norvegicus miR-30c-2 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR31 MI0000872 Rattus norvegicus miR-31a stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR32 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations. MI0000873 Rattus norvegicus miR-32 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR33B The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations. MI0000874 Rattus norvegicus miR-33 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR34C MI0000875 Rattus norvegicus miR-34b stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR34C MI0000876 Rattus norvegicus miR-34c stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR34C The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations. MI0000877 Rattus norvegicus miR-34a stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR92B MI0000878 Rattus norvegicus miR-92a-1 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR92B MI0000879 Rattus norvegicus miR-92a-2 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR20B MI0000880 Rattus norvegicus miR-93 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR96 MI0000881 Rattus norvegicus miR-96 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIRLET7I MI0000882 Rattus norvegicus miR-98 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR99B MI0000883 Rattus norvegicus miR-99a stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR99B MI0000884 Rattus norvegicus miR-99b stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR99B MI0000885 Rattus norvegicus miR-100 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR101-2 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations. MI0000886 Rattus norvegicus miR-101a stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR103-2AS MI0000887 Rattus norvegicus miR-103-2 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR103-2AS MI0000888 Rattus norvegicus miR-103-1 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR20B MI0000889 Rattus norvegicus miR-106b stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR103-2AS MI0000890 Rattus norvegicus miR-107 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR3591 MI0000891 Rattus norvegicus miR-122 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR124-3 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations. MI0000892 Rattus norvegicus miR-124-3 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR124-3 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations. MI0000893 Rattus norvegicus miR-124-1 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR124-3 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations. MI0000894 Rattus norvegicus miR-124-2 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR99B The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations. MI0000895 Rattus norvegicus miR-125a stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR99B MI0000896 Rattus norvegicus miR-125b-1 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR99B MI0000897 Rattus norvegicus miR-125b-2 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR126 MI0000898 Rattus norvegicus miR-126a stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR127 MI0000899 Rattus norvegicus miR-127 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR128-2 The most commonly cloned mature sequences derived from the previously annotated mir-128a and mir-128b were shown by Landgraf et al to be identical [3]. The sequences are therefore renamed mir-128-1 and mir-128-2. MI0000900 Rattus norvegicus miR-128-1 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR128-2 The most commonly cloned mature sequences derived from the previously annotated mir-128a and mir-128b were shown by Landgraf et al to be identical [3]. The sequences are therefore renamed mir-128-1 and mir-128-2. MI0000901 Rattus norvegicus miR-128-2 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR129-2 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations. MI0000902 Rattus norvegicus miR-129-1 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR301B MI0000903 Rattus norvegicus miR-130a stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR301B MI0000904 Rattus norvegicus miR-130b stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR132 MI0000905 Rattus norvegicus miR-132 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR133B MI0000906 Rattus norvegicus miR-133a stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR134 MI0000907 Rattus norvegicus miR-134 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR135B MI0000908 Rattus norvegicus miR-135a stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR136 MI0000909 Rattus norvegicus miR-136 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR137 MI0000910 Rattus norvegicus miR-137 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR138-1 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations. MI0000911 Rattus norvegicus miR-138-2 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR138-1 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations. MI0000912 Rattus norvegicus miR-138-1 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR139 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations. MI0000913 Rattus norvegicus miR-139 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR429 MI0000914 Rattus norvegicus miR-141 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR142 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations. MI0000915 Rattus norvegicus miR-142 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR143 MI0000916 Rattus norvegicus miR-143 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR144 MI0000917 Rattus norvegicus miR-144 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR145 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations. MI0000918 Rattus norvegicus miR-145 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR146B MI0000919 Rattus norvegicus miR-146a stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR150 MI0000920 Rattus norvegicus miR-150 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR148B MI0000921 Rattus norvegicus miR-152 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR153-2 MI0000922 Rattus norvegicus miR-153 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR323B MI0000923 Rattus norvegicus miR-154 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR181D MI0000924 Rattus norvegicus miR-181c stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR181D MI0000925 Rattus norvegicus miR-181a-2 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR181D MI0000926 Rattus norvegicus miR-181b-1 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR181D MI0000927 Rattus norvegicus miR-181b-2 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR183 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations. MI0000928 Rattus norvegicus miR-183 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR184 MI0000929 Rattus norvegicus miR-184 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR185 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations. MI0000930 Rattus norvegicus miR-185 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR186 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations. MI0000931 Rattus norvegicus miR-186 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR187 MI0000932 Rattus norvegicus miR-187 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR190B MI0000933 Rattus norvegicus miR-190-1 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR191 MI0000934 Rattus norvegicus miR-191a stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR215 MI0000935 Rattus norvegicus miR-192 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR193B The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations. MI0000936 Rattus norvegicus miR-193 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR194-2 MI0000937 Rattus norvegicus miR-194-1 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR194-2 MI0000938 Rattus norvegicus miR-194-2 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR195 MI0000939 Rattus norvegicus miR-195 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR196B Yekta et al. report that miR-196 miRNAs are expressed from HOX gene clusters in mammals, and that HOX genes in these clusters are targets of miR-196. Indeed, HOXB8 mRNA was shown to be a natural target for miR-196-directed cleavage through a perfectly complementary miR-target site. Other HOX genes have imperfect miR-196 complementary sites indicative of regulation by translational repression [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations. MI0000940 Rattus norvegicus miR-196a stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR199B MI0000941 Rattus norvegicus miR-199a stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR429 MI0000942 Rattus norvegicus miR-200c stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR429 MI0000943 Rattus norvegicus miR-200a stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR429 MI0000944 Rattus norvegicus miR-200b stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR3545 MI0000945 Rattus norvegicus miR-203a stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR211 MI0000946 Rattus norvegicus miR-204 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR205 MI0000947 Rattus norvegicus miR-205 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR1-1 MI0000948 Rattus norvegicus miR-206 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR208B MI0000949 Rattus norvegicus miR-208 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR210 MI0000950 Rattus norvegicus miR-210 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR211 MI0000951 Rattus norvegicus miR-211 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR132 MI0000952 Rattus norvegicus miR-212 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR181D MI0000953 Rattus norvegicus miR-181a-1 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR3120 MI0000954 Rattus norvegicus miR-214 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR216B MI0000955 Rattus norvegicus miR-216a stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR217 MI0000956 Rattus norvegicus miR-217 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR218-2 MI0000957 Rattus norvegicus miR-218a-2 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR218-2 MI0000958 Rattus norvegicus miR-218a-1 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene NIL MI0000959 Rattus norvegicus miR-219a-1 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene NIL MI0000960 Rattus norvegicus miR-219a-2 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR222 MI0000961 Rattus norvegicus miR-221 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR222 MI0000962 Rattus norvegicus miR-222 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR223 MI0000963 Rattus norvegicus miR-223 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR371B MI0000964 Rattus norvegicus miR-290 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR371B This sequence is the predicted rat homologue of a confirmed miRNA from mouse [1]. Its expression has not been experimentally verified in rat. MI0000965 Rattus norvegicus miR-291a stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR371B MI0000966 Rattus norvegicus miR-292 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR296 MI0000967 Rattus norvegicus miR-296 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR297 This sequence is the predicted rat homologue of a confirmed miRNA from mouse [1]. Its expression has not been experimentally verified in rat. MI0000968 Rattus norvegicus miR-297 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR298 MI0000969 Rattus norvegicus miR-298 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR299 MI0000970 Rattus norvegicus miR-299 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR323B MI0000971 Rattus norvegicus miR-300 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR320E MI0000972 Rattus norvegicus miR-320 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR215 This mouse miRNA was predicted by computational methods using conservation with human and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. The 3' end was not experimentally determined. The mature sequence differs from the human miR-215 at A12->U, and its expression has not been verified in mouse. MI0000974 Mus musculus miR-215 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR384 MI0001145 Homo sapiens miR-384 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR384 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0001146 Mus musculus miR-384 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR196B miR-196b is predicted based on sequence homology to miR-196a [1]. Yekta et al. report that miR-196 miRNAs are expressed from HOX gene clusters in mammals, and that HOX genes in these clusters are targets of miR-196. Indeed, HOXB8 mRNA was shown to be a natural target for miR-196-directed cleavage through a perfectly complementary miR-target site. Other HOX genes have imperfect miR-196 complementary sites indicative of regulation by translational repression [1]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0001150 Homo sapiens miR-196b stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR196B miR-196b is predicted based on sequence homology to miR-196a [1]. Yekta et al. report that miR-196 miRNAs are expressed from HOX gene clusters in mammals, and that HOX genes in these clusters are targets of miR-196. Indeed, HOXB8 mRNA was shown to be a natural target for miR-196-directed cleavage through a perfectly complementary miR-target site. Other HOX genes have imperfect miR-196 complementary sites indicative of regulation by translational repression [1]. Landgraf et al. confirm expression of miR-196b in mouse by cloning [2]. MI0001151 Mus musculus miR-196b stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR196B miR-196b is predicted based on sequence homology to miR-196a [1]. Yekta et al. report that miR-196 miRNAs are expressed from HOX gene clusters in mammals, and that HOX genes in these clusters are targets of miR-196. Indeed, HOXB8 mRNA was shown to be a natural target for miR-196-directed cleavage through a perfectly complementary miR-target site. Other HOX genes have imperfect miR-196 complementary sites indicative of regulation by translational repression [1]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations. MI0001152 Rattus norvegicus miR-196b-1 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR323B Seitz et al. predicted a cluster of 40 miRNAs in the imprinted human 14q32 domain, and confirmed the expression of a subset by Northern blot or primer extension in mouse, including the miR-409-5p [1]. The 3' end of miR-409-5p was not determined and is predicted based on a miRNA length of 23 nts. Landgraf et al. later confirm expression of mature miRNAs from both arms of the hairpin [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. MI0001160 Mus musculus miR-409 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR323B Seitz et al. predicted a cluster of 40 miRNAs in the imprinted human 14q32 domain, and confirmed the expression of a subset by Northern blot or primer extension in mouse [1]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. MI0001161 Mus musculus miR-410 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR376A2 Seitz et al. predicted a cluster of 40 miRNAs in the imprinted human 14q32 domain, and confirmed the expression of a subset by Northern blot or primer extension in mouse [1]. The mature miR-376b products have been shown to be modified by A to I edits [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. MI0001162 Mus musculus miR-376b stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR1197 Seitz et al. predicted a cluster of 40 miRNAs in the imprinted human 14q32 domain, and confirmed the expression of a subset by Northern blot or primer extension in mouse, including the mature sequence from the 3' arm of this hairpin [1]. Landgraf et al. later showed that the 5' product is the predominant one [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations. MI0001163 Mus musculus miR-411 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR412 Seitz et al. predicted a cluster of 40 miRNAs in the imprinted human 14q32 domain, and confirmed the expression of a subset by Northern blot or primer extension in mouse [1]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The 5' end of the miRNA may be offset with respect to previous annotations. MI0001164 Mus musculus miR-412 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR370 Seitz et al. predicted a cluster of 40 miRNAs in the imprinted human 14q32 domain, and confirmed the expression of a subset by Northern blot or primer extension in mouse [1]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. MI0001165 Mus musculus miR-370 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR29C This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken. MI0001166 Gallus gallus miR-29a stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR29C MI0001167 Gallus gallus miR-29b-1 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIRLET7I MI0001168 Gallus gallus let-7i stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR135B MI0001169 Gallus gallus miR-135a-2 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR33B MI0001170 Gallus gallus miR-33 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIRLET7I MI0001171 Gallus gallus let-7a-3 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIRLET7I MI0001172 Gallus gallus let-7b stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR99B MI0001173 Gallus gallus miR-99a stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIRLET7I MI0001174 Gallus gallus let-7c stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR99B MI0001175 Gallus gallus miR-125b-2 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR155 This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken. MI0001176 Gallus gallus miR-155 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR222 MI0001177 Gallus gallus miR-222a stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR222 MI0001178 Gallus gallus miR-221 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR92B MI0001179 Gallus gallus miR-92 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR19B2 MI0001180 Gallus gallus miR-19b stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR20B MI0001181 Gallus gallus miR-20a stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR19B2 MI0001182 Gallus gallus miR-19a stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR20B MI0001183 Gallus gallus miR-18a stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR20B MI0001184 Gallus gallus miR-17 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR195 MI0001185 Gallus gallus miR-16-1 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR195 MI0001186 Gallus gallus miR-15a stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR26A2 MI0001187 Gallus gallus miR-26a stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR153-2 This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken. MI0001188 Gallus gallus miR-153 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR148B This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken. MI0001189 Gallus gallus miR-148a stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR196B MI0001190 Gallus gallus miR-196-2 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR138-1 MI0001191 Gallus gallus miR-138-1 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR128-2 MI0001192 Gallus gallus miR-128-2 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR187 MI0001193 Gallus gallus miR-187 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR32 This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken. MI0001194 Gallus gallus miR-32 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR133B This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken. MI0001195 Gallus gallus miR-133a-1 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR1-1 MI0001196 Gallus gallus miR-1a-2 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR124-3 MI0001197 Gallus gallus miR-124a stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR30E MI0001198 Gallus gallus miR-30d stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR30E MI0001199 Gallus gallus miR-30b stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR216B This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken. MI0001200 Gallus gallus miR-216 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR217 This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken. MI0001201 Gallus gallus miR-217 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR194-2 This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken. MI0001202 Gallus gallus miR-194 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR215 This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken. MI0001203 Gallus gallus miR-215 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR30E MI0001204 Gallus gallus miR-30a stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR30E MI0001205 Gallus gallus miR-30c-2 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR133B This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken. MI0001206 Gallus gallus miR-133b stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR1-1 This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken. MI0001207 Gallus gallus miR-206 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR223 MI0001208 Gallus gallus miR-223 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR20B MI0001209 Gallus gallus miR-18b stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR20B MI0001210 Gallus gallus miR-106 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR302F This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken. MI0001211 Gallus gallus miR-302a stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR218-2 MI0001212 Gallus gallus miR-218-1 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR103-2AS MI0001213 Gallus gallus miR-103-2 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR3545 MI0001214 Gallus gallus miR-203 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR103-2AS MI0001215 Gallus gallus miR-107 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR99B MI0001216 Gallus gallus miR-10b stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR128-2 MI0001217 Gallus gallus miR-128-1 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR181D MI0001218 Gallus gallus miR-181a-1 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR181D MI0001219 Gallus gallus miR-181b-1 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR199B Chicken has two loci predicted to express miR-199. mir-199-2 (MIR:MI0001220) is homologous to mir-199a-2 in human (MIR:MI0000281) and mouse (MIR:MI0000713). mir-199-1 (MIR:MI0001245) is homologous to mir-199b in human (MIR:MI0000282) and mouse (MIR:MI0000714). The expression of chicken miR-199 has been verified experimentally [2]. MI0001220 Gallus gallus miR-199-2 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR137 This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken. MI0001221 Gallus gallus miR-137 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR195 MI0001222 Gallus gallus miR-16-2 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR195 MI0001223 Gallus gallus miR-15b stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR190B MI0001224 Gallus gallus miR-190 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR211 This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken. MI0001225 Gallus gallus miR-204-2 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR7-3 MI0001226 Gallus gallus miR-7-2 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR184 This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken. MI0001227 Gallus gallus miR-184 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR138-1 MI0001228 Gallus gallus miR-138-2 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR140 MI0001229 Gallus gallus miR-140 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIRLET7I MI0001230 Gallus gallus let-7g stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR135B MI0001231 Gallus gallus miR-135a-1 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIRLET7I This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken. MI0001232 Gallus gallus let-7d stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIRLET7I MI0001233 Gallus gallus let-7f stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIRLET7I MI0001234 Gallus gallus let-7a-1 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR146B MI0001235 Gallus gallus miR-146a stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR103-2AS MI0001236 Gallus gallus miR-103-1 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR218-2 MI0001237 Gallus gallus miR-218-2 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR205 MI0001238 Gallus gallus miR-205b stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR301B MI0001239 Gallus gallus miR-130b stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR301B MI0001240 Gallus gallus miR-301 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR301B MI0001241 Gallus gallus miR-130a stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR181D MI0001242 Gallus gallus miR-181b-2 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR181D MI0001243 Gallus gallus miR-181a-2 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR126 MI0001244 Gallus gallus miR-126 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR199B Chicken has two loci predicted to express miR-199. mir-199-2 (MIR:MI0001220) is homologous to mir-199a-2 in human (MIR:MI0000281) and mouse (MIR:MI0000713). mir-199-1 (MIR:MI0001245) is homologous to mir-199b in human (MIR:MI0000282) and mouse (MIR:MI0000714). The expression of chicken miR-199 has been verified experimentally [2]. MI0001245 Gallus gallus miR-199-1 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene NIL MI0001246 Gallus gallus miR-219a stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR1-1 MI0001247 Gallus gallus miR-1a-1 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR133B This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken. MI0001248 Gallus gallus miR-133a-2 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR429 MI0001249 Gallus gallus miR-200a stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR429 MI0001250 Gallus gallus miR-200b stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR34C MI0001251 Gallus gallus miR-34a stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR124-3 This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken. MI0001252 Gallus gallus miR-124b stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR1-1 This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken. MI0001254 Gallus gallus miR-1b stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR133B This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken. MI0001255 Gallus gallus miR-133c stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR30E MI0001256 Gallus gallus miR-30e stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR30E MI0001257 Gallus gallus miR-30c-1 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR99B MI0001258 Gallus gallus miR-100 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIRLET7I MI0001259 Gallus gallus let-7a-2 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR34C This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken. MI0001260 Gallus gallus miR-34b stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR34C This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken. MI0001261 Gallus gallus miR-34c stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIRLET7I This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken. MI0001262 Gallus gallus let-7j stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIRLET7I This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken. MI0001263 Gallus gallus let-7k stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR135B MI0001264 Gallus gallus miR-135a-3 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR29C MI0001265 Gallus gallus miR-29c stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR29C MI0001266 Gallus gallus miR-29b-2 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR205 This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken. MI0001267 Gallus gallus miR-205a stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR196B MI0001268 Gallus gallus miR-196-1 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR7-3 MI0001269 Gallus gallus miR-7-3 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR101-2 MI0001270 Gallus gallus miR-101 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR211 This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken. MI0001271 Gallus gallus miR-204-1 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR7-3 MI0001272 Gallus gallus miR-7-1 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR23B MI0001273 Gallus gallus miR-23b stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR27B MI0001274 Gallus gallus miR-27b stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR24-2 MI0001275 Gallus gallus miR-24 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR31 MI0001276 Gallus gallus miR-31 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR3591 MI0001277 Gallus gallus miR-122-1 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR183 This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken. MI0001278 Gallus gallus miR-183 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR7-3 MI0001279 Gallus gallus miR-7b stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR3591 MI0001280 Gallus gallus miR-122-2 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR142 MI0001281 Gallus gallus miR-142 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR196B MI0001282 Gallus gallus miR-196-3 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR9-3 This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken. MI0001283 Gallus gallus miR-9-2 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR7-3 MI0001360 Danio rerio miR-7b stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR7-3 MI0001361 Danio rerio miR-7a-1 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR7-3 MI0001362 Danio rerio miR-7a-2 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR99B MI0001363 Danio rerio miR-10a stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR99B The miR-10b sequence described in [1] is offset by 2 nt with respect to that cloned in mouse (MIR:MI0000221). MI0001364 Danio rerio miR-10b-1 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR34C MI0001365 Danio rerio miR-34 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR181D MI0001366 Danio rerio miR-181b-1 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR181D MI0001367 Danio rerio miR-181b-2 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR182 MI0001368 Danio rerio miR-182 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR183 MI0001369 Danio rerio miR-183 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR187 MI0001370 Danio rerio miR-187-1 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR215 MI0001371 Danio rerio miR-192 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR196B MI0001372 Danio rerio miR-196a-1 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR199B MI0001373 Danio rerio miR-199-1 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR199B MI0001374 Danio rerio miR-199-2 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR199B MI0001375 Danio rerio miR-199-3 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR3545 MI0001376 Danio rerio miR-203a stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR211 MI0001377 Danio rerio miR-204-1 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR205 MI0001378 Danio rerio miR-205 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR210 Lim et al. cloned this miRNA from D. rerio [1]. The 3' end of the mature sequence was not determined, but was later analysed in a study of many clones in mouse [2]. The most common cloned length is shown here. MI0001379 Danio rerio miR-210 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR181D MI0001380 Danio rerio miR-181a-1 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR3120 MI0001381 Danio rerio miR-214 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR216B MI0001382 Danio rerio miR-216a stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR217 MI0001383 Danio rerio miR-217 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene NIL MI0001384 Danio rerio miR-219-1 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene NIL MI0001385 Danio rerio miR-219-2 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR222 MI0001387 Danio rerio miR-221 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR222 MI0001388 Danio rerio miR-222 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR223 MI0001389 Danio rerio miR-223 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR1264 MI0001423 Rattus norvegicus miR-421 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR422A miR-422a is an predicted paralogue of miR-422b (MIR:MI0001443), later verified in human [2]. MI0001444 Homo sapiens miR-422a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR423 miR-423 (renamed miR-423-3p here) is expressed in human promyelocytic leukemia (HL-60) cells [1]. The level of expression was shown to be up-regulated 48 hours after TPA-induction. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0001445 Homo sapiens miR-423 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR424 This hairpin precursor expresses a 5' arm product, named miR-424, in human promyelocytic leukemia (HL-60) cells [1]. The level of expression of miR-424 was shown to be up-regulated 48 hours after TPA-induction. The sequence is orthologous to the experimentally verified rat miR-322 locus (MIR:MI0000589), which expresses its mature product from the 3' arm of the hairpin. The human miR-424 hairpin does not appear to contain the miR-322 sequence. MI0001446 Homo sapiens miR-424 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR425 MI0001447 Mus musculus miR-425 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR425 The mature sequences were previously named miR-425-5p and miR-425-3p in [2] and here. Landgraf et al. show that the 5' product is the predominant one [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. MI0001448 Homo sapiens miR-425 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR20B MI0001517 Gallus gallus miR-20b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR18B The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0001518 Homo sapiens miR-18b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR20B MI0001519 Homo sapiens miR-20b stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR431 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. MI0001524 Mus musculus miR-431 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR433 MI0001525 Mus musculus miR-433 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR448 Xie et al. [1] refer to this sequence by the internal identifier MIR64. The sequence is unrelated to C. elegans mir-64 (MIR:MI0000035). MI0001637 Homo sapiens miR-448 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR448 Xie et al. [1] refer to this sequence by the internal identifier MIR64. The sequence is unrelated to C. elegans mir-64 (MIR:MI0000035). MI0001638 Mus musculus miR-448 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR448 Xie et al. [1] refer to this sequence by the internal identifier MIR64. The sequence is unrelated to C. elegans mir-64 (MIR:MI0000035). MI0001639 Rattus norvegicus miR-448 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR448 Xie et al. [1] refer to this sequence by the internal identifier MIR64. The sequence is unrelated to C. elegans mir-64 (MIR:MI0000035). MI0001640 Canis familiaris miR-448 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR429 Xie et al. [1] refer to this sequence by the internal identifier MIR201. The sequence is unrelated to mouse mir-201 (MIR:MI0000244). MI0001641 Homo sapiens miR-429 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR429 Xie et al. [1] refer to this sequence by the internal identifier MIR201. The sequence is unrelated to mouse mir-201 (MIR:MI0000244). MI0001642 Mus musculus miR-429 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR429 Xie et al. [1] refer to this sequence by the internal identifier MIR201. The sequence is unrelated to mouse mir-201 (MIR:MI0000244). MI0001643 Rattus norvegicus miR-429 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR429 Xie et al. [1] refer to this sequence by the internal identifier MIR201. The sequence is unrelated to mouse mir-201 (MIR:MI0000244). MI0001644 Canis familiaris miR-429 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR365-2 Xie et al. [1] refer to this sequence by the internal identifier MIR190. The sequence is unrelated to mammalian mir-190 (MIR:MI0000486). MI0001645 Mus musculus miR-365-2 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR365-2 Xie et al. [1] refer to this sequence by the internal identifier MIR190. The sequence is unrelated to mammalian mir-190 (MIR:MI0000486). MI0001647 Canis familiaris miR-365-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR449A Xie et al. [1] refer to this sequence by the internal identifier MIR54. The sequence is unrelated to C. elegans mir-54 (MIR:MI0000025). MI0001648 Homo sapiens miR-449a stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR449C Xie et al. [1] refer to this sequence by the internal identifier MIR54. The sequence is unrelated to C. elegans mir-54 (MIR:MI0000025). MI0001649 Mus musculus miR-449a stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR449C MI0001650 Rattus norvegicus miR-449a stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR449C Xie et al. [1] refer to this sequence by the internal identifier MIR54. The sequence is unrelated to C. elegans mir-54 (MIR:MI0000025). MI0001651 Canis familiaris miR-449 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR450A1 Xie et al. [1] refer to this sequence by the internal identifier MIR238. The sequence is unrelated to C. elegans mir-238 (MIR:MI0000313). MI0001652 Homo sapiens miR-450a-1 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR450B Xie et al. [1] refer to this sequence by the internal identifier MIR238. The sequence is unrelated to C. elegans mir-238 (MIR:MI0000313). MI0001653 Mus musculus miR-450a-1 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR450B Xie et al. [1] refer to this sequence by the internal identifier MIR238. The sequence is unrelated to C. elegans mir-238 (MIR:MI0000313). MI0001654 Rattus norvegicus miR-450a stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR450B Xie et al. [1] refer to this sequence by the internal identifier MIR238. The sequence is unrelated to C. elegans mir-238 (MIR:MI0000313). MI0001655 Canis familiaris miR-450a stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR365-2 Xie et al. [1] refer to this sequence by the internal identifier MIR245. The sequence is unrelated to C. elegans mir-245 (MIR:MI0000321). MI0001656 Rattus norvegicus miR-365 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR365-2 Xie et al. [1] refer to this sequence by the internal identifier MIR245. The sequence is unrelated to C. elegans mir-245 (MIR:MI0000321). MI0001657 Canis familiaris miR-365-1 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR429 MI0001720 Danio rerio miR-429 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR431 MI0001721 Homo sapiens miR-431 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR431 MI0001722 Rattus norvegicus miR-431 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR433 MI0001723 Homo sapiens miR-433 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR433 MI0001724 Rattus norvegicus miR-433 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR329-1 MI0001725 Homo sapiens miR-329-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR329-2 MI0001726 Homo sapiens miR-329-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR451 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. MI0001729 Homo sapiens miR-451a stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR451B MI0001730 Mus musculus miR-451 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR451B MI0001731 Rattus norvegicus miR-451 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR451B MI0001732 Danio rerio miR-451 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR452 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The 5' end of the miRNA may be offset with respect to previous annotations. MI0001733 Homo sapiens miR-452 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR452 MI0001734 Mus musculus miR-452 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR409 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The 5' end of the miRNA may be offset with respect to previous annotations. MI0001735 Homo sapiens miR-409 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIRLET7I MI0001857 Danio rerio let-7a-1 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIRLET7I MI0001858 Danio rerio let-7a-2 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIRLET7I MI0001860 Danio rerio let-7a-3 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIRLET7I MI0001861 Danio rerio let-7a-4 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIRLET7I MI0001862 Danio rerio let-7a-5 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIRLET7I MI0001863 Danio rerio let-7a-6 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIRLET7I MI0001865 Danio rerio let-7b stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIRLET7I MI0001866 Danio rerio let-7c-1 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIRLET7I MI0001867 Danio rerio let-7c-2 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIRLET7I MI0001868 Danio rerio let-7d-1 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIRLET7I MI0001870 Danio rerio let-7d-2 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIRLET7I MI0001871 Danio rerio let-7e stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIRLET7I MI0001872 Danio rerio let-7f stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIRLET7I MI0001873 Danio rerio let-7g-1 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIRLET7I MI0001874 Danio rerio let-7g-2 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIRLET7I MI0001875 Danio rerio let-7h stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIRLET7I MI0001876 Danio rerio let-7i stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR1-1 MI0001877 Danio rerio miR-1-2 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR1-1 MI0001878 Danio rerio miR-1-1 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR7-3 MI0001879 Danio rerio miR-7a-3 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR9-3 MI0001880 Danio rerio miR-9-1 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR9-3 MI0001881 Danio rerio miR-9-2 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR9-3 MI0001882 Danio rerio miR-9-4 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR9-3 MI0001883 Danio rerio miR-9-3 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR9-3 MI0001884 Danio rerio miR-9-5 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR9-3 MI0001885 Danio rerio miR-9-6 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR9-3 MI0001886 Danio rerio miR-9-7 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR99B MI0001887 Danio rerio miR-10b-2 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR99B MI0001888 Danio rerio miR-10c stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR99B MI0001889 Danio rerio miR-10d stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR195 MI0001891 Danio rerio miR-15a-1 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR195 MI0001892 Danio rerio miR-15a-2 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR195 MI0001893 Danio rerio miR-15b stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR195 MI0001894 Danio rerio miR-16a stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR195 MI0001895 Danio rerio miR-16b stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR195 MI0001896 Danio rerio miR-16c stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR20B MI0001897 Danio rerio miR-17a-1 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR20B MI0001898 Danio rerio miR-17a-2 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR20B MI0001899 Danio rerio miR-20b stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR20B MI0001900 Danio rerio miR-18a stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR20B MI0001901 Danio rerio miR-18b stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR20B MI0001902 Danio rerio miR-18c stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR19B2 MI0001903 Danio rerio miR-19a stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR19B2 MI0001904 Danio rerio miR-19b stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR19B2 MI0001905 Danio rerio miR-19c stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR19B2 MI0001906 Danio rerio miR-19d stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR20B MI0001907 Danio rerio miR-20a stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR21 MI0001908 Danio rerio miR-21-1 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR21 MI0001909 Danio rerio miR-21-2 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR22 MI0001910 Danio rerio miR-22a stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR22 MI0001912 Danio rerio miR-22b stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR23B MI0001913 Danio rerio miR-23a-1 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR23B MI0001915 Danio rerio miR-23a-2 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR23B MI0001916 Danio rerio miR-23a-3 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR23B MI0001917 Danio rerio miR-23b stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR24-2 MI0001918 Danio rerio miR-24-4 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR24-2 MI0001919 Danio rerio miR-24-2 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR24-2 MI0001920 Danio rerio miR-24-3 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR24-2 MI0001921 Danio rerio miR-24-1 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR92B MI0001922 Danio rerio miR-25 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR26A2 MI0001923 Danio rerio miR-26a-1 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR26A2 MI0001925 Danio rerio miR-26a-2 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR26A2 MI0001926 Danio rerio miR-26a-3 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR26A2 MI0001927 Danio rerio miR-26b stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR27B MI0001928 Danio rerio miR-27a stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR27B MI0001929 Danio rerio miR-27b stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR27B MI0001930 Danio rerio miR-27c-1 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR27B MI0001931 Danio rerio miR-27d stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR27B MI0001932 Danio rerio miR-27e stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR29C MI0001933 Danio rerio miR-29b-1 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR29C MI0001934 Danio rerio miR-29b-2 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR29C MI0001938 Danio rerio miR-29a stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR30E MI0001940 Danio rerio miR-30a stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR30E MI0001941 Danio rerio miR-30b stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR30E MI0001944 Danio rerio miR-30c stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR30E MI0001946 Danio rerio miR-30d stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR30E MI0001950 Danio rerio miR-30e-2 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR92B MI0001951 Danio rerio miR-92a-1 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR92B MI0001952 Danio rerio miR-92a-2 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR92B MI0001953 Danio rerio miR-92b stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR20B MI0001954 Danio rerio miR-93 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR96 MI0001955 Danio rerio miR-96 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR99B MI0001956 Danio rerio miR-99-1 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR99B MI0001957 Danio rerio miR-99-2 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR99B MI0001958 Danio rerio miR-100-1 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR99B MI0001959 Danio rerio miR-100-2 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR101-2 MI0001960 Danio rerio miR-101a stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR101-2 MI0001961 Danio rerio miR-101b stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR103-2AS MI0001962 Danio rerio miR-103 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR103-2AS MI0001963 Danio rerio miR-107 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR3591 MI0001965 Danio rerio miR-122 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR124-3 MI0001966 Danio rerio miR-124-1 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR124-3 MI0001967 Danio rerio miR-124-2 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR124-3 MI0001968 Danio rerio miR-124-3 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR124-3 MI0001969 Danio rerio miR-124-4 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR124-3 MI0001970 Danio rerio miR-124-5 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR124-3 MI0001971 Danio rerio miR-124-6 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR99B MI0001972 Danio rerio miR-125a-1 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR99B MI0001973 Danio rerio miR-125a-2 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR99B MI0001975 Danio rerio miR-125b-1 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR99B MI0001976 Danio rerio miR-125b-2 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR99B MI0001977 Danio rerio miR-125b-3 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR99B MI0001978 Danio rerio miR-125c stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR126 MI0001979 Danio rerio miR-126a stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR128-2 MI0001980 Danio rerio miR-128-1 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR128-2 MI0001981 Danio rerio miR-128-2 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR129-2 MI0001982 Danio rerio miR-129-2 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR129-2 MI0001983 Danio rerio miR-129-1 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR301B MI0001984 Danio rerio miR-130a stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR301B MI0001986 Danio rerio miR-130b stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR301B MI0001987 Danio rerio miR-130c-1 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR301B MI0001988 Danio rerio miR-130c-2 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR132 MI0001989 Danio rerio miR-132-1 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR132 MI0001991 Danio rerio miR-132-2 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR133B MI0001992 Danio rerio miR-133a-2 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR133B MI0001993 Danio rerio miR-133a-1 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR133B MI0001994 Danio rerio miR-133b stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR133B MI0001995 Danio rerio miR-133c stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR135B MI0001996 Danio rerio miR-135c-1 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR135B MI0001997 Danio rerio miR-135c-2 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR137 MI0002000 Danio rerio miR-137-1 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR137 MI0002001 Danio rerio miR-137-2 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR138-1 MI0002002 Danio rerio miR-138 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR140 MI0002003 Danio rerio miR-140 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR429 MI0002004 Danio rerio miR-141 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR142 MI0002005 Danio rerio miR-142a stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR142 MI0002006 Danio rerio miR-142b stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR143 The cloned mature miR-143 sequence always appears to be 22nt in length, modified by the addition of a 3' U residue not found in the genomic sequence [1]. MI0002007 Danio rerio miR-143-1 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR143 The cloned mature miR-143 sequence always appears to be 22nt in length, modified by the addition of a 3' U residue not found in the genomic sequence [1]. MI0002008 Danio rerio miR-143-2 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR144 MI0002009 Danio rerio miR-144 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR145 MI0002010 Danio rerio miR-145 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR146B MI0002012 Danio rerio miR-146a stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR146B MI0002013 Danio rerio miR-146b stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR148B MI0002015 Danio rerio miR-148 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR150 MI0002016 Danio rerio miR-150 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR148B MI0002017 Danio rerio miR-152 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR153-2 MI0002019 Danio rerio miR-153b stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR153-2 MI0002021 Danio rerio miR-153a stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR153-2 MI0002022 Danio rerio miR-153c stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR155 MI0002023 Danio rerio miR-155 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR181D MI0002024 Danio rerio miR-181c stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR184 MI0002026 Danio rerio miR-184 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR190B MI0002027 Danio rerio miR-190 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR193B MI0002029 Danio rerio miR-193a-1 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR193B MI0002030 Danio rerio miR-193a-2 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR193B MI0002032 Danio rerio miR-193b stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR194-2 MI0002033 Danio rerio miR-194a stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR194-2 MI0002034 Danio rerio miR-194b stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR196B MI0002035 Danio rerio miR-196a-2 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR196B MI0002036 Danio rerio miR-196b stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR429 MI0002037 Danio rerio miR-200a stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR429 MI0002038 Danio rerio miR-200b stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR429 MI0002039 Danio rerio miR-200c stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR202 MI0002040 Danio rerio miR-202 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR3545 MI0002041 Danio rerio miR-203b stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR211 MI0002042 Danio rerio miR-204-2 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR1-1 MI0002045 Danio rerio miR-206-1 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR1-1 MI0002046 Danio rerio miR-206-2 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR216B MI0002048 Danio rerio miR-216b stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR218-2 MI0002051 Danio rerio miR-218a-1 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR218-2 MI0002052 Danio rerio miR-218a-2 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR218-2 MI0002053 Danio rerio miR-218b stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene NIL MI0002054 Danio rerio miR-219-3 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR301B MI0002059 Danio rerio miR-301a stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR301B MI0002061 Danio rerio miR-301b stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR301B MI0002062 Danio rerio miR-301c stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR338 MI0002063 Danio rerio miR-338-1 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR338 MI0002064 Danio rerio miR-338-2 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR363 MI0002067 Danio rerio miR-363 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR365-2 MI0002068 Danio rerio miR-365-1 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR365-2 MI0002069 Danio rerio miR-365-2 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR365-2 MI0002070 Danio rerio miR-365-3 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR375 MI0002072 Danio rerio miR-375-1 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR375 MI0002073 Danio rerio miR-375-2 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR454 MI0002074 Danio rerio miR-454a stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR454 MI0002076 Danio rerio miR-454b stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR455 The mir-455 precursor was predicted computationally and a mature product verified in human by Northern blot [2]. The precise sequence termini of the mature form were derived by cloning from human and rat samples (Landgraf and Tuschl, unpublished). MI0002077 Danio rerio miR-455-1 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR195 MI0002177 Danio rerio miR-457a stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR195 MI0002178 Danio rerio miR-457b stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 The sequence of miR-467 is of low complexity. The sequence maps exactly to several genomic positions, and many more with 1 or 2 substitutions. Confidence in this miRNA might therefore be reduced. MI0002402 Mus musculus miR-467a-1 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene NIL The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. MI0002405 Mus musculus miR-470 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR412 MI0002464 Homo sapiens miR-412 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR410 MI0002465 Homo sapiens miR-410 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR376B The mature miR-376b products have been shown to be modified by A to I edits [2]. MI0002466 Homo sapiens miR-376b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR483 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0002467 Homo sapiens miR-483 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR484 MI0002468 Homo sapiens miR-484 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR485 MI0002469 Homo sapiens miR-485 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR486 MI0002470 Homo sapiens miR-486 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR487A MI0002471 Homo sapiens miR-487a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR488 miR-488-3p cloned in [2] has a 1 nt 3' extension (U), which is incompatible with the genome sequence. MI0003123 Homo sapiens miR-488 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR489 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations. MI0003124 Homo sapiens miR-489 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR490 MI0003125 Homo sapiens miR-490 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR491 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0003126 Homo sapiens miR-491 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR511-1 MI0003127 Homo sapiens miR-511 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR146B MI0003129 Homo sapiens miR-146b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR202 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0003130 Homo sapiens miR-202 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR492 MI0003131 Homo sapiens miR-492 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR493 The mature miRNA sequences were named miR-493-5p and miR-493-3p in [1,2] and here. Landgraf et al. showed that the 3' product is the predominant one [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. MI0003132 Homo sapiens miR-493 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR432 MI0003133 Homo sapiens miR-432 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR494 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. MI0003134 Homo sapiens miR-494 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR495 MI0003135 Homo sapiens miR-495 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR496 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations. miR-496 cloned in [2] has a 1 nt 3' extension (U), which is incompatible with the genome sequence. MI0003136 Homo sapiens miR-496 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR193B The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. MI0003137 Homo sapiens miR-193b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR497 MI0003138 Homo sapiens miR-497 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR181D The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0003139 Homo sapiens miR-181d stem-loop A pre-miRNA processed from the primary transcript of human gene MIR512-1 MI0003140 Homo sapiens miR-512-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR512-2 MI0003141 Homo sapiens miR-512-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR498 MI0003142 Homo sapiens miR-498 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR520E MI0003143 Homo sapiens miR-520e stem-loop A pre-miRNA processed from the primary transcript of human gene MIR515-1 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0003144 Homo sapiens miR-515-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR519E The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations. MI0003145 Homo sapiens miR-519e stem-loop A pre-miRNA processed from the primary transcript of human gene MIR520F MI0003146 Homo sapiens miR-520f stem-loop A pre-miRNA processed from the primary transcript of human gene MIR515-2 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0003147 Homo sapiens miR-515-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR519C The 5' arm of this precursor expresses a product related to miR-526 (previously named miR-526c here). Landgraf et al. confirm mature miRNA expression from both arms of the precursor [2], leading to the -5p, -3p designations. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0003148 Homo sapiens miR-519c stem-loop A pre-miRNA processed from the primary transcript of human gene MIR520A MI0003149 Homo sapiens miR-520a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR526B The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0003150 Homo sapiens miR-526b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR519B The 5' arm of this precursor expresses a product related to miR-526 (previously named miR-526c here). Landgraf et al. confirm mature miRNA expression from both arms of the precursor [2], leading to the -5p, -3p designations. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0003151 Homo sapiens miR-519b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR525 The mature products were previously named miR-525 and miR-525* in [1] and here. Landgraf et al. show that both products are significantly expressed, prompting a renaming to miR-525-5p and miR-525-3p [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0003152 Homo sapiens miR-525 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR523 MI0003153 Homo sapiens miR-523 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR518F The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations. MI0003154 Homo sapiens miR-518f stem-loop A pre-miRNA processed from the primary transcript of human gene MIR520B MI0003155 Homo sapiens miR-520b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR518B MI0003156 Homo sapiens miR-518b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR526A1 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0003157 Homo sapiens miR-526a-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR520C The 5' arm of this precursor expresses a product related to miR-526 (previously named miR-526c here). Landgraf et al. confirm mature miRNA expression from both arms of the precursor [2], leading to the -5p, -3p designations. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0003158 Homo sapiens miR-520c stem-loop A pre-miRNA processed from the primary transcript of human gene MIR518C The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0003159 Homo sapiens miR-518c stem-loop A pre-miRNA processed from the primary transcript of human gene MIR524 MI0003160 Homo sapiens miR-524 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR517A The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0003161 Homo sapiens miR-517a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR519D The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0003162 Homo sapiens miR-519d stem-loop A pre-miRNA processed from the primary transcript of human gene MIR521-2 MI0003163 Homo sapiens miR-521-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR520D The mature products were previously named miR-520d and miR-520d* here and in [1]. Landgraf et al. show that both products may be significantly expressed [2]. They are therefore renamed miR-520d-5p and miR-520d-3p. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations. MI0003164 Homo sapiens miR-520d stem-loop A pre-miRNA processed from the primary transcript of human gene MIR517B MI0003165 Homo sapiens miR-517b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR520G MI0003166 Homo sapiens miR-520g stem-loop A pre-miRNA processed from the primary transcript of human gene MIR516B2 MI0003167 Homo sapiens miR-516b-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR526A2 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0003168 Homo sapiens miR-526a-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR518E MI0003169 Homo sapiens miR-518e stem-loop A pre-miRNA processed from the primary transcript of human gene MIR518A1 The 5' mature product was previously named miR-527 in [1] and here. Landgraf et al. showed that products from both arms are approximately equally expressed [2]. miR-527 is renamed miR-518a-5p here. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations. miR-518a-5p cloned in [2] has a 1 nt 3' extension (A), which is incompatible with the genome sequence. MI0003170 Homo sapiens miR-518a-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR518D The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0003171 Homo sapiens miR-518d stem-loop A pre-miRNA processed from the primary transcript of human gene MIR516B1 MI0003172 Homo sapiens miR-516b-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR518A2 The 5' mature product was previously named miR-527 in [1] and here. Landgraf et al. showed that products from both arms are approximately equally expressed [2]. miR-527 is renamed miR-518a-5p here. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations. miR-518a-5p cloned in [2] has a 1 nt 3' extension (A), which is incompatible with the genome sequence. MI0003173 Homo sapiens miR-518a-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR517C MI0003174 Homo sapiens miR-517c stem-loop A pre-miRNA processed from the primary transcript of human gene MIR520H MI0003175 Homo sapiens miR-520h stem-loop A pre-miRNA processed from the primary transcript of human gene MIR521-1 MI0003176 Homo sapiens miR-521-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR522 MI0003177 Homo sapiens miR-522 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR519A1 MI0003178 Homo sapiens miR-519a-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR527 miR-527 cloned in [2] has a 1 nt 3' extension (A), which is incompatible with the genome sequence. MI0003179 Homo sapiens miR-527 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR516A1 MI0003180 Homo sapiens miR-516a-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR516A2 MI0003181 Homo sapiens miR-516a-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR519A2 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0003182 Homo sapiens miR-519a-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR499 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0003183 Homo sapiens miR-499a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR500A MI0003184 Homo sapiens miR-500a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR501 MI0003185 Homo sapiens miR-501 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR502 Extensive cloning studies suggest that the 3' product may be the predominant one [2]. MI0003186 Homo sapiens miR-502 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR450A2 MI0003187 Homo sapiens miR-450a-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR503 MI0003188 Homo sapiens miR-503 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR504 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0003189 Homo sapiens miR-504 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR505 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations. MI0003190 Homo sapiens miR-505 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR513A1 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0003191 Homo sapiens miR-513a-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR513A2 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0003192 Homo sapiens miR-513a-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR506 MI0003193 Homo sapiens miR-506 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR507 MI0003194 Homo sapiens miR-507 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR508 MI0003195 Homo sapiens miR-508 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR509-1 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The cloned miR-509-5p sequence from [3] includes a 1 nt extension at the 3' end (A), which is incompatible with the genome sequence. MI0003196 Homo sapiens miR-509-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR510 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0003197 Homo sapiens miR-510 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR514-1 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0003198 Homo sapiens miR-514a-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR514-2 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0003199 Homo sapiens miR-514a-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR514-3 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0003200 Homo sapiens miR-514a-3 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR532 MI0003205 Homo sapiens miR-532 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR660 MI0003206 Mus musculus miR-532 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR184 This zebrafish miRNA sequence is predicted based on homology with a verified mammalian sequence (Mihaela Zavolan, personal communication). MI0003243 Danio rerio miR-184-2 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR489 miR-489 was predicted in zebrafish based on homology with a verified mammalian sequence (Mihaela Zavolan, personal communication), and later verified experimentally [1]. MI0003256 Danio rerio miR-489 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIRLET7I This zebrafish miRNA sequence is predicted based on homology with a verified mammalian sequence (Mihaela Zavolan, personal communication). MI0003343 Danio rerio let-7j stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR135B This zebrafish miRNA sequence is predicted based on homology with a verified mammalian sequence (Mihaela Zavolan, personal communication). MI0003364 Danio rerio miR-135b stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR132 This miRNA was predicted by computational methods using conservation between human, mouse and Fugu rubripes sequences [1]. Expression of the excised miR was validated in zebrafish, and the 5' end mapped by PCR. The 3' end was not experimentally determined. MI0003385 Danio rerio miR-212 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR181D This zebrafish miRNA sequence is predicted based on homology with a verified mammalian sequence (Mihaela Zavolan, personal communication). MI0003387 Danio rerio miR-181a-2 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR489 MI0003476 Mus musculus miR-489 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR489 MI0003477 Rattus norvegicus miR-489 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR383 MI0003478 Rattus norvegicus miR-383 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR500B MI0003480 Rattus norvegicus miR-501 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR361 MI0003481 Rattus norvegicus miR-361 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR215 MI0003482 Rattus norvegicus miR-215 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR224 MI0003483 Rattus norvegicus miR-224 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR483 MI0003484 Mus musculus miR-483 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR483 MI0003485 Rattus norvegicus miR-483 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR370 MI0003486 Rattus norvegicus miR-370 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR323B MI0003487 Rattus norvegicus miR-377 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR412 MI0003488 Rattus norvegicus miR-412 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR1-1 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations. MI0003489 Rattus norvegicus miR-1 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR133B The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations. MI0003490 Rattus norvegicus miR-133b stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR484 MI0003491 Mus musculus miR-484 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR485 miR-485-3p was predicted by Sewer et al [1], and its expression later verified experimentally by Mineno et al using MPSS technology [2]. The MPSS protocol used provides 22nt sequences, but the true extents of the mature miRNA are not reliably obtained. Landgraf et al. show that the 5' product is the predominant one [3]. MI0003492 Mus musculus miR-485 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene NIL MI0003493 Mus musculus miR-486a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR455 The mir-455 precursor was predicted computationally and a 5' mature product verified in human by Northern blot [1]. The precise sequence termini of the mature forms were derived by cloning from human and rat samples [2]. MI0003513 Homo sapiens miR-455 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR539 MI0003514 Homo sapiens miR-539 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR544 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0003515 Homo sapiens miR-544a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR545 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations. MI0003516 Homo sapiens miR-545 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR543 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. MI0003519 Mus musculus miR-543 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR323B MI0003520 Mus musculus miR-539 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR541 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. MI0003521 Mus musculus miR-541 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR542 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. MI0003522 Mus musculus miR-542 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR543 MI0003525 Rattus norvegicus miR-543 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR323B MI0003526 Rattus norvegicus miR-539 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR541 MI0003527 Rattus norvegicus miR-541 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR542 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations. MI0003528 Rattus norvegicus miR-542-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR376A2 The mature miR-376a products have been shown to be modified by A to I edits [2]. MI0003529 Homo sapiens miR-376a-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR487B MI0003530 Homo sapiens miR-487b stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR367 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. MI0003531 Mus musculus miR-367 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR323B The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. MI0003532 Mus musculus miR-494 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR376A2 The mature miR-376c products have been shown to be modified by A to I edits [2]. MI0003533 Mus musculus miR-376c stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR323B The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0003534 Mus musculus miR-487b stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR323B The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0003535 Mus musculus miR-369 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR20B The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. MI0003536 Mus musculus miR-20b stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR450B MI0003537 Mus musculus miR-450a-2 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR503 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5]. MI0003538 Mus musculus miR-503 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR371B The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0003539 Mus musculus miR-291b stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR493 MI0003540 Rattus norvegicus miR-493 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR1197 MI0003541 Rattus norvegicus miR-379 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR323B MI0003542 Rattus norvegicus miR-494 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR376A2 MI0003543 Rattus norvegicus miR-376c stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR376A2 MI0003544 Rattus norvegicus miR-376b stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR376A2 MI0003545 Rattus norvegicus miR-376a stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR323B MI0003546 Rattus norvegicus miR-381 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR323B MI0003547 Rattus norvegicus miR-487b stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR323B MI0003548 Rattus norvegicus miR-382 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR485 MI0003549 Rattus norvegicus miR-485 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR323B MI0003550 Rattus norvegicus miR-409 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR323B MI0003551 Rattus norvegicus miR-369 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR374C MI0003552 Rattus norvegicus miR-374 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR363 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations. MI0003553 Rattus norvegicus miR-363 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR20B The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations. MI0003554 Rattus norvegicus miR-20b stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR503 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations. MI0003555 Rattus norvegicus miR-503-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR551A MI0003556 Homo sapiens miR-551a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR552 MI0003557 Homo sapiens miR-552 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR553 MI0003558 Homo sapiens miR-553 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR554 MI0003559 Homo sapiens miR-554 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR92B The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0003560 Homo sapiens miR-92b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR555 MI0003561 Homo sapiens miR-555 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR556 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0003562 Homo sapiens miR-556 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR557 MI0003563 Homo sapiens miR-557 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR558 MI0003564 Homo sapiens miR-558 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR559 MI0003565 Homo sapiens miR-559 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR561 MI0003567 Homo sapiens miR-561 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR562 MI0003568 Homo sapiens miR-562 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR563 MI0003569 Homo sapiens miR-563 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR564 MI0003570 Homo sapiens miR-564 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR566 MI0003572 Homo sapiens miR-566 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR567 MI0003573 Homo sapiens miR-567 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR568 MI0003574 Homo sapiens miR-568 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR551B MI0003575 Homo sapiens miR-551b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR569 MI0003576 Homo sapiens miR-569 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR570 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations. MI0003577 Homo sapiens miR-570 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR571 MI0003578 Homo sapiens miR-571 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR572 MI0003579 Homo sapiens miR-572 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR573 MI0003580 Homo sapiens miR-573 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR574 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0003581 Homo sapiens miR-574 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR575 MI0003582 Homo sapiens miR-575 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR576 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0003583 Homo sapiens miR-576 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR577 MI0003584 Homo sapiens miR-577 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR578 MI0003585 Homo sapiens miR-578 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR579 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations. MI0003586 Homo sapiens miR-579 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR580 MI0003587 Homo sapiens miR-580 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR581 MI0003588 Homo sapiens miR-581 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR582 MI0003589 Homo sapiens miR-582 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR583 MI0003590 Homo sapiens miR-583 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR584 MI0003591 Homo sapiens miR-584 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR585 MI0003592 Homo sapiens miR-585 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548A1 MI0003593 Homo sapiens miR-548a-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR586 MI0003594 Homo sapiens miR-586 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR587 MI0003595 Homo sapiens miR-587 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548B MI0003596 Homo sapiens miR-548b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR588 MI0003597 Homo sapiens miR-588 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548A2 MI0003598 Homo sapiens miR-548a-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR589 MI0003599 Homo sapiens miR-589 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR550A1 MI0003600 Homo sapiens miR-550a-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR550A2 MI0003601 Homo sapiens miR-550a-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR590 MI0003602 Homo sapiens miR-590 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR591 MI0003603 Homo sapiens miR-591 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR592 MI0003604 Homo sapiens miR-592 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR593 MI0003605 Homo sapiens miR-593 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR595 MI0003607 Homo sapiens miR-595 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR596 MI0003608 Homo sapiens miR-596 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR597 MI0003609 Homo sapiens miR-597 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR598 MI0003610 Homo sapiens miR-598 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR599 MI0003611 Homo sapiens miR-599 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548A3 MI0003612 Homo sapiens miR-548a-3 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR600 MI0003613 Homo sapiens miR-600 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR601 MI0003614 Homo sapiens miR-601 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR602 MI0003615 Homo sapiens miR-602 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR603 MI0003616 Homo sapiens miR-603 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR604 MI0003617 Homo sapiens miR-604 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR605 MI0003618 Homo sapiens miR-605 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR606 MI0003619 Homo sapiens miR-606 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR607 MI0003620 Homo sapiens miR-607 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR608 MI0003621 Homo sapiens miR-608 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR609 MI0003622 Homo sapiens miR-609 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR610 MI0003623 Homo sapiens miR-610 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR611 MI0003624 Homo sapiens miR-611 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR612 MI0003625 Homo sapiens miR-612 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR613 MI0003626 Homo sapiens miR-613 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR614 MI0003627 Homo sapiens miR-614 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR615 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0003628 Homo sapiens miR-615 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR616 MI0003629 Homo sapiens miR-616 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548C Extensive cloning studies suggest that the 5' miRNA may be the predominant one [2]. MI0003630 Homo sapiens miR-548c stem-loop A pre-miRNA processed from the primary transcript of human gene MIR617 MI0003631 Homo sapiens miR-617 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR618 MI0003632 Homo sapiens miR-618 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR619 MI0003633 Homo sapiens miR-619 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR620 MI0003634 Homo sapiens miR-620 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR621 MI0003635 Homo sapiens miR-621 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR622 MI0003636 Homo sapiens miR-622 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR623 MI0003637 Homo sapiens miR-623 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR624 MI0003638 Homo sapiens miR-624 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR625 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0003639 Homo sapiens miR-625 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR626 MI0003640 Homo sapiens miR-626 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR627 MI0003641 Homo sapiens miR-627 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR628 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0003642 Homo sapiens miR-628 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR629 MI0003643 Homo sapiens miR-629 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR630 MI0003644 Homo sapiens miR-630 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR631 MI0003645 Homo sapiens miR-631 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR33B The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0003646 Homo sapiens miR-33b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR632 MI0003647 Homo sapiens miR-632 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR633 MI0003648 Homo sapiens miR-633 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR634 MI0003649 Homo sapiens miR-634 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR635 MI0003650 Homo sapiens miR-635 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR636 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0003651 Homo sapiens miR-636 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR637 MI0003652 Homo sapiens miR-637 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR638 MI0003653 Homo sapiens miR-638 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR639 MI0003654 Homo sapiens miR-639 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR640 MI0003655 Homo sapiens miR-640 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR641 MI0003656 Homo sapiens miR-641 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR642A MI0003657 Homo sapiens miR-642a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR643 MI0003658 Homo sapiens miR-643 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR644 MI0003659 Homo sapiens miR-644a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR645 MI0003660 Homo sapiens miR-645 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR646 MI0003661 Homo sapiens miR-646 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR647 MI0003662 Homo sapiens miR-647 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR648 MI0003663 Homo sapiens miR-648 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR649 MI0003664 Homo sapiens miR-649 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR650 MI0003665 Homo sapiens miR-650 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR651 MI0003666 Homo sapiens miR-651 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR652 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 3' end of the miRNA is offset with respect to previous annotations. miR-652 cloned in [2] has a 1 nt 3' extension (U), which is incompatible with the genome sequence. MI0003667 Homo sapiens miR-652 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548D1 MI0003668 Homo sapiens miR-548d-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR661 MI0003669 Homo sapiens miR-661 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR662 MI0003670 Homo sapiens miR-662 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548D2 MI0003671 Homo sapiens miR-548d-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR663 MI0003672 Homo sapiens miR-663a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR449B MI0003673 Homo sapiens miR-449b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR653 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations. MI0003674 Homo sapiens miR-653 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR411 MI0003675 Homo sapiens miR-411 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR654 MI0003676 Homo sapiens miR-654 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR655 MI0003677 Homo sapiens miR-655 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR656 MI0003678 Homo sapiens miR-656 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR549 Cummins et al report two mature isoforms that map to the same precursor locus, referred to as miR-549a (shown here) and miR-549b (two nt longer at the 3' end - GACAACUAUGGAUGAGCUCUCA) [1]. MI0003679 Homo sapiens miR-549 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR657 MI0003681 Homo sapiens miR-657 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR658 MI0003682 Homo sapiens miR-658 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR659 MI0003683 Homo sapiens miR-659 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR660 MI0003684 Homo sapiens miR-660 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR421 MI0003685 Homo sapiens miR-421 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR542 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0003686 Homo sapiens miR-542 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR34C MI0003690 Danio rerio miR-34b stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR31 MI0003691 Danio rerio miR-31 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR135B MI0003692 Danio rerio miR-135a stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR139 MI0003693 Danio rerio miR-139 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR9-3 MI0003694 Gallus gallus miR-9-1 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR146B MI0003695 Gallus gallus miR-146b stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR147B MI0003696 Gallus gallus miR-147 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR193B MI0003698 Gallus gallus miR-193b stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR202 MI0003699 Gallus gallus miR-202 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR302F MI0003700 Gallus gallus miR-302b stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR302F MI0003701 Gallus gallus miR-302c stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR302F MI0003702 Gallus gallus miR-302d stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR365-2 MI0003703 Gallus gallus miR-365-1 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR365-2 MI0003704 Gallus gallus miR-365-2 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR375 MI0003705 Gallus gallus miR-375 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR383 MI0003706 Gallus gallus miR-383 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR455 MI0003707 Gallus gallus miR-455 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR489 MI0003708 Gallus gallus miR-489 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR490 MI0003709 Gallus gallus miR-490 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR499 MI0003710 Gallus gallus miR-499 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR211 MI0003711 Gallus gallus miR-211 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR367 MI0003712 Gallus gallus miR-367 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR429 MI0003714 Gallus gallus miR-429 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR449C MI0003715 Gallus gallus miR-449 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR302F Mouse miR-302b was verified experimentally by Mineno et al using MPSS technology [1]. The MPSS protocol used provides 22nt sequences, but the true extents of the mature miRNA are not reliably obtained. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations. MI0003716 Mus musculus miR-302b stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR302F The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [1]. The 5' end of the miRNA may be offset with respect to previous annotations. MI0003717 Mus musculus miR-302c stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR302F Mouse miR-302d was verified experimentally by Mineno et al using MPSS technology [1]. The MPSS protocol used provides 22nt sequences, but the true extents of the mature miRNA are not reliably obtained. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations. MI0003718 Mus musculus miR-302d stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR378E The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations. MI0003719 Rattus norvegicus miR-378 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR505 MI0003720 Rattus norvegicus miR-505 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR499 MI0003721 Rattus norvegicus miR-499 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene NIL MI0003722 Rattus norvegicus miR-664-1 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene NIL MI0003723 Rattus norvegicus miR-664-2 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR497 MI0003724 Rattus norvegicus miR-497 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR758 MI0003757 Homo sapiens miR-758 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1264 MI0003758 Homo sapiens miR-1264 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR671 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0003760 Homo sapiens miR-671 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR668 MI0003761 Homo sapiens miR-668 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR550A3 MI0003762 Homo sapiens miR-550a-3 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR767 MI0003763 Homo sapiens miR-767 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1224 This sequence was identified as a miRNA candidate by Berezikov et al [1], and confirmed later by more extensive cloning [2]. MI0003764 Homo sapiens miR-1224 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR151B MI0003772 Homo sapiens miR-151b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR320B1 MI0003776 Homo sapiens miR-320b-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR320C1 This sequence was identified as a candidate by RAKE analysis [1], and later confirmed by Solexa sequencing [2]. MI0003778 Homo sapiens miR-320c-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1296 MI0003780 Homo sapiens miR-1296 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1468 This sequence was identified as a miRNA candidate by Berezikov et al [1], and confirmed later by cloning [2]. MI0003782 Homo sapiens miR-1468 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1323 This sequence was identified as a miRNA candidate by Berezikov et al [1], and confirmed later by cloning [2]. Afanasyeva et al. refer to this sequence using the internal identifier MYCNAMP_NB2_61 [2]. MI0003786 Homo sapiens miR-1323 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1271 MI0003814 Homo sapiens miR-1271 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1301 MI0003815 Homo sapiens miR-1301 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR454 The mature miRNA sequences were named miR-454-5p and miR-454-3p in [1] and here. Landgraf et al. showed that the 3' product is the predominant one [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0003820 Homo sapiens miR-454 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1185-2 This sequence was proposed as a miRNA candidate by Berezikov et al by RAKE analysis [1], and validated by cloning independently by Subramanian et al [2]. MI0003821 Homo sapiens miR-1185-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR449C This sequence was identified as a miRNA candidate by Berezikov et al. using the RAKE techniques [1]. Expression was later confirmed by Wyman et al. [2]. MI0003823 Homo sapiens miR-449c stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1283-1 MI0003832 Homo sapiens miR-1283-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR769 MI0003834 Homo sapiens miR-769 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR766 MI0003836 Homo sapiens miR-766 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR320B2 This sequence was identified as a candidate by RAKE analysis [1], and later confirmed by Solexa sequencing [2,3]. The sequence was named mir-1242 in [2]. MI0003839 Homo sapiens miR-320b-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR378D2 MI0003840 Homo sapiens miR-378d-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1185-1 This sequence was proposed as a miRNA candidate by Berezikov et al by RAKE analysis [1], and validated by cloning independently by Subramanian et al [2]. MI0003844 Homo sapiens miR-1185-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR762 Berezikov et al. proposed this sequence as a miRNA candidate based on the RAKE method [1]. Artzi et al. later showed that it is a homolog of a validated miRNA in mouse [2]. MI0003892 Homo sapiens miR-762 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR802 MI0003906 Homo sapiens miR-802 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR670 Berezikov et al. proposed this sequence as a miRNA candidate based on the RAKE method [1]. Artzi et al. later showed that it is a homolog of a validated miRNA in mouse [2]. MI0003933 Homo sapiens miR-670 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1298 MI0003938 Homo sapiens miR-1298 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR2113 This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by qRT-PCR [2]. This sequence is named MID246 in [2]. MI0003939 Homo sapiens miR-2113 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR761 Berezikov et al. proposed this sequence as a miRNA candidate based on the RAKE method [1]. Artzi et al. later showed that it is a homolog of a validated miRNA in mouse [2]. MI0003941 Homo sapiens miR-761 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR764 Berezikov et al. proposed this sequence as a miRNA candidate based on the RAKE method [1]. Artzi et al. later showed that it is a homolog of a validated miRNA in mouse [2]. MI0003944 Homo sapiens miR-764 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR759 Berezikov et al. proposed this sequence as a miRNA candidate based on the RAKE method [1]. Artzi et al. later showed that it is a homolog of a validated miRNA in mouse [2]. MI0004065 Homo sapiens miR-759 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR1224 This sequence was identified as a miRNA candidate by Berezikov et al [1], and confirmed later by more extensive cloning [2]. MI0004118 Mus musculus miR-1224 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR1247 This sequence was identified as a miRNA candidate by Berezikov et al [1], and confirmed later by sequencing [2]. MI0004120 Mus musculus miR-1247 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR301B The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0004122 Mus musculus miR-301b stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR675 MI0004123 Mus musculus miR-675 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR744 mir-744 was also named mir-803 in Takada et al., supplementary information [1]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. MI0004124 Mus musculus miR-744 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR374C MI0004125 Mus musculus miR-374b stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR216B The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations. MI0004126 Mus musculus miR-216b stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR592 MI0004127 Mus musculus miR-592 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR1197 MI0004129 Mus musculus miR-758 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR1264 This sequence was identified as a miRNA candidate by Berezikov et al [1], and confirmed later by sequencing [2]. MI0004130 Mus musculus miR-1264 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR551B The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations. MI0004131 Mus musculus miR-551b stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR1249 This sequence was identified as a miRNA candidate by Berezikov et al [1], and confirmed later in mouse ES cells [2]. MI0004132 Mus musculus miR-1249 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR671 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. MI0004133 Mus musculus miR-671 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR668 MI0004134 Mus musculus miR-668 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR665 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. MI0004171 Mus musculus miR-665 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR770 MI0004203 Mus musculus miR-770 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR762 MI0004215 Mus musculus miR-762 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR802 MI0004249 Mus musculus miR-802 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR670 MI0004295 Mus musculus miR-670 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR1298 This sequence was identified as a miRNA candidate by Berezikov et al [1], and confirmed later by sequencing [2]. MI0004300 Mus musculus miR-1298 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR761 MI0004306 Mus musculus miR-761 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR764 MI0004310 Mus musculus miR-764 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 The sequence of miR-669a-1 is of low complexity. The sequence maps exactly to several genomic positions, and many more with 1 or 2 substitutions. Confidence in this miRNA might therefore be reduced. MI0004523 Mus musculus miR-669a-1 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR759 MI0004554 Mus musculus miR-759 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR323B MI0004589 Mus musculus miR-496 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR760 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations. MI0004605 Mus musculus miR-760 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR488 The predominant miRNA cloned by Langraf et al. has a 3' terminal U residue, which is incompatible with the genome sequence [2]. MI0004633 Mus musculus miR-488 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR497 MI0004636 Mus musculus miR-497 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR423 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0004637 Mus musculus miR-423 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR543 MI0004639 Mus musculus miR-495 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR449C MI0004645 Mus musculus miR-449c stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR146B MI0004665 Mus musculus miR-146b stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 MI0004666 Mus musculus miR-669b stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 MI0004667 Mus musculus miR-669a-2 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 MI0004668 Mus musculus miR-669a-3 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 The sequence of miR-467 is of low complexity. The sequence maps exactly to several genomic positions, and many more with 1 or 2 substitutions. Confidence in this miRNA might therefore be reduced. MI0004671 Mus musculus miR-467b stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 MI0004673 Mus musculus miR-669c stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR297 MI0004674 Mus musculus miR-297b stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR499 MI0004676 Mus musculus miR-499 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR455 MI0004679 Mus musculus miR-455 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR491 MI0004680 Mus musculus miR-491 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR708 MI0004692 Mus musculus miR-708 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR711 MI0004695 Mus musculus miR-711 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR500B Mouse miR-500 was identified independently by two groups. Wheeler et al cloned a mature product with the same length as the human ortholog (MIR:MI0003184) [1]. Mineno et al report a shorter mature product with 1 additional base at the 5' end and 3 fewer at the 3' end (AAUGCACCUGGGCAAGGGUU), referred to as miR-500b in [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The 5' end of the miRNA may be offset with respect to previous annotations. MI0004702 Mus musculus miR-500 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR500B MI0004703 Mus musculus miR-501 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR450B MI0004705 Mus musculus miR-450b stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR505 MI0004706 Mus musculus miR-505 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR718 MI0004707 Mus musculus miR-718 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR190B MI0004764 Danio rerio miR-190b stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR499 MI0004766 Danio rerio miR-499 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR34C MI0004774 Danio rerio miR-34c stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR195 MI0004779 Danio rerio miR-15c stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR208B MI0004782 Danio rerio miR-736 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR652 The predominant miRNA cloned by Langraf et al. has a 3' terminal U residue, which is incompatible with the genome sequence [2]. MI0004965 Mus musculus miR-652 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR21 MI0004994 Gallus gallus miR-21 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR451B MI0004995 Gallus gallus miR-451 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR144 MI0004996 Gallus gallus miR-144 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR490 MI0005002 Mus musculus miR-490 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR676 MI0005003 Mus musculus miR-676 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR615 MI0005004 Mus musculus miR-615 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR765 MI0005116 Homo sapiens miR-765 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR770 MI0005118 Homo sapiens miR-770 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene NIL The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations. MI0005207 Mus musculus miR-743a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR675 MI0005416 Homo sapiens miR-675 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR181D The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. MI0005450 Mus musculus miR-181d stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene NIL MI0005470 Mus musculus miR-743b stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene NIL MI0005471 Mus musculus miR-871 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR190B MI0005478 Mus musculus miR-190b stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR874 MI0005479 Mus musculus miR-874 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR876 MI0005480 Mus musculus miR-876 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR105-2 MI0005481 Mus musculus miR-105 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR147B MI0005482 Mus musculus miR-147 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR20B MI0005483 Mus musculus miR-18b stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR193B MI0005484 Mus musculus miR-193b stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR297 MI0005488 Mus musculus miR-297a-3 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR297 MI0005489 Mus musculus miR-297a-4 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR297 MI0005492 Mus musculus miR-297c stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR1264 MI0005496 Mus musculus miR-421 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 Landgraf et al. identify several offset sequences which map to the 3' arm of the miR-466f hairpin precursors [1]. One sequence consistent with all three putative hairpin loci is shown here. MI0005507 Mus musculus miR-466f-1 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 Landgraf et al. identify several offset sequences which map to the 3' arm of the miR-466f hairpin precursors [1]. One sequence consistent with all three putative hairpin loci is shown here. MI0005508 Mus musculus miR-466f-2 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 Landgraf et al. identify several offset sequences which map to the 3' arm of the miR-466f hairpin precursors [1]. One sequence consistent with all three putative hairpin loci is shown here. MI0005509 Mus musculus miR-466f-3 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 MI0005510 Mus musculus miR-466g stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 MI0005511 Mus musculus miR-466h stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 MI0005512 Mus musculus miR-467c stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 MI0005513 Mus musculus miR-467d stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR493 MI0005514 Mus musculus miR-493 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR504 MI0005515 Mus musculus miR-504 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR514B MI0005516 Mus musculus miR-509 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR568 MI0005517 Mus musculus miR-568 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR574 MI0005518 Mus musculus miR-574 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR590 MI0005519 Mus musculus miR-590 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR654 MI0005520 Mus musculus miR-654 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR92B MI0005521 Mus musculus miR-92b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR298 MI0005523 Homo sapiens miR-298 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR891A MI0005524 Homo sapiens miR-891a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR300 MI0005525 Homo sapiens miR-300 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR892A MI0005528 Homo sapiens miR-892a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR509-2 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The cloned miR-509-5p sequence from [3] includes a 1 nt extension at the 3' end (A), which is incompatible with the genome sequence. MI0005530 Homo sapiens miR-509-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR450B MI0005531 Homo sapiens miR-450b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR874 MI0005532 Homo sapiens miR-874 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR890 MI0005533 Homo sapiens miR-890 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR891B MI0005534 Homo sapiens miR-891b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR888 MI0005537 Homo sapiens miR-888 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR892B MI0005538 Homo sapiens miR-892b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR541 MI0005539 Homo sapiens miR-541 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR889 MI0005540 Homo sapiens miR-889 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR875 MI0005541 Homo sapiens miR-875 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR876 MI0005542 Homo sapiens miR-876 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR708 MI0005543 Homo sapiens miR-708 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR147B MI0005544 Homo sapiens miR-147b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR190B MI0005545 Homo sapiens miR-190b stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 miR-466d-3p reported in [1] has an additional 3' U base which is inconsistent with the current genome sequence (as shown here). MI0005546 Mus musculus miR-466d stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR449C MI0005547 Mus musculus miR-449b stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR873 This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2]. MI0005550 Mus musculus miR-873 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR875 This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was independently shown in human and rat [2]. MI0005551 Mus musculus miR-875 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR208B This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2]. MI0005552 Mus musculus miR-208b stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR877 This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2]. MI0005553 Mus musculus miR-877 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR514B This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was independently shown in human and rat [2]. MI0005554 Mus musculus miR-511 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR544B This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was independently shown in human and rat [2]. MI0005555 Mus musculus miR-544 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR598 This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was independently shown in human and rat [2]. MI0005556 Mus musculus miR-598 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR653 This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was independently shown in human and rat [2]. MI0005557 Mus musculus miR-653 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR744 This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2]. MI0005559 Homo sapiens miR-744 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR885 This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2]. MI0005560 Homo sapiens miR-885 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR877 This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2]. MI0005561 Homo sapiens miR-877 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR887 This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2]. MI0005562 Homo sapiens miR-887 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR665 This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2]. MI0005563 Homo sapiens miR-665 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR873 This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2]. MI0005564 Homo sapiens miR-873 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR543 This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression has been independently confirmed in mouse and rat [2]. MI0005565 Homo sapiens miR-543 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR374B This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2]. MI0005566 Homo sapiens miR-374b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR760 This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2]. MI0005567 Homo sapiens miR-760 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR301B This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2]. MI0005568 Homo sapiens miR-301b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR216B This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2]. MI0005569 Homo sapiens miR-216b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR208B This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2]. MI0005570 Homo sapiens miR-208b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR920 MI0005712 Homo sapiens miR-920 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR921 MI0005713 Homo sapiens miR-921 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR922 MI0005714 Homo sapiens miR-922 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR924 MI0005716 Homo sapiens miR-924 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR509-3 MI0005717 Homo sapiens miR-509-3 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR933 MI0005755 Homo sapiens miR-933 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR934 MI0005756 Homo sapiens miR-934 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR935 MI0005757 Homo sapiens miR-935 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR936 MI0005758 Homo sapiens miR-936 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR937 MI0005759 Homo sapiens miR-937 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR938 MI0005760 Homo sapiens miR-938 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR939 MI0005761 Homo sapiens miR-939 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR940 MI0005762 Homo sapiens miR-940 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR941-1 MI0005763 Homo sapiens miR-941-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR941-2 MI0005764 Homo sapiens miR-941-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR941-3 MI0005765 Homo sapiens miR-941-3 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR941-4 MI0005766 Homo sapiens miR-941-4 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR942 MI0005767 Homo sapiens miR-942 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR943 MI0005768 Homo sapiens miR-943 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR944 MI0005769 Homo sapiens miR-944 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR297 The extents of the mature sequence are not absolutely determined in [1], but are predicted from mouse miR-297. MI0005775 Homo sapiens miR-297 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR466 MI0006112 Rattus norvegicus miR-466b-1 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR466 MI0006113 Rattus norvegicus miR-466b-2 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR466 MI0006114 Rattus norvegicus miR-466c stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene NIL MI0006115 Rattus norvegicus miR-743b stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene NIL MI0006116 Rattus norvegicus miR-871 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR874 MI0006118 Rattus norvegicus miR-874 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR877 MI0006119 Rattus norvegicus miR-877 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR582 MI0006127 Mus musculus miR-582 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 MI0006128 Mus musculus miR-467e stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR147B MI0006130 Rattus norvegicus miR-147 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR20B MI0006131 Rattus norvegicus miR-17-2 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR181D MI0006132 Rattus norvegicus miR-181d stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR182 MI0006133 Rattus norvegicus miR-182 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR660 MI0006134 Rattus norvegicus miR-188 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR190B MI0006135 Rattus norvegicus miR-190b stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR196B MI0006136 Rattus norvegicus miR-196c stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR301B MI0006137 Rattus norvegicus miR-301b stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR375 MI0006140 Rattus norvegicus miR-375 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR1197 MI0006141 Rattus norvegicus miR-380 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR384 MI0006142 Rattus norvegicus miR-384 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR323B MI0006143 Rattus norvegicus miR-410 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR1197 MI0006144 Rattus norvegicus miR-411 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR423 MI0006145 Rattus norvegicus miR-423 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR425 MI0006146 Rattus norvegicus miR-425 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR455 MI0006148 Rattus norvegicus miR-455 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR484 MI0006151 Rattus norvegicus miR-484 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR543 MI0006152 Rattus norvegicus miR-495 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR500B MI0006153 Rattus norvegicus miR-500 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR660 MI0006154 Rattus norvegicus miR-532 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR598 MI0006155 Rattus norvegicus miR-598-1 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR671 MI0006156 Rattus norvegicus miR-671 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR708 MI0006160 Rattus norvegicus miR-708 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene NIL MI0006162 Rattus norvegicus miR-743a stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR1197 MI0006163 Rattus norvegicus miR-758 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR760 MI0006164 Rattus norvegicus miR-760 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR770 MI0006165 Rattus norvegicus miR-770 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR873 MI0006166 Rattus norvegicus miR-873 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR92B MI0006167 Rattus norvegicus miR-92b stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR488 The predominant miRNA cloned by Landgraf et al. has a 3' additional U residue, which is incompatible with the genome sequence [1]. MI0006168 Rattus norvegicus miR-488 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR652 The predominant miRNA cloned by Landgraf et al. has a 3' additional U residue, which is incompatible with the genome sequence [1]. MI0006169 Rattus norvegicus miR-652 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1178 MI0006271 Homo sapiens miR-1178 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1179 MI0006272 Homo sapiens miR-1179 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1180 MI0006273 Homo sapiens miR-1180 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1181 MI0006274 Homo sapiens miR-1181 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1182 MI0006275 Homo sapiens miR-1182 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1183 MI0006276 Homo sapiens miR-1183 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1184-1 MI0006277 Homo sapiens miR-1184-1 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 MI0006278 Mus musculus miR-466l stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 MI0006279 Mus musculus miR-669k stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 MI0006280 Mus musculus miR-669g stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 MI0006281 Mus musculus miR-669d stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 MI0006282 Mus musculus miR-466i stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR1-1 Calabrese et al. report the detection of mature products from the antisense strand of mouse mir-1-2, at lower abundance than sense miR-1 [1]. MI0006283 Mus musculus miR-1b stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 MI0006286 Mus musculus miR-669j stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 MI0006287 Mus musculus miR-669f stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 MI0006288 Mus musculus miR-669i stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 MI0006289 Mus musculus miR-669h stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 MI0006293 Mus musculus miR-467f stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 MI0006295 Mus musculus miR-466j stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR1193 MI0006298 Mus musculus miR-1193 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 MI0006300 Mus musculus miR-669e stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 MI0006301 Mus musculus miR-467g stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 MI0006302 Mus musculus miR-467h stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR1197 MI0006305 Mus musculus miR-1197 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene NIL MI0006307 Mus musculus miR-1199 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1225 MI0006311 Homo sapiens miR-1225 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1226 MI0006313 Homo sapiens miR-1226 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1227 MI0006316 Homo sapiens miR-1227 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1228 MI0006318 Homo sapiens miR-1228 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1229 MI0006319 Homo sapiens miR-1229 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1231 MI0006321 Homo sapiens miR-1231 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1233-1 MI0006323 Homo sapiens miR-1233-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1234 MI0006324 Homo sapiens miR-1234 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1236 MI0006326 Homo sapiens miR-1236 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1237 MI0006327 Homo sapiens miR-1237 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1238 MI0006328 Homo sapiens miR-1238 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1200 MI0006332 Homo sapiens miR-1200 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1202 MI0006334 Homo sapiens miR-1202 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1203 MI0006335 Homo sapiens miR-1203 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR663B MI0006336 Homo sapiens miR-663b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1204 MI0006337 Homo sapiens miR-1204 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1205 MI0006338 Homo sapiens miR-1205 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1206 MI0006339 Homo sapiens miR-1206 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1207 MI0006340 Homo sapiens miR-1207 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1208 MI0006341 Homo sapiens miR-1208 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR146B MI0006342 Rattus norvegicus miR-146b stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR551B MI0006343 Rattus norvegicus miR-551b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548E MI0006344 Homo sapiens miR-548e stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548J MI0006345 Homo sapiens miR-548j stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1285-1 MI0006346 Homo sapiens miR-1285-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1285-2 MI0006347 Homo sapiens miR-1285-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1286 MI0006348 Homo sapiens miR-1286 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1287 MI0006349 Homo sapiens miR-1287 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1289-1 MI0006350 Homo sapiens miR-1289-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1289-2 MI0006351 Homo sapiens miR-1289-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1290 MI0006352 Homo sapiens miR-1290 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1291 MI0006353 Homo sapiens miR-1291 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548K MI0006354 Homo sapiens miR-548k stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1293 MI0006355 Homo sapiens miR-1293 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1294 MI0006356 Homo sapiens miR-1294 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1295 MI0006357 Homo sapiens miR-1295a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1297 MI0006358 Homo sapiens miR-1297 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1299 MI0006359 Homo sapiens miR-1299 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548L MI0006361 Homo sapiens miR-548l stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1302-1 MI0006362 Homo sapiens miR-1302-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1302-2 MI0006363 Homo sapiens miR-1302-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1302-3 MI0006364 Homo sapiens miR-1302-3 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1302-4 MI0006365 Homo sapiens miR-1302-4 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1302-5 MI0006366 Homo sapiens miR-1302-5 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1302-6 MI0006367 Homo sapiens miR-1302-6 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1302-7 MI0006368 Homo sapiens miR-1302-7 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1302-8 MI0006369 Homo sapiens miR-1302-8 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1303 MI0006370 Homo sapiens miR-1303 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1304 MI0006371 Homo sapiens miR-1304 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1305 MI0006372 Homo sapiens miR-1305 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1243 MI0006373 Homo sapiens miR-1243 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548F1 MI0006374 Homo sapiens miR-548f-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548F2 MI0006375 Homo sapiens miR-548f-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548F3 MI0006376 Homo sapiens miR-548f-3 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548F4 MI0006377 Homo sapiens miR-548f-4 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548F5 MI0006378 Homo sapiens miR-548f-5 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1244-1 MI0006379 Homo sapiens miR-1244-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1245 MI0006380 Homo sapiens miR-1245a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1246 MI0006381 Homo sapiens miR-1246 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1247 MI0006382 Homo sapiens miR-1247 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1248 MI0006383 Homo sapiens miR-1248 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1249 MI0006384 Homo sapiens miR-1249 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1250 MI0006385 Homo sapiens miR-1250 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1251 MI0006386 Homo sapiens miR-1251 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1253 MI0006387 Homo sapiens miR-1253 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1254 MI0006388 Homo sapiens miR-1254-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1255A MI0006389 Homo sapiens miR-1255a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1256 MI0006390 Homo sapiens miR-1256 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1257 MI0006391 Homo sapiens miR-1257 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1258 MI0006392 Homo sapiens miR-1258 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1260 MI0006394 Homo sapiens miR-1260a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548G MI0006395 Homo sapiens miR-548g stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1261 MI0006396 Homo sapiens miR-1261 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1262 MI0006397 Homo sapiens miR-1262 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1263 MI0006398 Homo sapiens miR-1263 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548N MI0006399 Homo sapiens miR-548n stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548M MI0006400 Homo sapiens miR-548m stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1265 MI0006401 Homo sapiens miR-1265 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548O MI0006402 Homo sapiens miR-548o stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1266 MI0006403 Homo sapiens miR-1266 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1267 MI0006404 Homo sapiens miR-1267 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1268 MI0006405 Homo sapiens miR-1268a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1269 MI0006406 Homo sapiens miR-1269a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1270-1 MI0006407 Homo sapiens miR-1270 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1272 MI0006408 Homo sapiens miR-1272 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1273 MI0006409 Homo sapiens miR-1273a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548H1 MI0006411 Homo sapiens miR-548h-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548H2 MI0006412 Homo sapiens miR-548h-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548H3 MI0006413 Homo sapiens miR-548h-3 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548H4 MI0006414 Homo sapiens miR-548h-4 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1275 MI0006415 Homo sapiens miR-1275 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1276 MI0006416 Homo sapiens miR-1276 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR302E MI0006417 Homo sapiens miR-302e stem-loop A pre-miRNA processed from the primary transcript of human gene MIR302F MI0006418 Homo sapiens miR-302f stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1277 MI0006419 Homo sapiens miR-1277 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548P MI0006420 Homo sapiens miR-548p stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548I1 MI0006421 Homo sapiens miR-548i-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548I2 MI0006422 Homo sapiens miR-548i-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548I3 MI0006423 Homo sapiens miR-548i-3 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548I4 MI0006424 Homo sapiens miR-548i-4 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1278 MI0006425 Homo sapiens miR-1278 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1279 MI0006426 Homo sapiens miR-1279 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1281 MI0006428 Homo sapiens miR-1281 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1282 MI0006429 Homo sapiens miR-1282 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1283-2 MI0006430 Homo sapiens miR-1283-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1284 MI0006431 Homo sapiens miR-1284 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1288 MI0006432 Homo sapiens miR-1288 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1292 MI0006433 Homo sapiens miR-1292 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1252 MI0006434 Homo sapiens miR-1252 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1255B1 MI0006435 Homo sapiens miR-1255b-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1255B2 MI0006436 Homo sapiens miR-1255b-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR664 This miRNA sequence overlaps an annotated snoRNA, ACA38b. However, both miR and miR* sequences are identified in reference [1], and the sequence is homologous with rat mir-664. MI0006442 Homo sapiens miR-664 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1306 MI0006443 Homo sapiens miR-1306 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1307 MI0006444 Homo sapiens miR-1307 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR513B MI0006648 Homo sapiens miR-513b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR513C MI0006649 Homo sapiens miR-513c stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1321 Afanasyeva et al. refer to this sequence using the internal identifier MYCNAMP_NB2_241 [1]. Some additional sequences reported in [1] do not meet miRBase requirements for miRNA identification. MI0006652 Homo sapiens miR-1321 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1322 Afanasyeva et al. refer to this sequence using the internal identifier MYCNSC_NB2_237 [1]. Some additional sequences reported in [1] do not meet miRBase requirements for miRNA identification. MI0006653 Homo sapiens miR-1322 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1197 Afanasyeva et al. refer to this sequence using the internal identifier MYCNSC_NB5_330 [1]. Some additional sequences reported in [1] do not meet miRBase requirements for miRNA identification. MI0006656 Homo sapiens miR-1197 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1324 Afanasyeva et al. refer to this sequence using the internal identifier MYCNSC_NB8_202 [1]. Some additional sequences reported in [1] do not meet miRBase requirements for miRNA identification. MI0006657 Homo sapiens miR-1324 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR22 MI0006982 Gallus gallus miR-22 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR551B MI0006983 Gallus gallus miR-551 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR454 MI0006984 Gallus gallus miR-454 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR1306 MI0007057 Gallus gallus miR-1306 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR216B MI0007066 Gallus gallus miR-216c stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1469 MI0007074 Homo sapiens miR-1469 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1470 MI0007075 Homo sapiens miR-1470 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1471 MI0007076 Homo sapiens miR-1471 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1537 MI0007258 Homo sapiens miR-1537 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1538 MI0007259 Homo sapiens miR-1538 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1539 MI0007260 Homo sapiens miR-1539 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR103-1AS MI0007261 Homo sapiens miR-103b-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR103-2AS MI0007262 Homo sapiens miR-103b-2 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR101-2 MI0007558 Gallus gallus miR-101-2 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR99B MI0007559 Gallus gallus miR-10a stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR301B MI0007560 Gallus gallus miR-130c stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR146B MI0007561 Gallus gallus miR-146c stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR195 MI0007562 Gallus gallus miR-15c stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR195 MI0007563 Gallus gallus miR-16c stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR193B This sequence does not map exactly to the galGal4.0 chicken genome assembly, but is annotated based on a Trace Achive sequence (J_AD0537A21_t807e807.b2). MI0007564 Gallus gallus miR-193a stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR301B MI0007565 Gallus gallus miR-301b stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR449C MI0007566 Gallus gallus miR-449b stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR216B MI0007987 Canis familiaris miR-216b stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR33B MI0007988 Canis familiaris miR-33 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIRLET7I MI0007989 Canis familiaris let-7a-1 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR26A2 MI0007990 Canis familiaris miR-26a-2 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR32 MI0007992 Canis familiaris miR-32 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR211 MI0007993 Canis familiaris miR-204 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR31 MI0007994 Canis familiaris miR-31 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR101-2 MI0007995 Canis familiaris miR-101-2 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR371B This sequence appears to be antisense to the annotated members of the mir-371 family in oter mammals. The orientation of the dog sequence here is supported by 66 miR reads and 2 miR* reads [1]. MI0007996 Canis familiaris miR-371 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR491 MI0007997 Canis familiaris miR-491 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR150 MI0007998 Canis familiaris miR-150 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR455 MI0007999 Canis familiaris miR-455 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR30E MI0008000 Canis familiaris miR-30a stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR30E MI0008001 Canis familiaris miR-30c-2 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR1-1 MI0008002 Canis familiaris miR-206 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR99B MI0008003 Canis familiaris miR-99b stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIRLET7I MI0008004 Canis familiaris let-7e stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR99B MI0008005 Canis familiaris miR-125a stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIRLET7I MI0008006 Canis familiaris let-7f stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene NIL MI0008007 Canis familiaris miR-219-1 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR23B MI0008008 Canis familiaris miR-23b stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR27B MI0008009 Canis familiaris miR-27b stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR24-2 MI0008010 Canis familiaris miR-24-1 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR151B MI0008011 Canis familiaris miR-151 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR30E MI0008012 Canis familiaris miR-30d stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR30E MI0008013 Canis familiaris miR-30b stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR3591 MI0008015 Canis familiaris miR-122 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR196B MI0008016 Canis familiaris miR-196b stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR183 MI0008017 Canis familiaris miR-183 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR148B MI0008018 Canis familiaris miR-148a stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR129-2 MI0008019 Canis familiaris miR-129-1 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR335 MI0008020 Canis familiaris miR-335 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR29C MI0008021 Canis familiaris miR-29b-1 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR29C MI0008022 Canis familiaris miR-29a stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR30E MI0008023 Canis familiaris miR-30e stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR30E MI0008024 Canis familiaris miR-30c-1 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR135B MI0008025 Canis familiaris miR-135a-2 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR383 MI0008026 Canis familiaris miR-383 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene NIL MI0008027 Canis familiaris miR-486 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR301B MI0008029 Canis familiaris miR-130a stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR129-2 MI0008030 Canis familiaris miR-129-2 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR215 MI0008031 Canis familiaris miR-192 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR128-2 MI0008032 Canis familiaris miR-128-1 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR7-3 MI0008033 Canis familiaris miR-7-1 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR181D MI0008034 Canis familiaris miR-181c stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR181D MI0008035 Canis familiaris miR-181d stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIRLET7I MI0008036 Canis familiaris let-7g stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR191 MI0008037 Canis familiaris miR-191 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR425 MI0008038 Canis familiaris miR-425 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR23B MI0008039 Canis familiaris miR-23a stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR27B MI0008040 Canis familiaris miR-27a stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR24-2 MI0008041 Canis familiaris miR-24-2 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR199B MI0008042 Canis familiaris miR-199-1 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR708 MI0008043 Canis familiaris miR-708 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR139 MI0008045 Canis familiaris miR-139 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR138-1 MI0008047 Canis familiaris miR-138b stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR195 MI0008048 Canis familiaris miR-15a stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR195 MI0008049 Canis familiaris miR-16-1 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR20B MI0008050 Canis familiaris miR-17 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR19B2 MI0008051 Canis familiaris miR-19a stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR20B MI0008052 Canis familiaris miR-20a stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR19B2 MI0008054 Canis familiaris miR-19b-1 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR92B MI0008055 Canis familiaris miR-92a-1 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR138-1 MI0008056 Canis familiaris miR-138a stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR128-2 MI0008057 Canis familiaris miR-128-2 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR26A2 MI0008058 Canis familiaris miR-26a-1 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR499 MI0008059 Canis familiaris miR-499 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR1-1 MI0008060 Canis familiaris miR-1-1 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR124-3 MI0008061 Canis familiaris miR-124-3 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR124-3 MI0008062 Canis familiaris miR-124-1 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR320E MI0008063 Canis familiaris miR-320 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR301B MI0008064 Canis familiaris miR-130b stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR185 MI0008065 Canis familiaris miR-185 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR1306 MI0008066 Canis familiaris miR-1306 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR196B MI0008068 Canis familiaris miR-196a-2 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR148B MI0008069 Canis familiaris miR-148b stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR429 MI0008070 Canis familiaris miR-200c stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR1307 MI0008071 Canis familiaris miR-1307 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR103-2AS MI0008072 Canis familiaris miR-107 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR146B MI0008073 Canis familiaris miR-146b stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR124-3 MI0008074 Canis familiaris miR-124-2 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR99B MI0008075 Canis familiaris miR-99a-1 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIRLET7I MI0008076 Canis familiaris let-7c stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR99B MI0008077 Canis familiaris miR-125b-2 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR155 MI0008078 Canis familiaris miR-155 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR218-2 MI0008079 Canis familiaris miR-218-1 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR574 MI0008080 Canis familiaris miR-574 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR9-3 MI0008081 Canis familiaris miR-9-2 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR151B MI0008082 Canis familiaris miR-28 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR195 MI0008083 Canis familiaris miR-15b stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR195 MI0008084 Canis familiaris miR-16-2 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR7-3 MI0008085 Canis familiaris miR-7-2 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR9-3 MI0008086 Canis familiaris miR-9-3 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR26A2 MI0008088 Canis familiaris miR-26b stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene NIL MI0008090 Canis familiaris miR-664 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR194-2 MI0008091 Canis familiaris miR-194 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR143 MI0008092 Canis familiaris miR-143 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR378E MI0008093 Canis familiaris miR-378 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR146B MI0008094 Canis familiaris miR-146a stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR1271 MI0008095 Canis familiaris miR-1271 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR218-2 MI0008097 Canis familiaris miR-218-2 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR103-2AS MI0008098 Canis familiaris miR-103-1 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR328 MI0008099 Canis familiaris miR-328 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR140 MI0008100 Canis familiaris miR-140 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR34C MI0008101 Canis familiaris miR-34a stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR99B MI0008102 Canis familiaris miR-99a-2 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR99B MI0008103 Canis familiaris miR-125b-1 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR497 MI0008104 Canis familiaris miR-497 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR195 MI0008105 Canis familiaris miR-195 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR34C MI0008106 Canis familiaris miR-34c stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR101-2 MI0008107 Canis familiaris miR-101-1 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR186 MI0008108 Canis familiaris miR-186 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR20B MI0008109 Canis familiaris miR-106b stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR20B MI0008110 Canis familiaris miR-93 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR92B MI0008111 Canis familiaris miR-25 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR197 MI0008112 Canis familiaris miR-197 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR193B MI0008113 Canis familiaris miR-193b stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR590 MI0008114 Canis familiaris miR-590 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR339 MI0008115 Canis familiaris miR-339 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR137 MI0008117 Canis familiaris miR-137 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR1-1 MI0008118 Canis familiaris miR-1-2 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR92B MI0008119 Canis familiaris miR-92b stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR29C MI0008121 Canis familiaris miR-29b-2 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR29C MI0008122 Canis familiaris miR-29c-1 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR199B MI0008124 Canis familiaris miR-199-2 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR9-3 MI0008125 Canis familiaris miR-9-1 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR181D MI0008126 Canis familiaris miR-181a-1 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR181D MI0008127 Canis familiaris miR-181b-1 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR342 MI0008128 Canis familiaris miR-342 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR345 MI0008129 Canis familiaris miR-345 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR493 MI0008130 Canis familiaris miR-493 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR433 MI0008131 Canis familiaris miR-433 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR127 MI0008132 Canis familiaris miR-127 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR136 MI0008133 Canis familiaris miR-136 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR1197 MI0008134 Canis familiaris miR-379 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR1197 MI0008135 Canis familiaris miR-411 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR1197 MI0008136 Canis familiaris miR-380 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR323B MI0008137 Canis familiaris miR-323 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR543 MI0008138 Canis familiaris miR-329a stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR543 MI0008139 Canis familiaris miR-543 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR543 MI0008140 Canis familiaris miR-495 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR376A2 MI0008141 Canis familiaris miR-376a-3 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR376A2 MI0008142 Canis familiaris miR-376a-2 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR376A2 MI0008143 Canis familiaris miR-376a-1 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR323B MI0008144 Canis familiaris miR-487b stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR323B MI0008145 Canis familiaris miR-382 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR485 MI0008146 Canis familiaris miR-485 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR323B MI0008147 Canis familiaris miR-409 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR323B MI0008148 Canis familiaris miR-369 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR323B MI0008149 Canis familiaris miR-410 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene NIL MI0008150 Canis familiaris miR-219-2 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR199B MI0008151 Canis familiaris miR-199-3 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR181D MI0008152 Canis familiaris miR-181a-2 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR181D MI0008153 Canis familiaris miR-181b-2 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR126 MI0008154 Canis familiaris miR-126 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR132 MI0008155 Canis familiaris miR-212 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR132 MI0008156 Canis familiaris miR-132 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR22 MI0008157 Canis familiaris miR-22 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR144 MI0008158 Canis familiaris miR-144 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR193B MI0008159 Canis familiaris miR-193a stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR142 MI0008160 Canis familiaris miR-142 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR99B MI0008161 Canis familiaris miR-10 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR148B MI0008162 Canis familiaris miR-152 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR338 MI0008163 Canis familiaris miR-338 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR21 MI0008165 Canis familiaris miR-21 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR423 MI0008166 Canis familiaris miR-423a stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR652 MI0008167 Canis familiaris miR-652 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR224 MI0008168 Canis familiaris miR-224 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR424 MI0008169 Canis familiaris miR-424 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR503 MI0008170 Canis familiaris miR-503 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR542 MI0008171 Canis familiaris miR-542 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR450B MI0008172 Canis familiaris miR-450b stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR20B MI0008173 Canis familiaris miR-106a stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR19B2 MI0008174 Canis familiaris miR-19b-2 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR92B MI0008175 Canis familiaris miR-92a-2 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR363 MI0008176 Canis familiaris miR-363 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR361 MI0008177 Canis familiaris miR-361 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR384 MI0008178 Canis familiaris miR-384 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR374C MI0008179 Canis familiaris miR-374a stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR374C MI0008180 Canis familiaris miR-374b stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR1264 MI0008181 Canis familiaris miR-421 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIRLET7I MI0008182 Canis familiaris miR-98 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR222 MI0008183 Canis familiaris miR-221 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR660 MI0008184 Canis familiaris miR-532 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR500B MI0008185 Canis familiaris miR-500 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR660 MI0008186 Canis familiaris miR-660 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR500B MI0008187 Canis familiaris miR-502 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR676 MI0008188 Canis familiaris miR-676 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR320D1 MI0008190 Homo sapiens miR-320d-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR320C2 MI0008191 Homo sapiens miR-320c-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR320D2 MI0008192 Homo sapiens miR-320d-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1825 MI0008193 Homo sapiens miR-1825 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1827 MI0008195 Homo sapiens miR-1827 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR216B MI0008205 Gallus gallus miR-216b stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR3120 MI0008208 Gallus gallus miR-214 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR762 MI0008209 Gallus gallus miR-762 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR124-3 MI0008210 Gallus gallus miR-124a-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1908 MI0008329 Homo sapiens miR-1908 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1909 MI0008330 Homo sapiens miR-1909 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1910 MI0008331 Homo sapiens miR-1910 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1911 MI0008332 Homo sapiens miR-1911 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1912 MI0008333 Homo sapiens miR-1912 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1913 MI0008334 Homo sapiens miR-1913 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1914 MI0008335 Homo sapiens miR-1914 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1915 MI0008336 Homo sapiens miR-1915 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR1306 MI0009935 Mus musculus miR-1306 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 MI0009942 Mus musculus miR-669l stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 MI0009943 Mus musculus miR-669m-1 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 MI0009944 Mus musculus miR-669m-2 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 MI0009945 Mus musculus miR-669o stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1972-1 MI0009982 Homo sapiens miR-1972-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1973 MI0009983 Homo sapiens miR-1973 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1976 MI0009986 Homo sapiens miR-1976 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR20B MI0010322 Canis familiaris miR-20b stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR20B MI0010323 Canis familiaris miR-18b stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR20B MI0010324 Canis familiaris miR-18a stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR133B MI0010325 Canis familiaris miR-133c stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR133B MI0010326 Canis familiaris miR-133a stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR133B MI0010327 Canis familiaris miR-133b stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIRLET7I MI0010328 Canis familiaris let-7a-2 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIRLET7I MI0010329 Canis familiaris let-7b stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR7-3 MI0010330 Canis familiaris miR-7-3 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR99B MI0010331 Canis familiaris miR-10b stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR34C MI0010332 Canis familiaris miR-34b stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR135B MI0010333 Canis familiaris miR-135a-1 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR135B MI0010334 Canis familiaris miR-135b stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR153-2 MI0010335 Canis familiaris miR-153 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR182 MI0010336 Canis familiaris miR-182 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR184 MI0010337 Canis familiaris miR-184 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR187 MI0010338 Canis familiaris miR-187 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR202 MI0010339 Canis familiaris miR-202 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR205 MI0010340 Canis familiaris miR-205 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR210 MI0010341 Canis familiaris miR-210 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR3120 MI0010342 Canis familiaris miR-214 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR215 MI0010343 Canis familiaris miR-215 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR216B MI0010344 Canis familiaris miR-216a stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR217 MI0010345 Canis familiaris miR-217 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR222 MI0010346 Canis familiaris miR-222 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR223 MI0010347 Canis familiaris miR-223 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR301B MI0010348 Canis familiaris miR-301a stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR301B MI0010349 Canis familiaris miR-301b stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR302F MI0010350 Canis familiaris miR-302a stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR302F MI0010351 Canis familiaris miR-302b stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR302F MI0010352 Canis familiaris miR-302c stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR302F MI0010353 Canis familiaris miR-302d stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR367 MI0010354 Canis familiaris miR-367 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR489 MI0010355 Canis familiaris miR-489 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR96 MI0010356 Canis familiaris miR-96 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR103-2AS MI0010357 Canis familiaris miR-103-2 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR33B MI0010358 Canis familiaris miR-33b stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR145 MI0010359 Canis familiaris miR-145 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR196B MI0010360 Canis familiaris miR-196a-1 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR429 MI0010361 Canis familiaris miR-200b stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR429 MI0010362 Canis familiaris miR-200a stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR3545 MI0010363 Canis familiaris miR-203 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR208B MI0010365 Canis familiaris miR-208a stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR208B MI0010366 Canis familiaris miR-208b stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR451B MI0010367 Canis familiaris miR-451 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR375 MI0010368 Canis familiaris miR-375 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR190B MI0010369 Canis familiaris miR-190a stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR190B MI0010370 Canis familiaris miR-190b stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR147B MI0010371 Canis familiaris miR-147 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR490 MI0010372 Canis familiaris miR-490 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR211 MI0010373 Canis familiaris miR-211 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR429 MI0010374 Canis familiaris miR-141 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR514B MI0010375 Canis familiaris miR-514 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR1264 MI0010376 Canis familiaris miR-95 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR105-2 MI0010377 Canis familiaris miR-105a stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR105-2 MI0010378 Canis familiaris miR-105b stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR660 MI0010379 Canis familiaris miR-188 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR134 MI0010382 Canis familiaris miR-134 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR149 MI0010383 Canis familiaris miR-149 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR299 MI0010384 Canis familiaris miR-299 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR362 MI0010385 Canis familiaris miR-362 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR376A2 MI0010386 Canis familiaris miR-376b stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR376A2 MI0010387 Canis familiaris miR-376c stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR370 MI0010388 Canis familiaris miR-370 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR323B MI0010389 Canis familiaris miR-377 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR323B MI0010390 Canis familiaris miR-381 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR340 MI0010391 Canis familiaris miR-340 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR330 MI0010392 Canis familiaris miR-330 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR326 MI0010393 Canis familiaris miR-326 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR331 MI0010394 Canis familiaris miR-331 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR324 MI0010395 Canis familiaris miR-324 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR325 MI0010396 Canis familiaris miR-325 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR346 MI0010397 Canis familiaris miR-346 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR543 MI0010398 Canis familiaris miR-329b stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR452 MI0010399 Canis familiaris miR-452 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR483 MI0010400 Canis familiaris miR-483 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR323B MI0010401 Canis familiaris miR-487a stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR488 MI0010402 Canis familiaris miR-488 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR432 MI0010403 Canis familiaris miR-432 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR323B MI0010404 Canis familiaris miR-494 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR323B MI0010405 Canis familiaris miR-496 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR504 MI0010406 Canis familiaris miR-504 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR505 MI0010407 Canis familiaris miR-505 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR323B MI0010408 Canis familiaris miR-539 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR544B MI0010409 Canis familiaris miR-544 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR1264 MI0010410 Canis familiaris miR-545 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR551B MI0010411 Canis familiaris miR-551a stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR551B MI0010412 Canis familiaris miR-551b stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR568 MI0010413 Canis familiaris miR-568 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR582 MI0010415 Canis familiaris miR-582 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR589 MI0010416 Canis familiaris miR-589 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR592 MI0010417 Canis familiaris miR-592 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR599 MI0010418 Canis familiaris miR-599 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR615 MI0010419 Canis familiaris miR-615 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR628 MI0010420 Canis familiaris miR-628 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR631 MI0010421 Canis familiaris miR-631 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR632 MI0010422 Canis familiaris miR-632 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR653 MI0010423 Canis familiaris miR-653 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR1197 MI0010424 Canis familiaris miR-758 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR671 MI0010425 Canis familiaris miR-671 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR454 MI0010426 Canis familiaris miR-454 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR802 MI0010427 Canis familiaris miR-802 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR323B MI0010428 Canis familiaris miR-300 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR874 MI0010429 Canis familiaris miR-874 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR875 MI0010430 Canis familiaris miR-875 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR876 MI0010431 Canis familiaris miR-876 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR885 MI0010432 Canis familiaris miR-885 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR665 MI0010433 Canis familiaris miR-665 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR761 MI0010435 Canis familiaris miR-761 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR764 MI0010436 Canis familiaris miR-764 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR759 MI0010437 Canis familiaris miR-759 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR718 MI0010438 Canis familiaris miR-718 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR2052 MI0010486 Homo sapiens miR-2052 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR2053 MI0010487 Homo sapiens miR-2053 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR2054 MI0010488 Homo sapiens miR-2054 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR2110 Zhu et al. incorrectly referred to this sequence as mir-1309 in [1]. This sequence is unrelated to MIR1309 in plants. MI0010629 Homo sapiens miR-2110 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR2114 MI0010633 Homo sapiens miR-2114 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR2115 MI0010634 Homo sapiens miR-2115 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR2116 MI0010635 Homo sapiens miR-2116 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR2117 MI0010636 Homo sapiens miR-2117 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548Q MI0010637 Homo sapiens miR-548q stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR429 MI0010836 Danio rerio miR-429b stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR196B MI0010840 Danio rerio miR-196c stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR103-2AS MI0010843 Danio rerio miR-107b stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR455 MI0010844 Danio rerio miR-455b-2 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR222 MI0010845 Danio rerio miR-222b stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR126 MI0010848 Danio rerio miR-126b stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR196B MI0010853 Danio rerio miR-196d stem-loop A pre-miRNA processed from the primary transcript of human gene MIR2276 MI0011282 Homo sapiens miR-2276 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR2277 MI0011284 Homo sapiens miR-2277 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR2278 MI0011285 Homo sapiens miR-2278 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR2681 MI0012062 Homo sapiens miR-2681 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR2682 MI0012063 Homo sapiens miR-2682 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR711 MI0012488 Homo sapiens miR-711 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR718 MI0012489 Homo sapiens miR-718 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR432 MI0012528 Mus musculus miR-432 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR599 MI0012529 Mus musculus miR-599 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR767 MI0012530 Mus musculus miR-767 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene NIL MI0012531 Mus musculus miR-664 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR202 MI0012584 Rattus norvegicus miR-202 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR490 MI0012585 Rattus norvegicus miR-490 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR105-2 MI0012587 Rattus norvegicus miR-105 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR1224 MI0012589 Rattus norvegicus miR-1224 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR362 MI0012590 Rattus norvegicus miR-362 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR504 MI0012592 Rattus norvegicus miR-504 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR544B MI0012593 Rattus norvegicus miR-544 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR568 MI0012594 Rattus norvegicus miR-568 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR582 MI0012595 Rattus norvegicus miR-582 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR592 MI0012596 Rattus norvegicus miR-592 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR615 MI0012597 Rattus norvegicus miR-615 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR628 MI0012598 Rattus norvegicus miR-628 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR632 MI0012599 Rattus norvegicus miR-632 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR653 MI0012600 Rattus norvegicus miR-653 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR668 MI0012601 Rattus norvegicus miR-668 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR802 MI0012602 Rattus norvegicus miR-802 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR675 MI0012603 Rattus norvegicus miR-675 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR875 MI0012604 Rattus norvegicus miR-875 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR876 MI0012605 Rattus norvegicus miR-876 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR665 MI0012606 Rattus norvegicus miR-665 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR935 MI0012607 Rattus norvegicus miR-935 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene NIL MI0012608 Rattus norvegicus miR-201 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR371B MI0012609 Rattus norvegicus miR-293 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR371B MI0012610 Rattus norvegicus miR-294 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR371B MI0012611 Rattus norvegicus miR-295-1 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR761 MI0012615 Rattus norvegicus miR-761 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR764 MI0012616 Rattus norvegicus miR-764 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR759 MI0012618 Rattus norvegicus miR-759 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR711 MI0012621 Rattus norvegicus miR-711 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR323B MI0012622 Rattus norvegicus miR-496 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR2861 MI0013006 Homo sapiens miR-2861 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR2861 MI0013007 Mus musculus miR-2861 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR2909 This miRNA was referred to as hmiR-che-1 in [1]. MI0013083 Homo sapiens miR-2909 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR1251 MI0014021 Mus musculus miR-1251 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR3064 MI0014026 Mus musculus miR-3064 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR3065 MI0014027 Mus musculus miR-3065 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR3074 MI0014037 Mus musculus miR-3074-1 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 MI0014050 Mus musculus miR-466m stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 MI0014051 Mus musculus miR-669d-2 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 MI0014052 Mus musculus miR-466o stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 MI0014053 Mus musculus miR-467a-2 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 MI0014054 Mus musculus miR-669a-4 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 MI0014055 Mus musculus miR-669a-5 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 MI0014056 Mus musculus miR-467a-3 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 MI0014058 Mus musculus miR-669a-6 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 MI0014059 Mus musculus miR-467a-4 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 MI0014061 Mus musculus miR-669a-7 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 MI0014062 Mus musculus miR-467a-5 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 MI0014064 Mus musculus miR-669p-1 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 MI0014065 Mus musculus miR-467a-6 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 MI0014066 Mus musculus miR-669a-8 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 MI0014068 Mus musculus miR-669a-9 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 MI0014069 Mus musculus miR-467a-7 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 MI0014071 Mus musculus miR-669p-2 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 MI0014072 Mus musculus miR-467a-8 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 MI0014073 Mus musculus miR-669a-10 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 MI0014074 Mus musculus miR-467a-9 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 MI0014075 Mus musculus miR-669a-11 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 MI0014076 Mus musculus miR-467a-10 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 MI0014077 Mus musculus miR-669a-12 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 MI0014079 Mus musculus miR-466n stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene NIL MI0014103 Mus musculus miR-486b stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR3074 MI0014104 Mus musculus miR-3074-2 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR374C MI0014108 Mus musculus miR-374c stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR1912 MI0014110 Mus musculus miR-1912 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3115 MI0014127 Homo sapiens miR-3115 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3116-1 MI0014128 Homo sapiens miR-3116-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3116-2 MI0014129 Homo sapiens miR-3116-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3117 MI0014130 Homo sapiens miR-3117 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0014131 Homo sapiens miR-3118-1 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0014132 Homo sapiens miR-3118-2 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0014133 Homo sapiens miR-3118-3 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3119-1 MI0014134 Homo sapiens miR-3119-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3119-2 MI0014135 Homo sapiens miR-3119-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3120 MI0014136 Homo sapiens miR-3120 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3121 MI0014137 Homo sapiens miR-3121 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3122 MI0014138 Homo sapiens miR-3122 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3123 MI0014139 Homo sapiens miR-3123 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3124 MI0014140 Homo sapiens miR-3124 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548S MI0014141 Homo sapiens miR-548s stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3125 MI0014142 Homo sapiens miR-3125 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3126 MI0014143 Homo sapiens miR-3126 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3127 MI0014144 Homo sapiens miR-3127 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3128 MI0014145 Homo sapiens miR-3128 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3129 MI0014146 Homo sapiens miR-3129 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3130-1 MI0014147 Homo sapiens miR-3130-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3130-2 MI0014148 Homo sapiens miR-3130-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3131 MI0014151 Homo sapiens miR-3131 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3132 MI0014152 Homo sapiens miR-3132 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3133 MI0014153 Homo sapiens miR-3133 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR378B MI0014154 Homo sapiens miR-378b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3134 MI0014155 Homo sapiens miR-3134 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3135 MI0014156 Homo sapiens miR-3135a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR466 MI0014157 Homo sapiens miR-466 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3136 MI0014158 Homo sapiens miR-3136 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR544B MI0014159 Homo sapiens miR-544b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3137 MI0014160 Homo sapiens miR-3137 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3138 MI0014161 Homo sapiens miR-3138 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3139 MI0014162 Homo sapiens miR-3139 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3140 MI0014163 Homo sapiens miR-3140 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548T MI0014164 Homo sapiens miR-548t stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3141 MI0014165 Homo sapiens miR-3141 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3142 MI0014166 Homo sapiens miR-3142 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3143 MI0014167 Homo sapiens miR-3143 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548U MI0014168 Homo sapiens miR-548u stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3144 MI0014169 Homo sapiens miR-3144 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3145 MI0014170 Homo sapiens miR-3145 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1273C MI0014171 Homo sapiens miR-1273c stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3146 MI0014172 Homo sapiens miR-3146 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3147 MI0014173 Homo sapiens miR-3147 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548V MI0014174 Homo sapiens miR-548v stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3148 MI0014175 Homo sapiens miR-3148 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3149 MI0014176 Homo sapiens miR-3149 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3150A MI0014177 Homo sapiens miR-3150a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3151 MI0014178 Homo sapiens miR-3151 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3152 Berezikov et al. proposed this sequence as a miRNA candidate based on the RAKE method [1]. Stark et al. later validated its expression in human using high-throughput sequencing [2]. MI0014179 Homo sapiens miR-3152 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3153 MI0014180 Homo sapiens miR-3153 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3074 MI0014181 Homo sapiens miR-3074 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3154 Berezikov et al. proposed this sequence as a miRNA candidate based on the RAKE method [1]. Goff et al. [2] and Stark et al. [3] later validated its expression in human using high-throughput sequencing. MI0014182 Homo sapiens miR-3154 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3155 MI0014183 Homo sapiens miR-3155a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3156-1 MI0014184 Homo sapiens miR-3156-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3157 MI0014185 Homo sapiens miR-3157 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3158-1 MI0014186 Homo sapiens miR-3158-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3158-2 MI0014187 Homo sapiens miR-3158-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3159 MI0014188 Homo sapiens miR-3159 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3160-1 MI0014189 Homo sapiens miR-3160-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3160-2 MI0014190 Homo sapiens miR-3160-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3161 MI0014191 Homo sapiens miR-3161 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3162 MI0014192 Homo sapiens miR-3162 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3163 MI0014193 Homo sapiens miR-3163 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3164 MI0014194 Homo sapiens miR-3164 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3165 MI0014195 Homo sapiens miR-3165 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3166 MI0014196 Homo sapiens miR-3166 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1260B MI0014197 Homo sapiens miR-1260b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3167 MI0014198 Homo sapiens miR-3167 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3168 MI0014199 Homo sapiens miR-3168 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3169 MI0014200 Homo sapiens miR-3169 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3170 MI0014201 Homo sapiens miR-3170 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3171 MI0014202 Homo sapiens miR-3171 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3173 MI0014204 Homo sapiens miR-3173 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1193 MI0014205 Homo sapiens miR-1193 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR323B miR-323b-5p was previously named miR-453 here and in [1,2], but appears to be processed from the same hairpin as miR-332b-3p identified in [3]. Entries for mir-323b and mir-453 are merged here. MI0014206 Homo sapiens miR-323b stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0014207 Homo sapiens miR-3118-4 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3174 MI0014208 Homo sapiens miR-3174 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3175 MI0014209 Homo sapiens miR-3175 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3176 MI0014210 Homo sapiens miR-3176 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3177 MI0014211 Homo sapiens miR-3177 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3178 MI0014212 Homo sapiens miR-3178 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3179-1 MI0014213 Homo sapiens miR-3179-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3180-1 MI0014214 Homo sapiens miR-3180-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3180-2 MI0014215 Homo sapiens miR-3180-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3179-2 MI0014216 Homo sapiens miR-3179-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3180-3 MI0014217 Homo sapiens miR-3180-3 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3179-3 MI0014221 Homo sapiens miR-3179-3 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548W MI0014222 Homo sapiens miR-548w stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3181 MI0014223 Homo sapiens miR-3181 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3182 MI0014224 Homo sapiens miR-3182 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3183 MI0014225 Homo sapiens miR-3183 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3184 MI0014226 Homo sapiens miR-3184 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3185 MI0014227 Homo sapiens miR-3185 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3065 MI0014228 Homo sapiens miR-3065 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3186 MI0014229 Homo sapiens miR-3186 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3156-2 MI0014230 Homo sapiens miR-3156-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3187 MI0014231 Homo sapiens miR-3187 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3188 MI0014232 Homo sapiens miR-3188 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3189 MI0014233 Homo sapiens miR-3189 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR320E MI0014234 Homo sapiens miR-320e stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3190 MI0014235 Homo sapiens miR-3190 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3191 MI0014236 Homo sapiens miR-3191 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3192 MI0014237 Homo sapiens miR-3192 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3193 MI0014238 Homo sapiens miR-3193 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3194 MI0014239 Homo sapiens miR-3194 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3195 MI0014240 Homo sapiens miR-3195 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3196 MI0014241 Homo sapiens miR-3196 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3156-3 MI0014242 Homo sapiens miR-3156-3 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548X MI0014244 Homo sapiens miR-548x stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3197 MI0014245 Homo sapiens miR-3197 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3198-1 MI0014246 Homo sapiens miR-3198-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3199-1 MI0014247 Homo sapiens miR-3199-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3199-2 MI0014248 Homo sapiens miR-3199-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3200 MI0014249 Homo sapiens miR-3200 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3201 MI0014250 Homo sapiens miR-3201 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR514B MI0014251 Homo sapiens miR-514b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3202-1 MI0014252 Homo sapiens miR-3202-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3202-2 MI0014253 Homo sapiens miR-3202-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1273D MI0014254 Homo sapiens miR-1273d stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR3529 MI0015380 Gallus gallus miR-3529 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene NIL MI0015382 Gallus gallus miR-219b stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR3545 MI0015399 Rattus norvegicus miR-203b stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR208B MI0015400 Rattus norvegicus miR-3546 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR449C MI0015402 Rattus norvegicus miR-449c stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR429 MI0015404 Rattus norvegicus miR-3548 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR193B MI0015405 Rattus norvegicus miR-3549 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene NIL MI0015407 Rattus norvegicus miR-3551 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR3074 MI0015411 Rattus norvegicus miR-3074 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR31 MI0015412 Rattus norvegicus miR-31b stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR191 MI0015413 Rattus norvegicus miR-191b stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR378E MI0015415 Rattus norvegicus miR-3557 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR371B MI0015417 Rattus norvegicus miR-291b stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIRLET7I MI0015418 Rattus norvegicus miR-3596d stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR466 MI0015419 Rattus norvegicus miR-466d stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR299 MI0015425 Rattus norvegicus miR-299b stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR9-3 MI0015426 Rattus norvegicus miR-9b-3 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR3065 MI0015429 Rattus norvegicus miR-3065 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR9-3 MI0015430 Rattus norvegicus miR-9b-1 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR126 MI0015433 Rattus norvegicus miR-126b stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR208B MI0015434 Rattus norvegicus miR-208b stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR216B MI0015435 Rattus norvegicus miR-216b stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR9-3 MI0015439 Rattus norvegicus miR-9b-2 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR1-1 MI0015440 Rattus norvegicus miR-3571 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR1193 MI0015445 Rattus norvegicus miR-1193 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR429 MI0015447 Rattus norvegicus miR-3575 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR1912 MI0015450 Rattus norvegicus miR-1912 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR323B MI0015454 Rattus norvegicus miR-409b stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIRLET7I MI0015455 Rattus norvegicus miR-3596b stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR133B MI0015456 Rattus norvegicus miR-133c stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR514B MI0015460 Rattus norvegicus miR-3585 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR151B MI0015461 Rattus norvegicus miR-3586 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene NIL MI0015462 Rattus norvegicus miR-219b stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR99B MI0015466 Rattus norvegicus miR-3588 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR1249 MI0015470 Rattus norvegicus miR-1249 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR3591 MI0015471 Rattus norvegicus miR-3591 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR3120 MI0015476 Rattus norvegicus miR-3120 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene NIL MI0015477 Rattus norvegicus miR-741 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR376A2 MI0015478 Rattus norvegicus miR-3595 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4295 MI0015822 Homo sapiens miR-4295 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4296 MI0015823 Homo sapiens miR-4296 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4297 MI0015824 Homo sapiens miR-4297 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR378C MI0015825 Homo sapiens miR-378c stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4293 MI0015826 Homo sapiens miR-4293 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4294 MI0015827 Homo sapiens miR-4294 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4301 MI0015828 Homo sapiens miR-4301 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4299 MI0015829 Homo sapiens miR-4299 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4298 MI0015830 Homo sapiens miR-4298 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4300 MI0015831 Homo sapiens miR-4300 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4304 MI0015832 Homo sapiens miR-4304 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4302 MI0015833 Homo sapiens miR-4302 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4303 MI0015834 Homo sapiens miR-4303 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4305 MI0015835 Homo sapiens miR-4305 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4306 MI0015836 Homo sapiens miR-4306 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4309 MI0015837 Homo sapiens miR-4309 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4307 MI0015838 Homo sapiens miR-4307 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4308 MI0015839 Homo sapiens miR-4308 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4310 MI0015840 Homo sapiens miR-4310 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4311 MI0015841 Homo sapiens miR-4311 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4312 MI0015842 Homo sapiens miR-4312 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4313 MI0015843 Homo sapiens miR-4313 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4315-1 MI0015844 Homo sapiens miR-4315-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4316 MI0015845 Homo sapiens miR-4316 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4314 MI0015846 Homo sapiens miR-4314 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4318 MI0015847 Homo sapiens miR-4318 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4319 MI0015848 Homo sapiens miR-4319 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4320 MI0015849 Homo sapiens miR-4320 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4317 MI0015850 Homo sapiens miR-4317 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4322 MI0015851 Homo sapiens miR-4322 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4321 MI0015852 Homo sapiens miR-4321 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4323 MI0015853 Homo sapiens miR-4323 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4324 MI0015854 Homo sapiens miR-4324 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4256 MI0015855 Homo sapiens miR-4256 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4257 MI0015856 Homo sapiens miR-4257 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4258 MI0015857 Homo sapiens miR-4258 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4259 MI0015858 Homo sapiens miR-4259 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4260 MI0015859 Homo sapiens miR-4260 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4253 MI0015860 Homo sapiens miR-4253 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4251 MI0015861 Homo sapiens miR-4251 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4254 MI0015862 Homo sapiens miR-4254 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4255 MI0015863 Homo sapiens miR-4255 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4252 MI0015864 Homo sapiens miR-4252 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4325 MI0015865 Homo sapiens miR-4325 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4326 MI0015866 Homo sapiens miR-4326 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4327 MI0015867 Homo sapiens miR-4327 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4261 MI0015868 Homo sapiens miR-4261 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4265 MI0015869 Homo sapiens miR-4265 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4266 MI0015870 Homo sapiens miR-4266 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4267 MI0015871 Homo sapiens miR-4267 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4262 MI0015872 Homo sapiens miR-4262 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR2355 MI0015873 Homo sapiens miR-2355 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4268 MI0015874 Homo sapiens miR-4268 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4269 MI0015875 Homo sapiens miR-4269 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4263 MI0015876 Homo sapiens miR-4263 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4264 MI0015877 Homo sapiens miR-4264 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4270 MI0015878 Homo sapiens miR-4270 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4271 MI0015879 Homo sapiens miR-4271 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4272 MI0015880 Homo sapiens miR-4272 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4273 MI0015881 Homo sapiens miR-4273 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4276 MI0015882 Homo sapiens miR-4276 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4275 MI0015883 Homo sapiens miR-4275 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4274 MI0015884 Homo sapiens miR-4274 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4281 MI0015885 Homo sapiens miR-4281 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4277 MI0015886 Homo sapiens miR-4277 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4279 MI0015887 Homo sapiens miR-4279 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4278 MI0015888 Homo sapiens miR-4278 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4280 MI0015889 Homo sapiens miR-4280 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4282 MI0015890 Homo sapiens miR-4282 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4285 MI0015891 Homo sapiens miR-4285 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4283-1 MI0015892 Homo sapiens miR-4283-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4284 MI0015893 Homo sapiens miR-4284 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4286 MI0015894 Homo sapiens miR-4286 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4287 MI0015895 Homo sapiens miR-4287 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4288 MI0015896 Homo sapiens miR-4288 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4292 MI0015897 Homo sapiens miR-4292 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4289 MI0015898 Homo sapiens miR-4289 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4290 MI0015899 Homo sapiens miR-4290 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4291 MI0015900 Homo sapiens miR-4291 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4329 MI0015901 Homo sapiens miR-4329 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4330 MI0015902 Homo sapiens miR-4330 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR500B MI0015903 Homo sapiens miR-500b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4328 MI0015904 Homo sapiens miR-4328 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR29C MI0015960 Canis familiaris miR-29c-2 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR371B MI0015968 Rattus norvegicus miR-295-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1184-2 MI0015971 Homo sapiens miR-1184-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1184-3 MI0015972 Homo sapiens miR-1184-3 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1233-2 MI0015973 Homo sapiens miR-1233-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1244-2 MI0015974 Homo sapiens miR-1244-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1244-3 MI0015975 Homo sapiens miR-1244-3 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1972-2 MI0015977 Homo sapiens miR-1972-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1302-9 MI0015978 Homo sapiens miR-1302-9 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1302-10 MI0015979 Homo sapiens miR-1302-10 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1302-11 MI0015980 Homo sapiens miR-1302-11 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4283-2 MI0015982 Homo sapiens miR-4283-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4315-2 MI0015983 Homo sapiens miR-4315-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3605 MI0015995 Homo sapiens miR-3605 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3606 MI0015996 Homo sapiens miR-3606 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3607 MI0015997 Homo sapiens miR-3607 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3609 MI0015999 Homo sapiens miR-3609 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3610 MI0016000 Homo sapiens miR-3610 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3611 MI0016001 Homo sapiens miR-3611 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3612 MI0016002 Homo sapiens miR-3612 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3613 MI0016003 Homo sapiens miR-3613 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3614 MI0016004 Homo sapiens miR-3614 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3615 MI0016005 Homo sapiens miR-3615 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3616 MI0016006 Homo sapiens miR-3616 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3617 MI0016007 Homo sapiens miR-3617 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3618 MI0016008 Homo sapiens miR-3618 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3619 MI0016009 Homo sapiens miR-3619 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR23C MI0016010 Homo sapiens miR-23c stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3620 MI0016011 Homo sapiens miR-3620 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3621 MI0016012 Homo sapiens miR-3621 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3622A MI0016013 Homo sapiens miR-3622a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3622B MI0016014 Homo sapiens miR-3622b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3646 MI0016046 Homo sapiens miR-3646 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3648 MI0016048 Homo sapiens miR-3648-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3649 MI0016049 Homo sapiens miR-3649 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3650 MI0016050 Homo sapiens miR-3650 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3651 MI0016051 Homo sapiens miR-3651 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3652 MI0016052 Homo sapiens miR-3652 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3653 MI0016053 Homo sapiens miR-3653 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3654 MI0016054 Homo sapiens miR-3654 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3655 MI0016055 Homo sapiens miR-3655 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3656 MI0016056 Homo sapiens miR-3656 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3657 MI0016057 Homo sapiens miR-3657 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3658 MI0016058 Homo sapiens miR-3658 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1273E MI0016059 Homo sapiens miR-1273e stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3659 MI0016060 Homo sapiens miR-3659 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3660 MI0016061 Homo sapiens miR-3660 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3661 MI0016062 Homo sapiens miR-3661 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3662 MI0016063 Homo sapiens miR-3662 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3663 MI0016064 Homo sapiens miR-3663 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3664 MI0016065 Homo sapiens miR-3664 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3665 This sequence was predicted as a miRNA by Xie et al. [1] and validated later by microarray [2]. MI0016066 Homo sapiens miR-3665 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3666 This sequence was predicted as a miRNA by Xie et al. [1] and validated later by microarray [2]. MI0016067 Homo sapiens miR-3666 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3667 MI0016068 Homo sapiens miR-3667 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3668 MI0016069 Homo sapiens miR-3668 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3670 MI0016071 Homo sapiens miR-3670-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3671 MI0016072 Homo sapiens miR-3671 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3672 MI0016073 Homo sapiens miR-3672 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3674 MI0016075 Homo sapiens miR-3674 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3675 MI0016076 Homo sapiens miR-3675 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3677 MI0016078 Homo sapiens miR-3677 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3678 MI0016079 Homo sapiens miR-3678 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3679 MI0016080 Homo sapiens miR-3679 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3680 MI0016081 Homo sapiens miR-3680-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3681 MI0016082 Homo sapiens miR-3681 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3682 MI0016083 Homo sapiens miR-3682 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3683 MI0016084 Homo sapiens miR-3683 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3684 MI0016085 Homo sapiens miR-3684 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3685 MI0016086 Homo sapiens miR-3685 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3686 MI0016087 Homo sapiens miR-3686 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3687 MI0016088 Homo sapiens miR-3687-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3688-1 MI0016089 Homo sapiens miR-3688-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3689A MI0016090 Homo sapiens miR-3689a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3690 MI0016091 Homo sapiens miR-3690-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3691 MI0016092 Homo sapiens miR-3691 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3692 MI0016093 Homo sapiens miR-3692 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3713 MI0016134 Homo sapiens miR-3713 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3714 MI0016135 Homo sapiens miR-3714 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3180-4 MI0016408 Homo sapiens miR-3180-4 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3180-5 MI0016409 Homo sapiens miR-3180-5 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3907 MI0016410 Homo sapiens miR-3907 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3689B MI0016411 Homo sapiens miR-3689b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3908 MI0016412 Homo sapiens miR-3908 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3909 MI0016413 Homo sapiens miR-3909 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3910-1 MI0016414 Homo sapiens miR-3910-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3911 MI0016415 Homo sapiens miR-3911 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3912 MI0016416 Homo sapiens miR-3912 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3913-1 MI0016417 Homo sapiens miR-3913-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3913-2 MI0016418 Homo sapiens miR-3913-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3914-1 MI0016419 Homo sapiens miR-3914-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3915 MI0016420 Homo sapiens miR-3915 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3914-2 MI0016421 Homo sapiens miR-3914-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3916 MI0016422 Homo sapiens miR-3916 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3917 MI0016423 Homo sapiens miR-3917 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3918 MI0016424 Homo sapiens miR-3918 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3919 MI0016425 Homo sapiens miR-3919 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3150B MI0016426 Homo sapiens miR-3150b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3920 MI0016427 Homo sapiens miR-3920 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3921 MI0016428 Homo sapiens miR-3921 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3922 MI0016429 Homo sapiens miR-3922 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3923 MI0016430 Homo sapiens miR-3923 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3910-2 MI0016431 Homo sapiens miR-3910-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3924 MI0016432 Homo sapiens miR-3924 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3925 MI0016433 Homo sapiens miR-3925 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3926-1 MI0016434 Homo sapiens miR-3926-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3927 MI0016435 Homo sapiens miR-3927 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR676 MI0016436 Homo sapiens miR-676 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3926-2 MI0016437 Homo sapiens miR-3926-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3928 MI0016438 Homo sapiens miR-3928 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3929 MI0016439 Homo sapiens miR-3929 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3934 MI0016590 Homo sapiens miR-3934 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3935 MI0016591 Homo sapiens miR-3935 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3936 MI0016592 Homo sapiens miR-3936 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3937 MI0016593 Homo sapiens miR-3937 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3938 MI0016594 Homo sapiens miR-3938 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548Y MI0016595 Homo sapiens miR-548y stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3939 MI0016596 Homo sapiens miR-3939 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3940 MI0016597 Homo sapiens miR-3940 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3941 MI0016598 Homo sapiens miR-3941 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3942 MI0016599 Homo sapiens miR-3942 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3943 MI0016600 Homo sapiens miR-3943 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3944 MI0016601 Homo sapiens miR-3944 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3945 MI0016602 Homo sapiens miR-3945 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR374C MI0016684 Homo sapiens miR-374c stem-loop A pre-miRNA processed from the primary transcript of human gene MIR642B MI0016685 Homo sapiens miR-642b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR550B1 MI0016686 Homo sapiens miR-550b-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR550B2 MI0016687 Homo sapiens miR-550b-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548Z MI0016688 Homo sapiens miR-548z stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548AA1 MI0016689 Homo sapiens miR-548aa-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548AA2 MI0016690 Homo sapiens miR-548aa-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548O2 MI0016746 Homo sapiens miR-548o-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1254-2 MI0016747 Homo sapiens miR-1254-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1268B MI0016748 Homo sapiens miR-1268b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR378D1 MI0016749 Homo sapiens miR-378d-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR378E MI0016750 Homo sapiens miR-378e stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548H5 MI0016751 Homo sapiens miR-548h-5 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548AB MI0016752 Homo sapiens miR-548ab stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4417 MI0016753 Homo sapiens miR-4417 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4418 MI0016754 Homo sapiens miR-4418 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4419A MI0016755 Homo sapiens miR-4419a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR378F MI0016756 Homo sapiens miR-378f stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4420 MI0016757 Homo sapiens miR-4420 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4421 MI0016758 Homo sapiens miR-4421 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4422 MI0016759 Homo sapiens miR-4422 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4423 MI0016760 Homo sapiens miR-4423 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR378G MI0016761 Homo sapiens miR-378g stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548AC MI0016762 Homo sapiens miR-548ac stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4424 MI0016763 Homo sapiens miR-4424 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4425 MI0016764 Homo sapiens miR-4425 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4426 MI0016765 Homo sapiens miR-4426 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4427 MI0016766 Homo sapiens miR-4427 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4428 MI0016767 Homo sapiens miR-4428 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4429 MI0016768 Homo sapiens miR-4429 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4430 MI0016769 Homo sapiens miR-4430 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548AD MI0016770 Homo sapiens miR-548ad stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4431 MI0016771 Homo sapiens miR-4431 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4432 MI0016772 Homo sapiens miR-4432 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4433 MI0016773 Homo sapiens miR-4433a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4434 MI0016774 Homo sapiens miR-4434 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4435-1 MI0016775 Homo sapiens miR-4435-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4436A MI0016776 Homo sapiens miR-4436a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4435-2 MI0016777 Homo sapiens miR-4435-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4437 MI0016778 Homo sapiens miR-4437 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548AE1 MI0016779 Homo sapiens miR-548ae-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548AE2 MI0016780 Homo sapiens miR-548ae-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4438 MI0016781 Homo sapiens miR-4438 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4439 MI0016782 Homo sapiens miR-4439 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4440 MI0016783 Homo sapiens miR-4440 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4441 MI0016784 Homo sapiens miR-4441 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4442 MI0016785 Homo sapiens miR-4442 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4443 MI0016786 Homo sapiens miR-4443 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4444 MI0016787 Homo sapiens miR-4444-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4445 MI0016788 Homo sapiens miR-4445 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4446 MI0016789 Homo sapiens miR-4446 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4447 MI0016790 Homo sapiens miR-4447 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4448 MI0016791 Homo sapiens miR-4448 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4449 MI0016792 Homo sapiens miR-4449 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548AG1 MI0016793 Homo sapiens miR-548ag-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548AG2 MI0016794 Homo sapiens miR-548ag-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4450 MI0016795 Homo sapiens miR-4450 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548AH MI0016796 Homo sapiens miR-548ah stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4451 MI0016797 Homo sapiens miR-4451 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4452 MI0016798 Homo sapiens miR-4452 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4453 MI0016799 Homo sapiens miR-4453 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4454 MI0016800 Homo sapiens miR-4454 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4455 MI0016801 Homo sapiens miR-4455 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4456 MI0016802 Homo sapiens miR-4456 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4457 MI0016803 Homo sapiens miR-4457 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4458 MI0016804 Homo sapiens miR-4458 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4459 MI0016805 Homo sapiens miR-4459 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4460 MI0016806 Homo sapiens miR-4460 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4461 MI0016807 Homo sapiens miR-4461 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR378H MI0016808 Homo sapiens miR-378h stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3135B MI0016809 Homo sapiens miR-3135b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4462 MI0016810 Homo sapiens miR-4462 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4463 MI0016811 Homo sapiens miR-4463 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4464 MI0016812 Homo sapiens miR-4464 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548AI MI0016813 Homo sapiens miR-548ai stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548AJ1 MI0016814 Homo sapiens miR-548aj-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548AJ2 MI0016815 Homo sapiens miR-548aj-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4465 MI0016816 Homo sapiens miR-4465 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4466 MI0016817 Homo sapiens miR-4466 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4467 MI0016818 Homo sapiens miR-4467 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4468 MI0016819 Homo sapiens miR-4468 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4469 MI0016820 Homo sapiens miR-4469 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4470 MI0016821 Homo sapiens miR-4470 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4471 MI0016822 Homo sapiens miR-4471 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4472-1 MI0016823 Homo sapiens miR-4472-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4472-2 MI0016824 Homo sapiens miR-4472-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4473 MI0016825 Homo sapiens miR-4473 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4474 MI0016826 Homo sapiens miR-4474 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4475 MI0016827 Homo sapiens miR-4475 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4476 MI0016828 Homo sapiens miR-4476 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4477A MI0016829 Homo sapiens miR-4477a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4477B MI0016830 Homo sapiens miR-4477b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4478 MI0016831 Homo sapiens miR-4478 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3689C MI0016832 Homo sapiens miR-3689c stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548X2 MI0016833 Homo sapiens miR-548x-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3689D1 MI0016834 Homo sapiens miR-3689d-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3689D2 MI0016835 Homo sapiens miR-3689d-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3689E MI0016836 Homo sapiens miR-3689e stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3689F MI0016837 Homo sapiens miR-3689f stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4479 MI0016838 Homo sapiens miR-4479 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3155B MI0016839 Homo sapiens miR-3155b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548AK MI0016840 Homo sapiens miR-548ak stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4480 MI0016841 Homo sapiens miR-4480 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4481 MI0016842 Homo sapiens miR-4481 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4482 MI0016843 Homo sapiens miR-4482 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4483 MI0016844 Homo sapiens miR-4483 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4484 MI0016845 Homo sapiens miR-4484 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4485 MI0016846 Homo sapiens miR-4485 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4486 MI0016847 Homo sapiens miR-4486 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4487 MI0016848 Homo sapiens miR-4487 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4488 MI0016849 Homo sapiens miR-4488 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4489 MI0016850 Homo sapiens miR-4489 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548AL MI0016851 Homo sapiens miR-548al stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4490 MI0016852 Homo sapiens miR-4490 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4491 MI0016853 Homo sapiens miR-4491 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4492 MI0016854 Homo sapiens miR-4492 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4493 MI0016855 Homo sapiens miR-4493 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4494 MI0016856 Homo sapiens miR-4494 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4495 MI0016857 Homo sapiens miR-4495 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4496 MI0016858 Homo sapiens miR-4496 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4497 MI0016859 Homo sapiens miR-4497 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4498 MI0016860 Homo sapiens miR-4498 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4419B MI0016861 Homo sapiens miR-4419b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4499 MI0016862 Homo sapiens miR-4499 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4500 MI0016863 Homo sapiens miR-4500 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4501 MI0016864 Homo sapiens miR-4501 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4502 MI0016865 Homo sapiens miR-4502 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4503 MI0016866 Homo sapiens miR-4503 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4504 MI0016867 Homo sapiens miR-4504 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4505 MI0016868 Homo sapiens miR-4505 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4506 MI0016869 Homo sapiens miR-4506 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR2392 MI0016870 Homo sapiens miR-2392 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4507 MI0016871 Homo sapiens miR-4507 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4508 MI0016872 Homo sapiens miR-4508 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4509-1 MI0016873 Homo sapiens miR-4509-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4509-2 MI0016874 Homo sapiens miR-4509-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4509-3 MI0016875 Homo sapiens miR-4509-3 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4510 MI0016876 Homo sapiens miR-4510 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4511 MI0016877 Homo sapiens miR-4511 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4512 MI0016878 Homo sapiens miR-4512 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4513 MI0016879 Homo sapiens miR-4513 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4514 MI0016880 Homo sapiens miR-4514 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4515 MI0016881 Homo sapiens miR-4515 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4516 MI0016882 Homo sapiens miR-4516 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4517 MI0016883 Homo sapiens miR-4517 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4518 MI0016884 Homo sapiens miR-4518 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4519 MI0016885 Homo sapiens miR-4519 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4520A MI0016886 Homo sapiens miR-4520-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4521 MI0016887 Homo sapiens miR-4521 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1269B MI0016888 Homo sapiens miR-1269b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4522 MI0016889 Homo sapiens miR-4522 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4523 MI0016890 Homo sapiens miR-4523 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4524 MI0016891 Homo sapiens miR-4524a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4525 MI0016892 Homo sapiens miR-4525 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4526 MI0016893 Homo sapiens miR-4526 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4527 MI0016894 Homo sapiens miR-4527 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4528 MI0016895 Homo sapiens miR-4528 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4529 MI0016896 Homo sapiens miR-4529 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4530 MI0016897 Homo sapiens miR-4530 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4531 MI0016898 Homo sapiens miR-4531 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4532 MI0016899 Homo sapiens miR-4532 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4533 MI0016900 Homo sapiens miR-4533 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4534 MI0016901 Homo sapiens miR-4534 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR378I MI0016902 Homo sapiens miR-378i stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4535 MI0016903 Homo sapiens miR-4535 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548AM MI0016904 Homo sapiens miR-548am stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1587 MI0016905 Homo sapiens miR-1587 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4536 MI0016906 Homo sapiens miR-4536-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR548AN MI0016907 Homo sapiens miR-548an stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4537 MI0016908 Homo sapiens miR-4537 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4538 MI0016909 Homo sapiens miR-4538 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4539 MI0016910 Homo sapiens miR-4539 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4540 MI0016911 Homo sapiens miR-4540 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR3960 MI0016963 Mus musculus miR-3960 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3960 MI0016964 Homo sapiens miR-3960 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR151B MI0016966 Mus musculus miR-28c stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR378E MI0016973 Mus musculus miR-378b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3972 MI0016990 Homo sapiens miR-3972 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3973 MI0016991 Homo sapiens miR-3973 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3974 MI0016992 Homo sapiens miR-3974 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3975 MI0016993 Homo sapiens miR-3975 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3976 MI0016994 Homo sapiens miR-3976 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3977 MI0016995 Homo sapiens miR-3977 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3978 MI0016996 Homo sapiens miR-3978 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4632 MI0017259 Homo sapiens miR-4632 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4633 MI0017260 Homo sapiens miR-4633 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4634 MI0017261 Homo sapiens miR-4634 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4635 MI0017262 Homo sapiens miR-4635 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4636 MI0017263 Homo sapiens miR-4636 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4637 MI0017264 Homo sapiens miR-4637 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4638 MI0017265 Homo sapiens miR-4638 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4639 MI0017266 Homo sapiens miR-4639 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4640 MI0017267 Homo sapiens miR-4640 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4641 MI0017268 Homo sapiens miR-4641 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4642 MI0017269 Homo sapiens miR-4642 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4643 MI0017270 Homo sapiens miR-4643 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4644 MI0017271 Homo sapiens miR-4644 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4645 MI0017272 Homo sapiens miR-4645 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4646 MI0017273 Homo sapiens miR-4646 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4647 MI0017274 Homo sapiens miR-4647 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4648 MI0017275 Homo sapiens miR-4648 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4649 MI0017276 Homo sapiens miR-4649 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4650-1 MI0017277 Homo sapiens miR-4650-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4650-2 MI0017278 Homo sapiens miR-4650-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4651 MI0017279 Homo sapiens miR-4651 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4652 MI0017280 Homo sapiens miR-4652 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4653 MI0017281 Homo sapiens miR-4653 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4654 MI0017282 Homo sapiens miR-4654 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4655 MI0017283 Homo sapiens miR-4655 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4656 MI0017284 Homo sapiens miR-4656 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4657 MI0017285 Homo sapiens miR-4657 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4658 MI0017286 Homo sapiens miR-4658 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4659A MI0017287 Homo sapiens miR-4659a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4660 MI0017288 Homo sapiens miR-4660 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4661 MI0017289 Homo sapiens miR-4661 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4662A MI0017290 Homo sapiens miR-4662a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4659B MI0017291 Homo sapiens miR-4659b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4663 MI0017292 Homo sapiens miR-4663 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4662B MI0017293 Homo sapiens miR-4662b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4664 MI0017294 Homo sapiens miR-4664 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4665 MI0017295 Homo sapiens miR-4665 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4666 MI0017296 Homo sapiens miR-4666a stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4667 MI0017297 Homo sapiens miR-4667 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4668 MI0017298 Homo sapiens miR-4668 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0017299 Homo sapiens miR-219b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4669 MI0017300 Homo sapiens miR-4669 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4670 MI0017301 Homo sapiens miR-4670 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4671 MI0017302 Homo sapiens miR-4671 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4672 MI0017303 Homo sapiens miR-4672 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4673 MI0017304 Homo sapiens miR-4673 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4674 MI0017305 Homo sapiens miR-4674 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4675 MI0017306 Homo sapiens miR-4675 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4676 MI0017307 Homo sapiens miR-4676 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4677 MI0017308 Homo sapiens miR-4677 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4678 MI0017309 Homo sapiens miR-4678 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4679-1 MI0017310 Homo sapiens miR-4679-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4679-2 MI0017311 Homo sapiens miR-4679-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4680 MI0017312 Homo sapiens miR-4680 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4681 MI0017313 Homo sapiens miR-4681 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4682 MI0017314 Homo sapiens miR-4682 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4683 MI0017315 Homo sapiens miR-4683 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4684 MI0017316 Homo sapiens miR-4684 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4685 MI0017317 Homo sapiens miR-4685 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4686 MI0017318 Homo sapiens miR-4686 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4687 MI0017319 Homo sapiens miR-4687 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1343 MI0017320 Homo sapiens miR-1343 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4688 MI0017321 Homo sapiens miR-4688 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4689 MI0017322 Homo sapiens miR-4689 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4690 MI0017323 Homo sapiens miR-4690 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4691 MI0017324 Homo sapiens miR-4691 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4692 MI0017325 Homo sapiens miR-4692 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4693 MI0017326 Homo sapiens miR-4693 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4694 MI0017327 Homo sapiens miR-4694 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4695 MI0017328 Homo sapiens miR-4695 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4696 MI0017329 Homo sapiens miR-4696 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4697 MI0017330 Homo sapiens miR-4697 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4698 MI0017331 Homo sapiens miR-4698 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4699 MI0017332 Homo sapiens miR-4699 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4700 MI0017333 Homo sapiens miR-4700 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4701 MI0017334 Homo sapiens miR-4701 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3198-2 MI0017335 Homo sapiens miR-3198-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4703 MI0017336 Homo sapiens miR-4703 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4704 MI0017337 Homo sapiens miR-4704 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4705 MI0017338 Homo sapiens miR-4705 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4706 MI0017339 Homo sapiens miR-4706 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4707 MI0017340 Homo sapiens miR-4707 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4708 MI0017341 Homo sapiens miR-4708 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4709 MI0017342 Homo sapiens miR-4709 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3545 MI0017343 Homo sapiens miR-203b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4710 MI0017344 Homo sapiens miR-4710 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4711 MI0017345 Homo sapiens miR-4711 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4712 MI0017346 Homo sapiens miR-4712 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4713 MI0017347 Homo sapiens miR-4713 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4714 MI0017348 Homo sapiens miR-4714 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4715 MI0017349 Homo sapiens miR-4715 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4716 MI0017350 Homo sapiens miR-4716 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3529 MI0017351 Homo sapiens miR-3529 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4717 MI0017352 Homo sapiens miR-4717 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4718 MI0017353 Homo sapiens miR-4718 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4719 MI0017354 Homo sapiens miR-4719 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4720 MI0017355 Homo sapiens miR-4720 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4721 MI0017356 Homo sapiens miR-4721 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4722 MI0017357 Homo sapiens miR-4722 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4520B MI0017358 Homo sapiens miR-4520-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4723 MI0017359 Homo sapiens miR-4723 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR451B MI0017360 Homo sapiens miR-451b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4724 MI0017361 Homo sapiens miR-4724 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4725 MI0017362 Homo sapiens miR-4725 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4726 MI0017363 Homo sapiens miR-4726 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4727 MI0017364 Homo sapiens miR-4727 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4728 MI0017365 Homo sapiens miR-4728 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4729 MI0017366 Homo sapiens miR-4729 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4730 MI0017367 Homo sapiens miR-4730 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4731 MI0017368 Homo sapiens miR-4731 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4732 MI0017369 Homo sapiens miR-4732 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4733 MI0017370 Homo sapiens miR-4733 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4734 MI0017371 Homo sapiens miR-4734 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4735 MI0017372 Homo sapiens miR-4735 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4736 MI0017373 Homo sapiens miR-4736 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4737 MI0017374 Homo sapiens miR-4737 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3064 MI0017375 Homo sapiens miR-3064 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4738 MI0017376 Homo sapiens miR-4738 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4739 MI0017377 Homo sapiens miR-4739 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4740 MI0017378 Homo sapiens miR-4740 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4741 MI0017379 Homo sapiens miR-4741 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4742 MI0017380 Homo sapiens miR-4742 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4743 MI0017381 Homo sapiens miR-4743 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4744 MI0017382 Homo sapiens miR-4744 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3591 MI0017383 Homo sapiens miR-3591 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4745 MI0017384 Homo sapiens miR-4745 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4746 MI0017385 Homo sapiens miR-4746 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4747 MI0017386 Homo sapiens miR-4747 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4748 MI0017387 Homo sapiens miR-4748 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4749 MI0017388 Homo sapiens miR-4749 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4750 MI0017389 Homo sapiens miR-4750 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4751 MI0017390 Homo sapiens miR-4751 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4752 MI0017391 Homo sapiens miR-4752 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4753 MI0017392 Homo sapiens miR-4753 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR371B MI0017393 Homo sapiens miR-371b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4754 MI0017394 Homo sapiens miR-4754 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4755 MI0017395 Homo sapiens miR-4755 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR499A MI0017396 Homo sapiens miR-499b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4756 MI0017397 Homo sapiens miR-4756 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4757 MI0017398 Homo sapiens miR-4757 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4758 MI0017399 Homo sapiens miR-4758 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4759 MI0017400 Homo sapiens miR-4759 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4760 MI0017401 Homo sapiens miR-4760 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4761 MI0017402 Homo sapiens miR-4761 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4762 MI0017403 Homo sapiens miR-4762 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4763 MI0017404 Homo sapiens miR-4763 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4764 MI0017405 Homo sapiens miR-4764 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4765 MI0017406 Homo sapiens miR-4765 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4766 MI0017407 Homo sapiens miR-4766 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4767 MI0017408 Homo sapiens miR-4767 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4768 MI0017409 Homo sapiens miR-4768 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4769 MI0017410 Homo sapiens miR-4769 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4770 MI0017411 Homo sapiens miR-4770 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4771-1 MI0017412 Homo sapiens miR-4771-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4771-2 MI0017413 Homo sapiens miR-4771-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4772 MI0017414 Homo sapiens miR-4772 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4773-1 MI0017415 Homo sapiens miR-4773-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4773-2 MI0017416 Homo sapiens miR-4773-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4774 MI0017417 Homo sapiens miR-4774 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4775 MI0017418 Homo sapiens miR-4775 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4776-1 MI0017419 Homo sapiens miR-4776-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4776-2 MI0017420 Homo sapiens miR-4776-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4777 MI0017421 Homo sapiens miR-4777 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4778 MI0017422 Homo sapiens miR-4778 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4779 MI0017423 Homo sapiens miR-4779 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4780 MI0017424 Homo sapiens miR-4780 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4436B MI0017425 Homo sapiens miR-4436b-1 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4781 MI0017426 Homo sapiens miR-4781 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4782 MI0017427 Homo sapiens miR-4782 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4783 MI0017428 Homo sapiens miR-4783 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4784 MI0017429 Homo sapiens miR-4784 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4785 MI0017430 Homo sapiens miR-4785 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1245B MI0017431 Homo sapiens miR-1245b stem-loop A pre-miRNA processed from the primary transcript of human gene MIR2467 MI0017432 Homo sapiens miR-2467 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4786 MI0017433 Homo sapiens miR-4786 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4787 MI0017434 Homo sapiens miR-4787 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4788 MI0017435 Homo sapiens miR-4788 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4789 MI0017436 Homo sapiens miR-4789 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4790 MI0017437 Homo sapiens miR-4790 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4791 MI0017438 Homo sapiens miR-4791 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4792 MI0017439 Homo sapiens miR-4792 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4793 MI0017440 Homo sapiens miR-4793 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4794 MI0017441 Homo sapiens miR-4794 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4795 MI0017442 Homo sapiens miR-4795 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4796 MI0017443 Homo sapiens miR-4796 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4797 MI0017444 Homo sapiens miR-4797 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4798 MI0017445 Homo sapiens miR-4798 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4799 MI0017446 Homo sapiens miR-4799 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3688-2 MI0017447 Homo sapiens miR-3688-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4800 MI0017448 Homo sapiens miR-4800 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4801 MI0017449 Homo sapiens miR-4801 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4802 MI0017450 Homo sapiens miR-4802 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4803 MI0017451 Homo sapiens miR-4803 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR4804 MI0017452 Homo sapiens miR-4804 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0017865 Homo sapiens miR-4999 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0017866 Homo sapiens miR-5000 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0017867 Homo sapiens miR-5001 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0017868 Homo sapiens miR-5002 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0017869 Homo sapiens miR-5003 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0017870 Homo sapiens miR-5004 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0017871 Homo sapiens miR-548ao stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0017873 Homo sapiens miR-5006 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0017874 Homo sapiens miR-5007 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0017875 Homo sapiens miR-548ap stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0017876 Homo sapiens miR-5008 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0017877 Homo sapiens miR-5009 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0017878 Homo sapiens miR-5010 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0017879 Homo sapiens miR-5011 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR5047 MI0017932 Homo sapiens miR-5047 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0017976 Homo sapiens miR-5087 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0017977 Homo sapiens miR-5088 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0017978 Homo sapiens miR-5089 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0017979 Homo sapiens miR-5090 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0017980 Homo sapiens miR-5091 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0017981 Homo sapiens miR-5092 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0017982 Homo sapiens miR-5093 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0017983 Homo sapiens miR-5094 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR5095 MI0018001 Homo sapiens miR-5095 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1273F MI0018002 Homo sapiens miR-1273f stem-loop A pre-miRNA processed from the primary transcript of human gene MIR1273G MI0018003 Homo sapiens miR-1273g stem-loop A pre-miRNA processed from the primary transcript of human gene MIR5096 MI0018004 Homo sapiens miR-5096 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR466 MI0018032 Mus musculus miR-466q stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0018165 Homo sapiens miR-5186 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0018166 Homo sapiens miR-5187 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0018167 Homo sapiens miR-5188 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0018168 Homo sapiens miR-5189 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0018169 Homo sapiens miR-5190 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0018170 Homo sapiens miR-5191 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0018171 Homo sapiens miR-5192 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0018172 Homo sapiens miR-5193 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0018173 Homo sapiens miR-5194 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0018174 Homo sapiens miR-5195 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0018175 Homo sapiens miR-5196 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0018176 Homo sapiens miR-5197 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019110 Homo sapiens miR-4436b-2 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019111 Homo sapiens miR-4444-2 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019112 Homo sapiens miR-3670-2 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019113 Homo sapiens miR-3680-2 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019114 Homo sapiens miR-4524b stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019115 Homo sapiens miR-5571 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019116 Homo sapiens miR-5100 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019117 Homo sapiens miR-5572 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019130 Homo sapiens miR-548aq stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019131 Homo sapiens miR-548ar stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019132 Homo sapiens miR-548as stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019133 Homo sapiens miR-5579 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019134 Homo sapiens miR-664b stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019135 Homo sapiens miR-5580 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019136 Homo sapiens miR-5581 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019137 Homo sapiens miR-548at stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019138 Homo sapiens miR-5582 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019139 Homo sapiens miR-5583-1 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019140 Homo sapiens miR-5583-2 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019141 Homo sapiens miR-5584 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019142 Homo sapiens miR-5585 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019143 Homo sapiens miR-5586 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019144 Homo sapiens miR-5587 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019145 Homo sapiens miR-548au stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019146 Homo sapiens miR-1295b stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019147 Homo sapiens miR-5588 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019148 Homo sapiens miR-5589 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019149 Homo sapiens miR-4536-2 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019150 Homo sapiens miR-5590 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019151 Homo sapiens miR-5591 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019152 Homo sapiens miR-548av stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR299 MI0019180 Mus musculus miR-299b stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR1231 MI0019183 Mus musculus miR-1231 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019280 Homo sapiens miR-5680 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019281 Homo sapiens miR-5681a stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019282 Homo sapiens miR-5682 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019283 Homo sapiens miR-548aw stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019284 Homo sapiens miR-5683 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019285 Homo sapiens miR-5684 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019286 Homo sapiens miR-548ax stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019287 Homo sapiens miR-5685 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019288 Homo sapiens miR-5692c-1 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019289 Homo sapiens miR-5692c-2 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019291 Homo sapiens miR-5687 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019292 Homo sapiens miR-5688 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019293 Homo sapiens miR-5681b stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019294 Homo sapiens miR-5689 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019295 Homo sapiens miR-5690 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019296 Homo sapiens miR-5691 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019297 Homo sapiens miR-5692a-1 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019298 Homo sapiens miR-5692a-2 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019299 Homo sapiens miR-4666b stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019300 Homo sapiens miR-5693 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019301 Homo sapiens miR-5694 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019302 Homo sapiens miR-5695 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019303 Homo sapiens miR-5696 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019304 Homo sapiens miR-5697 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019305 Homo sapiens miR-5698 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019306 Homo sapiens miR-5699 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019307 Homo sapiens miR-5700 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019308 Homo sapiens miR-5701-1 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019309 Homo sapiens miR-5702 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019310 Homo sapiens miR-5703 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019311 Homo sapiens miR-5692b stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019312 Homo sapiens miR-5704 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019313 Homo sapiens miR-5705 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019314 Homo sapiens miR-5706 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019315 Homo sapiens miR-5707 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019316 Homo sapiens miR-5708 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019412 Homo sapiens miR-5739 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR132 MI0019581 Danio rerio miR-132-3 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR137 MI0019582 Danio rerio miR-137-3 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR187 MI0019583 Danio rerio miR-187-2 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR27B MI0019589 Danio rerio miR-27c-2 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR23B MI0019591 Danio rerio miR-23a-4 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR24-2 MI0019592 Danio rerio miR-24-5 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019593 Homo sapiens miR-5701-2 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0019797 Homo sapiens miR-5787 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0020340 Homo sapiens miR-1199 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene NIL MI0020342 Canis familiaris miR-1199 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene NIL MI0020343 Rattus norvegicus miR-1199 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0020345 Homo sapiens miR-6068 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0020346 Homo sapiens miR-6069 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0020347 Homo sapiens miR-6070 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0020348 Homo sapiens miR-6071 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0020349 Homo sapiens miR-6072 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0020350 Homo sapiens miR-6073 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0020351 Homo sapiens miR-6074 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0020352 Homo sapiens miR-6075 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0020353 Homo sapiens miR-6076 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0020354 Homo sapiens miR-6077 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0020355 Homo sapiens miR-6078 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0020356 Homo sapiens miR-6079 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0020357 Homo sapiens miR-6080 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0020358 Homo sapiens miR-6081 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0020359 Homo sapiens miR-6082 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0020360 Homo sapiens miR-6083 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0020361 Homo sapiens miR-6084 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0020362 Homo sapiens miR-6085 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0020363 Homo sapiens miR-6086 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0020364 Homo sapiens miR-6087 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0020365 Homo sapiens miR-6088 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0020366 Homo sapiens miR-6089-1 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0020367 Homo sapiens miR-6090 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0021258 Homo sapiens miR-6124 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0021259 Homo sapiens miR-6125 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0021260 Homo sapiens miR-6126 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0021271 Homo sapiens miR-6127 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0021272 Homo sapiens miR-6128 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0021273 Homo sapiens miR-378j stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0021274 Homo sapiens miR-6129 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0021275 Homo sapiens miR-6130 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0021276 Homo sapiens miR-6131 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0021277 Homo sapiens miR-6132 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0021278 Homo sapiens miR-6133 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0021279 Homo sapiens miR-6134 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0021472 Homo sapiens miR-6165 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR514B MI0021536 Rattus norvegicus miR-509 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR1306 MI0021537 Rattus norvegicus miR-1306 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR1298 MI0021845 Rattus norvegicus miR-1298 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR873 MI0021959 Mus musculus miR-873b stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR451B MI0021960 Mus musculus miR-451b stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022209 Homo sapiens miR-6499 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022210 Homo sapiens miR-548ay stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022211 Homo sapiens miR-6500 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022212 Homo sapiens miR-548az stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022213 Homo sapiens miR-6501 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022214 Homo sapiens miR-6502 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022215 Homo sapiens miR-6503 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022216 Homo sapiens miR-6504 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022217 Homo sapiens miR-6505 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022218 Homo sapiens miR-6506 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022219 Homo sapiens miR-6507 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022220 Homo sapiens miR-6508 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022221 Homo sapiens miR-6509 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022222 Homo sapiens miR-6510 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022223 Homo sapiens miR-6511-1 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022224 Homo sapiens miR-6512 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022225 Homo sapiens miR-6513 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022226 Homo sapiens miR-6514 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022227 Homo sapiens miR-6515 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene NIL MI0022266 Mus musculus miR-6516 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR124-3 MI0022364 Gallus gallus miR-124c stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR3607 MI0022368 Gallus gallus miR-3607 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR222 MI0022373 Gallus gallus miR-222b stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR3064 MI0022380 Gallus gallus miR-3064 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene NIL MI0022520 Gallus gallus miR-6516 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022548 Homo sapiens miR-6715a stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022549 Homo sapiens miR-6715b stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022550 Homo sapiens miR-6716 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022551 Homo sapiens miR-6717 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022552 Homo sapiens miR-6511b-1 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022553 Homo sapiens miR-6718 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022554 Homo sapiens miR-6719 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022555 Homo sapiens miR-6720 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022556 Homo sapiens miR-6721 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022557 Homo sapiens miR-6722 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022558 Homo sapiens miR-6723 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022559 Homo sapiens miR-6724-1 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022560 Homo sapiens miR-892c stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022571 Homo sapiens miR-6726 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022572 Homo sapiens miR-6727 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022573 Homo sapiens miR-6728 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022574 Homo sapiens miR-6729 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022575 Homo sapiens miR-6730 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022576 Homo sapiens miR-6731 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022577 Homo sapiens miR-6732 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022578 Homo sapiens miR-6733 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022579 Homo sapiens miR-6734 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022580 Homo sapiens miR-6735 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022581 Homo sapiens miR-6736 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022582 Homo sapiens miR-6737 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022583 Homo sapiens miR-6738 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022584 Homo sapiens miR-6739 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022585 Homo sapiens miR-6740 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022586 Homo sapiens miR-6741 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022587 Homo sapiens miR-6742 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022588 Homo sapiens miR-6743 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022589 Homo sapiens miR-6744 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022590 Homo sapiens miR-6745 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022591 Homo sapiens miR-6746 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022592 Homo sapiens miR-6747 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022593 Homo sapiens miR-6748 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022594 Homo sapiens miR-6749 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022595 Homo sapiens miR-6750 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022596 Homo sapiens miR-6751 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022597 Homo sapiens miR-6752 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022598 Homo sapiens miR-6753 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022599 Homo sapiens miR-6754 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022600 Homo sapiens miR-6755 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022601 Homo sapiens miR-6756 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022602 Homo sapiens miR-6757 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022603 Homo sapiens miR-6758 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022604 Homo sapiens miR-6759 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022605 Homo sapiens miR-6760 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022606 Homo sapiens miR-6761 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022607 Homo sapiens miR-6762 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022608 Homo sapiens miR-6763 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022609 Homo sapiens miR-6764 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022610 Homo sapiens miR-6765 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022611 Homo sapiens miR-6766 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022612 Homo sapiens miR-6767 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022613 Homo sapiens miR-6768 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022614 Homo sapiens miR-6769a stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022615 Homo sapiens miR-6770-1 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022616 Homo sapiens miR-6771 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022617 Homo sapiens miR-6772 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022618 Homo sapiens miR-6773 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022619 Homo sapiens miR-6774 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022620 Homo sapiens miR-6775 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022621 Homo sapiens miR-6776 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022622 Homo sapiens miR-6777 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022623 Homo sapiens miR-6778 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022624 Homo sapiens miR-6779 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022625 Homo sapiens miR-6780a stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022626 Homo sapiens miR-6781 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022627 Homo sapiens miR-6782 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022628 Homo sapiens miR-6783 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022629 Homo sapiens miR-6784 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022630 Homo sapiens miR-6785 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022631 Homo sapiens miR-6786 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022632 Homo sapiens miR-6787 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022633 Homo sapiens miR-6788 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022634 Homo sapiens miR-6789 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022635 Homo sapiens miR-6790 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022636 Homo sapiens miR-6791 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022637 Homo sapiens miR-6792 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022638 Homo sapiens miR-6793 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022639 Homo sapiens miR-6794 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022640 Homo sapiens miR-6795 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022641 Homo sapiens miR-6796 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022642 Homo sapiens miR-6797 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022643 Homo sapiens miR-6798 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022644 Homo sapiens miR-6799 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022645 Homo sapiens miR-6800 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022646 Homo sapiens miR-6801 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022647 Homo sapiens miR-6802 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022648 Homo sapiens miR-6803 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022649 Homo sapiens miR-6804 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022650 Homo sapiens miR-6805 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022651 Homo sapiens miR-6806 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022652 Homo sapiens miR-6807 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022653 Homo sapiens miR-6808 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022654 Homo sapiens miR-6809 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022655 Homo sapiens miR-6810 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022656 Homo sapiens miR-6811 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022657 Homo sapiens miR-6812 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022658 Homo sapiens miR-6813 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022659 Homo sapiens miR-6814 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022660 Homo sapiens miR-6815 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022661 Homo sapiens miR-6816 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022662 Homo sapiens miR-6817 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022663 Homo sapiens miR-6818 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022664 Homo sapiens miR-6819 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022665 Homo sapiens miR-6820 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022666 Homo sapiens miR-6821 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022667 Homo sapiens miR-6822 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022668 Homo sapiens miR-6823 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022669 Homo sapiens miR-6824 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022670 Homo sapiens miR-6825 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022671 Homo sapiens miR-6826 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022672 Homo sapiens miR-6827 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022673 Homo sapiens miR-6828 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022674 Homo sapiens miR-6829 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022675 Homo sapiens miR-6830 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022676 Homo sapiens miR-6831 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022677 Homo sapiens miR-6832 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022678 Homo sapiens miR-6833 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022679 Homo sapiens miR-6834 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022680 Homo sapiens miR-6835 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022681 Homo sapiens miR-6780b stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022682 Homo sapiens miR-6836 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022683 Homo sapiens miR-6837 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022684 Homo sapiens miR-6838 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022685 Homo sapiens miR-6839 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022686 Homo sapiens miR-6840 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022687 Homo sapiens miR-6841 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022688 Homo sapiens miR-6842 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022689 Homo sapiens miR-6843 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022690 Homo sapiens miR-6844 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022691 Homo sapiens miR-6845 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022692 Homo sapiens miR-6846 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022693 Homo sapiens miR-6847 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022694 Homo sapiens miR-6848 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022695 Homo sapiens miR-6849 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022696 Homo sapiens miR-6850 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022697 Homo sapiens miR-6851 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022698 Homo sapiens miR-6852 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022699 Homo sapiens miR-6853 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022700 Homo sapiens miR-6854 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022701 Homo sapiens miR-6855 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022702 Homo sapiens miR-6856 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022703 Homo sapiens miR-6857 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022704 Homo sapiens miR-6858 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022705 Homo sapiens miR-6859-1 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022706 Homo sapiens miR-6769b stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022707 Homo sapiens miR-6860 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022708 Homo sapiens miR-6861 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022709 Homo sapiens miR-6862-1 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022710 Homo sapiens miR-6863 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022711 Homo sapiens miR-6864 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022712 Homo sapiens miR-6865 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022713 Homo sapiens miR-6866 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022714 Homo sapiens miR-6867 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022715 Homo sapiens miR-6868 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022716 Homo sapiens miR-6869 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022717 Homo sapiens miR-6870 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022718 Homo sapiens miR-6871 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022719 Homo sapiens miR-6872 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022720 Homo sapiens miR-6873 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022721 Homo sapiens miR-6874 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022722 Homo sapiens miR-6875 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022723 Homo sapiens miR-6876 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022724 Homo sapiens miR-6877 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022725 Homo sapiens miR-6878 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022726 Homo sapiens miR-6879 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022727 Homo sapiens miR-6880 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022728 Homo sapiens miR-6881 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022729 Homo sapiens miR-6882 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022730 Homo sapiens miR-6883 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022731 Homo sapiens miR-6884 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022732 Homo sapiens miR-6885 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022733 Homo sapiens miR-6886 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022734 Homo sapiens miR-6887 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022735 Homo sapiens miR-6888 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022736 Homo sapiens miR-6889 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022737 Homo sapiens miR-6890 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022738 Homo sapiens miR-6891 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022739 Homo sapiens miR-6892 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022740 Homo sapiens miR-6893 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022741 Homo sapiens miR-6894 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022742 Homo sapiens miR-6895 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022957 Homo sapiens miR-7106 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022958 Homo sapiens miR-7107 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022959 Homo sapiens miR-7108 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022960 Homo sapiens miR-7109 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022961 Homo sapiens miR-7110 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022962 Homo sapiens miR-7111 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022963 Homo sapiens miR-7112 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022964 Homo sapiens miR-7113 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0022965 Homo sapiens miR-7114 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0023431 Homo sapiens miR-6511b-2 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR196B MI0023559 Gallus gallus miR-196-4 stem-loop A pre-miRNA processed from the primary transcript of a Gallus gallus ortholog of human gene MIR196B MI0023560 Gallus gallus miR-196-5 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3690 MI0023561 Homo sapiens miR-3690-2 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0023563 Homo sapiens miR-6089-2 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0023564 Homo sapiens miR-6511a-2 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0023565 Homo sapiens miR-6511a-3 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0023566 Homo sapiens miR-6511a-4 stem-loop A pre-miRNA processed from the primary transcript of a Danio rerio ortholog of human gene MIR1306 MI0023609 Danio rerio miR-1306 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0023610 Homo sapiens miR-7150 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0023611 Homo sapiens miR-7151 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0023612 Homo sapiens miR-7152 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0023613 Homo sapiens miR-7153 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0023614 Homo sapiens miR-7154 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0023615 Homo sapiens miR-7155 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0023616 Homo sapiens miR-7156 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0023617 Homo sapiens miR-7157 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0023618 Homo sapiens miR-7158 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0023619 Homo sapiens miR-7161 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0023620 Homo sapiens miR-7159 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0023621 Homo sapiens miR-7160 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0023622 Homo sapiens miR-486-2 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0023623 Homo sapiens miR-7162 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0024354 Homo sapiens miR-7515 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0024975 Homo sapiens miR-7641-1 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0024976 Homo sapiens miR-7641-2 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene NIL MI0024990 Mus musculus miR-219b stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR129-2 MI0025019 Mus musculus miR-129b stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene NIL MI0025026 Mus musculus miR-6715 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR126 MI0025035 Mus musculus miR-126b stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025238 Homo sapiens miR-7702 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025239 Homo sapiens miR-7703 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025240 Homo sapiens miR-7704 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025241 Homo sapiens miR-7705 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025242 Homo sapiens miR-7706 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR155 MI0025509 Rattus norvegicus miR-155 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025510 Homo sapiens miR-7843 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025511 Homo sapiens miR-4433b stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025512 Homo sapiens miR-1273h stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025513 Homo sapiens miR-6516 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025514 Homo sapiens miR-7844 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025515 Homo sapiens miR-7845 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025516 Homo sapiens miR-7846 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025517 Homo sapiens miR-7847 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025518 Homo sapiens miR-7848 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025519 Homo sapiens miR-7849 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025520 Homo sapiens miR-7850 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025521 Homo sapiens miR-7851 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025522 Homo sapiens miR-7852 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025523 Homo sapiens miR-7853 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025524 Homo sapiens miR-7854 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025525 Homo sapiens miR-7855 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025526 Homo sapiens miR-7856 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025747 Homo sapiens miR-548ba stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025748 Homo sapiens miR-7973-1 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025749 Homo sapiens miR-7973-2 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025750 Homo sapiens miR-7974 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025751 Homo sapiens miR-7975 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025752 Homo sapiens miR-7976 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025753 Homo sapiens miR-7977 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025754 Homo sapiens miR-7978 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025888 Homo sapiens miR-8052 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025889 Homo sapiens miR-8053 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025890 Homo sapiens miR-8054 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025891 Homo sapiens miR-8055 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025892 Homo sapiens miR-8056 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025893 Homo sapiens miR-8057 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025894 Homo sapiens miR-8058 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025895 Homo sapiens miR-8059 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025896 Homo sapiens miR-8060 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025897 Homo sapiens miR-8061 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025898 Homo sapiens miR-8062 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025899 Homo sapiens miR-8063 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025900 Homo sapiens miR-8064 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025901 Homo sapiens miR-8065 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025902 Homo sapiens miR-8066 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025903 Homo sapiens miR-8067 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025904 Homo sapiens miR-8068 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025905 Homo sapiens miR-8069-1 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025906 Homo sapiens miR-8070 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025907 Homo sapiens miR-8071-1 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025908 Homo sapiens miR-8072 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025909 Homo sapiens miR-8073 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025910 Homo sapiens miR-8074 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025911 Homo sapiens miR-8075 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025912 Homo sapiens miR-8076 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025913 Homo sapiens miR-8077 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025914 Homo sapiens miR-8078 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025915 Homo sapiens miR-8079 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025916 Homo sapiens miR-8080 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025917 Homo sapiens miR-8081 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025918 Homo sapiens miR-8082 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025919 Homo sapiens miR-8083 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025920 Homo sapiens miR-8084 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025921 Homo sapiens miR-8085 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025922 Homo sapiens miR-8086 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025923 Homo sapiens miR-8087 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025924 Homo sapiens miR-8088 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0025925 Homo sapiens miR-8089 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR1291 MI0026023 Mus musculus miR-1291 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR142 MI0026028 Mus musculus miR-142b stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR497 MI0026030 Mus musculus miR-497b stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0026415 Homo sapiens miR-6862-2 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0026417 Homo sapiens miR-8071 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0026418 Homo sapiens miR-6770 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0026419 Homo sapiens miR-6770-3 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0026420 Homo sapiens miR-6859-2 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0026421 Homo sapiens miR-6859-3 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0027288 Homo sapiens miR-8485 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR1249 MI0027912 Canis familiaris miR-1249 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR1301 MI0027930 Canis familiaris miR-1301 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR1343 MI0027953 Canis familiaris miR-1343 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR323B MI0027980 Canis familiaris miR-1185 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR889 MI0027984 Canis familiaris miR-889 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR323B MI0027985 Canis familiaris miR-3958 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene NIL MI0027991 Canis familiaris miR-6516 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIRLET7I MI0027994 Canis familiaris let-7d stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR769 MI0027998 Canis familiaris miR-769 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR449C MI0028007 Canis familiaris miR-449b stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR1296 MI0028014 Canis familiaris miR-1296 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR514B MI0028017 Canis familiaris miR-507b stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR514B MI0028020 Canis familiaris miR-508a stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR514B MI0028024 Canis familiaris miR-506 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR1468 MI0028025 Canis familiaris miR-1468 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR514B MI0028027 Canis familiaris miR-508b stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR2114 MI0028029 Canis familiaris miR-2114 stem-loop A pre-miRNA processed from the primary transcript of a Canis lupus familiaris ortholog of human gene MIR514B MI0028035 Canis familiaris miR-507a stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0029185 Homo sapiens miR-9500 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0029321 Homo sapiens miR-548bb stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR3154 MI0030343 Mus musculus miR-3154 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR3618 MI0030345 Mus musculus miR-3618 stem-loop A pre-miRNA processed from the primary transcript of a Mus musculus ortholog of human gene MIR935 MI0030346 Mus musculus miR-935 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIRLET7I MI0030347 Rattus norvegicus let-7g stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR1247 MI0030348 Rattus norvegicus miR-1247 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR1297 MI0030349 Rattus norvegicus miR-1297 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR148B MI0030350 Rattus norvegicus miR-148a stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR149 MI0030351 Rattus norvegicus miR-149 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR195 MI0030352 Rattus norvegicus miR-15a stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR193B MI0030355 Rattus norvegicus miR-193b stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR3064 MI0030357 Rattus norvegicus miR-3064 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR450B MI0030362 Rattus norvegicus miR-450b-1 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR452 MI0030363 Rattus norvegicus miR-452 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR762 MI0030365 Rattus norvegicus miR-762 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0031510 Homo sapiens miR-3179-4 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0031511 Homo sapiens miR-1244-4 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0031512 Homo sapiens miR-3648-2 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3670 MI0031513 Homo sapiens miR-3670-3 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0031514 Homo sapiens miR-3670-4 stem-loop A pre-miRNA processed from the primary transcript of human gene MIR3687 MI0031515 Homo sapiens miR-3687-2 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0031516 Homo sapiens miR-6724-2 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0031517 Homo sapiens miR-6724-3 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0031518 Homo sapiens miR-6724-4 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0031519 Homo sapiens miR-8069-2 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0031520 Homo sapiens miR-941-5 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0031521 Homo sapiens miR-6859-4 stem-loop A pre-miRNA processed from the primary transcript of human gene NIL MI0031522 Homo sapiens miR-5701-3 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR190B MI0031759 Rattus norvegicus miR-190-2 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR196B miR-196b is predicted based on sequence homology to miR-196a [1]. Yekta et al. report that miR-196 miRNAs are expressed from HOX gene clusters in mammals, and that HOX genes in these clusters are targets of miR-196. Indeed, HOXB8 mRNA was shown to be a natural target for miR-196-directed cleavage through a perfectly complementary miR-target site. Other HOX genes have imperfect miR-196 complementary sites indicative of regulation by translational repression [1]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations. MI0031760 Rattus norvegicus miR-196b-2 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR29C The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations. MI0031761 Rattus norvegicus miR-29c-2 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR424 Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. The miR-322 locus has an orthologous sequence in human (MIR:MI0001446), which expresses an experimentally validated mature miRNA sequence from its 5' arm, named miR-424. The human mir-424 locus does not appear to contain a homolog of the miR-322 sequence. The mouse ortholog (MIR:MI0000590) appears able to express both miR-322 and miR-424. Both miR-322 and miR-424 have been experimentally verified in rat. Landgraf et al. show that the 5' product is the predominant one [3]. The 5' product is therefore renamed miR-322 and the 3' product renamed miR-322*. MI0031763 Rattus norvegicus miR-322-2 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR340 MI0031764 Rattus norvegicus miR-340-2 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR450B MI0031772 Rattus norvegicus miR-450b-2 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR503 The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations. MI0031773 Rattus norvegicus miR-503-2 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR598 MI0031774 Rattus norvegicus miR-598-2 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR29C MI0031777 Rattus norvegicus miR-29b-3 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR466 MI0031779 Rattus norvegicus miR-466b-3 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR466 MI0031780 Rattus norvegicus miR-466b-4 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR542 MI0031781 Rattus norvegicus miR-542-2 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR542 MI0031782 Rattus norvegicus miR-542-3 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR1-1 MI0031785 Rattus norvegicus miR-1b stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene MIR676 MI0031786 Rattus norvegicus miR-676 stem-loop A pre-miRNA processed from the primary transcript of a Rattus norvegicus ortholog of human gene NIL MI0031787 Rattus norvegicus miR-486 stem-loop A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_6239), with sequence ugagguaguagguuguauaguu MIMAT0000001 cel-let-7-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_6239), with sequence uggaauguaaagaaguaugua MIMAT0000003 cel-miR-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_6239), with sequence aggcagugugguuagcugguug MIMAT0000005 cel-miR-34-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_6239), with sequence auaaagcuagguuaccaaagcu MIMAT0000051 cel-miR-79-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugagguaguagguuguauaguu MIMAT0000062 hsa-let-7a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugagguaguagguugugugguu MIMAT0000063 hsa-let-7b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugagguaguagguuguaugguu MIMAT0000064 hsa-let-7c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agagguaguagguugcauaguu MIMAT0000065 hsa-let-7d-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugagguaggagguuguauaguu MIMAT0000066 hsa-let-7e-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugagguaguagauuguauaguu MIMAT0000067 hsa-let-7f-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uagcagcacauaaugguuugug MIMAT0000068 hsa-miR-15a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uagcagcacguaaauauuggcg MIMAT0000069 hsa-miR-16-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caaagugcuuacagugcagguag MIMAT0000070 hsa-miR-17-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acugcagugaaggcacuuguag MIMAT0000071 hsa-miR-17-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaaggugcaucuagugcagauag MIMAT0000072 hsa-miR-18a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugugcaaaucuaugcaaaacuga MIMAT0000073 hsa-miR-19a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugugcaaauccaugcaaaacuga MIMAT0000074 hsa-miR-19b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaaagugcuuauagugcagguag MIMAT0000075 hsa-miR-20a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uagcuuaucagacugauguuga MIMAT0000076 hsa-miR-21-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aagcugccaguugaagaacugu MIMAT0000077 hsa-miR-22-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aucacauugccagggauuucc MIMAT0000078 hsa-miR-23a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugccuacugagcugauaucagu MIMAT0000079 hsa-miR-24-1-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggcucaguucagcaggaacag MIMAT0000080 hsa-miR-24-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cauugcacuugucucggucuga MIMAT0000081 hsa-miR-25-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uucaaguaauccaggauaggcu MIMAT0000082 hsa-miR-26a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uucaaguaauucaggauaggu MIMAT0000083 hsa-miR-26b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uucacaguggcuaaguuccgc MIMAT0000084 hsa-miR-27a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaggagcucacagucuauugag MIMAT0000085 hsa-miR-28-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uagcaccaucugaaaucgguua MIMAT0000086 hsa-miR-29a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uguaaacauccucgacuggaag MIMAT0000087 hsa-miR-30a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuuucagucggauguuugcagc MIMAT0000088 hsa-miR-30a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggcaagaugcuggcauagcu MIMAT0000089 hsa-miR-31-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uauugcacauuacuaaguugca MIMAT0000090 hsa-miR-32-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gugcauuguaguugcauugca MIMAT0000091 hsa-miR-33a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uauugcacuugucccggccugu MIMAT0000092 hsa-miR-92a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caaagugcuguucgugcagguag MIMAT0000093 hsa-miR-93-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uucaacggguauuuauugagca MIMAT0000094 hsa-miR-95-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuuggcacuagcacauuuuugcu MIMAT0000095 hsa-miR-96-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugagguaguaaguuguauuguu MIMAT0000096 hsa-miR-98-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aacccguagauccgaucuugug MIMAT0000097 hsa-miR-99a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aacccguagauccgaacuugug MIMAT0000098 hsa-miR-100-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uacaguacugugauaacugaa MIMAT0000099 hsa-miR-101-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uagcaccauuugaaaucaguguu MIMAT0000100 hsa-miR-29b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agcagcauuguacagggcuauga MIMAT0000101 hsa-miR-103a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucaaaugcucagacuccuguggu MIMAT0000102 hsa-miR-105-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaagugcuuacagugcagguag MIMAT0000103 hsa-miR-106a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agcagcauuguacagggcuauca MIMAT0000104 hsa-miR-107 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugagguaguaguuuguacaguu MIMAT0000121 mmu-let-7g-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugagguaguaguuugugcuguu MIMAT0000122 mmu-let-7i-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uggaauguaaagaaguauguau MIMAT0000123 mmu-miR-1a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uagcagcacaucaugguuuaca MIMAT0000124 mmu-miR-15b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aucacauugccagggauuacc MIMAT0000125 mmu-miR-23b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uucacaguggcuaaguucugc MIMAT0000126 mmu-miR-27b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uagcaccauuugaaaucaguguu MIMAT0000127 mmu-miR-29b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uguaaacauccucgacuggaag MIMAT0000128 mmu-miR-30a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cuuucagucggauguuugcagc MIMAT0000129 mmu-miR-30a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uguaaacauccuacacucagcu MIMAT0000130 mmu-miR-30b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aacccguagauccgaucuugug MIMAT0000131 mmu-miR-99a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cacccguagaaccgaccuugcg MIMAT0000132 mmu-miR-99b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uacaguacugugauaacugaa MIMAT0000133 mmu-miR-101a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uaaggcacgcggugaaugcc MIMAT0000134 mmu-miR-124-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ucccugagacccuuuaaccuguga MIMAT0000135 mmu-miR-125a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ucccugagacccuaacuuguga MIMAT0000136 mmu-miR-125b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cauuauuacuuuugguacgcg MIMAT0000137 mmu-miR-126a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ucguaccgugaguaauaaugcg MIMAT0000138 mmu-miR-126a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ucggauccgucugagcuuggcu MIMAT0000139 mmu-miR-127-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ucacagugaaccggucucuuu MIMAT0000140 mmu-miR-128-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cagugcaauguuaaaagggcau MIMAT0000141 mmu-miR-130a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ucuuugguuaucuagcuguauga MIMAT0000142 mmu-miR-9-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence auaaagcuagauaaccgaaagu MIMAT0000143 mmu-miR-9-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uaacagucuacagccauggucg MIMAT0000144 mmu-miR-132-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uuugguccccuucaaccagcug MIMAT0000145 mmu-miR-133a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugugacugguugaccagagggg MIMAT0000146 mmu-miR-134-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uauggcuuuuuauuccuauguga MIMAT0000147 mmu-miR-135a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence acuccauuuguuuugaugaugg MIMAT0000148 mmu-miR-136-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uuauugcuuaagaauacgcguag MIMAT0000149 mmu-miR-137-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence agcugguguugugaaucaggccg MIMAT0000150 mmu-miR-138-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cagugguuuuacccuaugguag MIMAT0000151 mmu-miR-140-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uaccacaggguagaaccacgg MIMAT0000152 mmu-miR-140-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uaacacugucugguaaagaugg MIMAT0000153 mmu-miR-141-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cauaaaguagaaagcacuacu MIMAT0000154 mmu-miR-142a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uguaguguuuccuacuuuaugga MIMAT0000155 mmu-miR-142a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uacaguauagaugauguacu MIMAT0000156 mmu-miR-144-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence guccaguuuucccaggaaucccu MIMAT0000157 mmu-miR-145a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugagaacugaauuccauggguu MIMAT0000158 mmu-miR-146a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ucuggcuccgugucuucacuccc MIMAT0000159 mmu-miR-149-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ucucccaacccuuguaccagug MIMAT0000160 mmu-miR-150-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cuagacugaggcuccuugagg MIMAT0000161 mmu-miR-151-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ucagugcaugacagaacuugg MIMAT0000162 mmu-miR-152-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uugcauagucacaaaagugauc MIMAT0000163 mmu-miR-153-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uagguuauccguguugccuucg MIMAT0000164 mmu-miR-154-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uuaaugcuaauugugauaggggu MIMAT0000165 mmu-miR-155-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uacccuguagaaccgaauuugug MIMAT0000208 mmu-miR-10b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cuuuuugcggucugggcuugc MIMAT0000209 mmu-miR-129-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aacauucaacgcugucggugagu MIMAT0000210 mmu-miR-181a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uuuggcaaugguagaacucacaccg MIMAT0000211 mmu-miR-182-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uauggcacugguagaauucacu MIMAT0000212 mmu-miR-183-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uggacggagaacugauaagggu MIMAT0000213 mmu-miR-184-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uggagagaaaggcaguuccuga MIMAT0000214 mmu-miR-185-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence caaagaauucuccuuuugggcu MIMAT0000215 mmu-miR-186-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ucgugucuuguguugcagccgg MIMAT0000216 mmu-miR-187-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence caucccuugcaugguggaggg MIMAT0000217 mmu-miR-188-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gugccuacugagcugauaucagu MIMAT0000218 mmu-miR-24-1-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uggcucaguucagcaggaacag MIMAT0000219 mmu-miR-24-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugauauguuugauauauuaggu MIMAT0000220 mmu-miR-190a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence caacggaaucccaaaagcagcug MIMAT0000221 mmu-miR-191-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cugaccuaugaauugacagcc MIMAT0000222 hsa-miR-192-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aacuggccuacaaagucccagu MIMAT0000223 mmu-miR-193a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uguaacagcaacuccaugugga MIMAT0000224 mmu-miR-194-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uagcagcacagaaauauuggc MIMAT0000225 mmu-miR-195a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uagguaguuucauguuguuggg MIMAT0000226 hsa-miR-196a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uucaccaccuucuccacccagc MIMAT0000227 hsa-miR-197-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gguccagaggggagauagguuc MIMAT0000228 hsa-miR-198 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cccaguguucagacuaccuguuc MIMAT0000229 mmu-miR-199a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence acaguagucugcacauugguua MIMAT0000230 mmu-miR-199a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cccaguguucagacuaccuguuc MIMAT0000231 hsa-miR-199a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acaguagucugcacauugguua MIMAT0000232 hsa-miR-199a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uaauacugccugguaaugauga MIMAT0000233 mmu-miR-200b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uacucaguaaggcauuguucuu MIMAT0000234 mmu-miR-201-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence agagguauagcgcaugggaaga MIMAT0000235 mmu-miR-202-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gugaaauguuuaggaccacuag MIMAT0000236 mmu-miR-203-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uucccuuugucauccuaugccu MIMAT0000237 mmu-miR-204-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uccuucauuccaccggagucug MIMAT0000238 mmu-miR-205-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uggaauguaaggaagugugugg MIMAT0000239 mmu-miR-206-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auaagacgagcaaaaagcuugu MIMAT0000241 hsa-miR-208a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuuuuugcggucugggcuugc MIMAT0000242 hsa-miR-129-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucagugcacuacagaacuuugu MIMAT0000243 hsa-miR-148a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uguaaacauccuacacucucagc MIMAT0000244 hsa-miR-30c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uguaaacauccccgacuggaag MIMAT0000245 hsa-miR-30d-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uggagugugacaaugguguuug MIMAT0000246 mmu-miR-122-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugagaugaagcacuguagcuc MIMAT0000247 mmu-miR-143-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uguaaacauccuugacuggaag MIMAT0000248 mmu-miR-30e-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cuuucagucggauguuuacagc MIMAT0000249 mmu-miR-30e-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucuacagugcacgugucuccagu MIMAT0000250 hsa-miR-139-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence guguguggaaaugcuucugc MIMAT0000251 hsa-miR-147a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggaagacuagugauuuuguugu MIMAT0000252 hsa-miR-7-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uacccuguagauccgaauuugug MIMAT0000253 hsa-miR-10a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uacccuguagaaccgaauuugug MIMAT0000254 hsa-miR-10b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggcagugucuuagcugguugu MIMAT0000255 hsa-miR-34a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aacauucaacgcugucggugagu MIMAT0000256 hsa-miR-181a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aacauucauugcugucggugggu MIMAT0000257 hsa-miR-181b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aacauucaaccugucggugagu MIMAT0000258 hsa-miR-181c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuuggcaaugguagaacucacacu MIMAT0000259 hsa-miR-182-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugguucuagacuugccaacua MIMAT0000260 hsa-miR-182-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uauggcacugguagaauucacu MIMAT0000261 hsa-miR-183-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucgugucuuguguugcagccgg MIMAT0000262 hsa-miR-187-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cccaguguuuagacuaucuguuc MIMAT0000263 hsa-miR-199b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gugaaauguuuaggaccacuag MIMAT0000264 hsa-miR-203a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uucccuuugucauccuaugccu MIMAT0000265 hsa-miR-204-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uccuucauuccaccggagucug MIMAT0000266 hsa-miR-205-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cugugcgugugacagcggcuga MIMAT0000267 hsa-miR-210-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uucccuuugucauccuucgccu MIMAT0000268 hsa-miR-211-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaacagucuccagucacggcc MIMAT0000269 hsa-miR-212-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence accaucgaccguugauuguacc MIMAT0000270 hsa-miR-181a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acagcaggcacagacaggcagu MIMAT0000271 hsa-miR-214-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence augaccuaugaauugacagac MIMAT0000272 hsa-miR-215-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaaucucagcuggcaacuguga MIMAT0000273 hsa-miR-216a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uacugcaucaggaacugauugga MIMAT0000274 hsa-miR-217 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uugugcuugaucuaaccaugu MIMAT0000275 hsa-miR-218-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugauuguccaaacgcaauucu MIMAT0000276 hsa-miR-219a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agcuacauugucugcuggguuuc MIMAT0000278 hsa-miR-221-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agcuacaucuggcuacugggu MIMAT0000279 hsa-miR-222-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugucaguuugucaaauacccca MIMAT0000280 hsa-miR-223-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caagucacuagugguuccguu MIMAT0000281 hsa-miR-224-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_6239), with sequence uaaggcacgcggugaaugcca MIMAT0000282 cel-miR-124-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaauacugccugguaaugauga MIMAT0000318 hsa-miR-200b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence acucaaacuaugggggcacuuu MIMAT0000366 mmu-miR-290a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence caucaaaguggaggcccucucu MIMAT0000367 mmu-miR-291a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aaagugcuuccacuuugugugc MIMAT0000368 mmu-miR-291a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence acucaaacugggggcucuuuug MIMAT0000369 mmu-miR-292a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aaagugccgccagguuuugagugu MIMAT0000370 mmu-miR-292a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence agugccgcagaguuuguagugu MIMAT0000371 mmu-miR-293-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aaagugcuucccuuuugugugu MIMAT0000372 mmu-miR-294-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aaagugcuacuacuuuugagucu MIMAT0000373 mmu-miR-295-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence agggcccccccucaauccugu MIMAT0000374 mmu-miR-296-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence auguaugugugcaugugcaugu MIMAT0000375 mmu-miR-297a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ggcagaggagggcuguucuuccc MIMAT0000376 mmu-miR-298-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugguuuaccgucccacauacau MIMAT0000377 mmu-miR-299a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uaugcaagggcaagcucucuuc MIMAT0000378 mmu-miR-300-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cagugcaauaguauugucaaagc MIMAT0000379 mmu-miR-301a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uaagugcuuccauguuuugguga MIMAT0000380 mmu-miR-302a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aggcaguguaguuagcugauugc MIMAT0000381 mmu-miR-34c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aggcaguguaauuagcugauugu MIMAT0000382 mmu-miR-34b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence agagguaguagguugcauaguu MIMAT0000383 mmu-let-7d-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cuauacgaccugcugccuuucu MIMAT0000384 mmu-let-7d-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence caaagugcuaacagugcagguag MIMAT0000385 mmu-miR-106a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uaaagugcugacagugcagau MIMAT0000386 mmu-miR-106b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cagugcaaugaugaaagggcau MIMAT0000387 mmu-miR-130b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugagguaguaguuuguacaguu MIMAT0000414 hsa-let-7g-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugagguaguaguuugugcuguu MIMAT0000415 hsa-let-7i-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggaauguaaagaaguauguau MIMAT0000416 hsa-miR-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uagcagcacaucaugguuuaca MIMAT0000417 hsa-miR-15b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aucacauugccagggauuacc MIMAT0000418 hsa-miR-23b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uucacaguggcuaaguucugc MIMAT0000419 hsa-miR-27b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uguaaacauccuacacucagcu MIMAT0000420 hsa-miR-30b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggagugugacaaugguguuug MIMAT0000421 hsa-miR-122-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaaggcacgcggugaaugcc MIMAT0000422 hsa-miR-124-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucccugagacccuaacuuguga MIMAT0000423 hsa-miR-125b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucacagugaaccggucucuuu MIMAT0000424 hsa-miR-128-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cagugcaauguuaaaagggcau MIMAT0000425 hsa-miR-130a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaacagucuacagccauggucg MIMAT0000426 hsa-miR-132-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuugguccccuucaaccagcug MIMAT0000427 hsa-miR-133a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uauggcuuuuuauuccuauguga MIMAT0000428 hsa-miR-135a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuauugcuuaagaauacgcguag MIMAT0000429 hsa-miR-137 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agcugguguugugaaucaggccg MIMAT0000430 hsa-miR-138-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cagugguuuuacccuaugguag MIMAT0000431 hsa-miR-140-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaacacugucugguaaagaugg MIMAT0000432 hsa-miR-141-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cauaaaguagaaagcacuacu MIMAT0000433 hsa-miR-142-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uguaguguuuccuacuuuaugga MIMAT0000434 hsa-miR-142-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugagaugaagcacuguagcuc MIMAT0000435 hsa-miR-143-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uacaguauagaugauguacu MIMAT0000436 hsa-miR-144-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence guccaguuuucccaggaaucccu MIMAT0000437 hsa-miR-145-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucagugcaugacagaacuugg MIMAT0000438 hsa-miR-152-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uugcauagucacaaaagugauc MIMAT0000439 hsa-miR-153-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caacggaaucccaaaagcagcug MIMAT0000440 hsa-miR-191-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucuuugguuaucuagcuguauga MIMAT0000441 hsa-miR-9-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auaaagcuagauaaccgaaagu MIMAT0000442 hsa-miR-9-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucccugagacccuuuaaccuguga MIMAT0000443 hsa-miR-125a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cauuauuacuuuugguacgcg MIMAT0000444 hsa-miR-126-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucguaccgugaguaauaaugcg MIMAT0000445 hsa-miR-126-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucggauccgucugagcuuggcu MIMAT0000446 hsa-miR-127-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugugacugguugaccagagggg MIMAT0000447 hsa-miR-134-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acuccauuuguuuugaugaugga MIMAT0000448 hsa-miR-136-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugagaacugaauuccauggguu MIMAT0000449 hsa-miR-146a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucuggcuccgugucuucacuccc MIMAT0000450 hsa-miR-149-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucucccaacccuuguaccagug MIMAT0000451 hsa-miR-150-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uagguuauccguguugccuucg MIMAT0000452 hsa-miR-154-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaucauacacgguugaccuauu MIMAT0000453 hsa-miR-154-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggacggagaacugauaagggu MIMAT0000454 hsa-miR-184 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggagagaaaggcaguuccuga MIMAT0000455 hsa-miR-185-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caaagaauucuccuuuugggcu MIMAT0000456 hsa-miR-186-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caucccuugcaugguggaggg MIMAT0000457 hsa-miR-188-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugauauguuugauauauuaggu MIMAT0000458 hsa-miR-190a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aacuggccuacaaagucccagu MIMAT0000459 hsa-miR-193a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uguaacagcaacuccaugugga MIMAT0000460 hsa-miR-194-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uagcagcacagaaauauuggc MIMAT0000461 hsa-miR-195-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggaauguaaggaagugugugg MIMAT0000462 hsa-miR-206 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaagcuggguugagagggcga MIMAT0000510 hsa-miR-320a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugugcaaauccaugcaaaacuga MIMAT0000513 mmu-miR-19b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uguaaacauccuacacucucagc MIMAT0000514 mmu-miR-30c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uguaaacauccccgacuggaag MIMAT0000515 mmu-miR-30d-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ucagugcacuacagaacuuugu MIMAT0000516 mmu-miR-148a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cugaccuaugaauugacagcc MIMAT0000517 mmu-miR-192-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uagguaguuucauguuguuggg MIMAT0000518 mmu-miR-196a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uaacacugucugguaacgaugu MIMAT0000519 mmu-miR-200a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence auaagacgagcaaaaagcuugu MIMAT0000520 mmu-miR-208a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugagguaguagguuguauaguu MIMAT0000521 mmu-let-7a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugagguaguagguugugugguu MIMAT0000522 mmu-let-7b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugagguaguagguuguaugguu MIMAT0000523 mmu-let-7c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugagguaggagguuguauaguu MIMAT0000524 mmu-let-7e-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugagguaguagauuguauaguu MIMAT0000525 mmu-let-7f-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uagcagcacauaaugguuugug MIMAT0000526 mmu-miR-15a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uagcagcacguaaauauuggcg MIMAT0000527 mmu-miR-16-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uaaggugcaucuagugcagauag MIMAT0000528 mmu-miR-18a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uaaagugcuuauagugcagguag MIMAT0000529 mmu-miR-20a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uagcuuaucagacugauguuga MIMAT0000530 mmu-miR-21a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aagcugccaguugaagaacugu MIMAT0000531 mmu-miR-22-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aucacauugccagggauuucc MIMAT0000532 mmu-miR-23a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uucaaguaauccaggauaggcu MIMAT0000533 mmu-miR-26a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uucaaguaauucaggauaggu MIMAT0000534 mmu-miR-26b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uagcaccaucugaaaucgguua MIMAT0000535 mmu-miR-29a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uagcaccauuugaaaucgguua MIMAT0000536 mmu-miR-29c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uucacaguggcuaaguuccgc MIMAT0000537 mmu-miR-27a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aggcaagaugcuggcauagcug MIMAT0000538 mmu-miR-31-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uauugcacuugucccggccug MIMAT0000539 mmu-miR-92a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence caaagugcuguucgugcagguag MIMAT0000540 mmu-miR-93-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uuuggcacuagcacauuuuugcu MIMAT0000541 mmu-miR-96-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uggcagugucuuagcugguugu MIMAT0000542 mmu-miR-34a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aagcccuuaccccaaaaagcau MIMAT0000544 mmu-miR-129-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugagguaguaaguuguauuguu MIMAT0000545 mmu-miR-98-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence agcagcauuguacagggcuauga MIMAT0000546 mmu-miR-103-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aaacaugaagcgcugcaaca MIMAT0000547 rno-miR-322-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cagcagcaauucauguuuugga MIMAT0000548 mmu-miR-322-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aaacaugaagcgcugcaacac MIMAT0000549 mmu-miR-322-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cacauuacacggucgaccucu MIMAT0000550 rno-miR-323-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cacauuacacggucgaccucu MIMAT0000551 mmu-miR-323-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cagugcaauaguauugucaaagc MIMAT0000552 rno-miR-301a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cgcauccccuagggcauuggugu MIMAT0000553 rno-miR-324-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ccacugccccaggugcugcugg MIMAT0000554 rno-miR-324-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cgcauccccuagggcauuggugu MIMAT0000555 mmu-miR-324-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ccacugccccaggugcugcu MIMAT0000556 mmu-miR-324-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ccuaguaggugcucaguaagugu MIMAT0000557 rno-miR-325-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ccuaguaggugcucaguaagugu MIMAT0000558 mmu-miR-325-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ccucugggcccuuccuccagu MIMAT0000559 mmu-miR-326-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ccucugggcccuuccuccagu MIMAT0000560 rno-miR-326-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence agagguaguagguugcauaguu MIMAT0000562 rno-let-7d-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cuauacgaccugcugccuuucu MIMAT0000563 rno-let-7d-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cuggcccucucugcccuuccgu MIMAT0000564 rno-miR-328a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cuggcccucucugcccuuccgu MIMAT0000565 mmu-miR-328-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aacacacccagcuaaccuuuuu MIMAT0000566 rno-miR-329-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aacacacccagcuaaccuuuuu MIMAT0000567 mmu-miR-329-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence gcaaagcacagggccugcagaga MIMAT0000568 rno-miR-330-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gcaaagcacagggccugcagaga MIMAT0000569 mmu-miR-330-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence gccccugggccuauccuagaa MIMAT0000570 rno-miR-331-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gccccugggccuauccuagaa MIMAT0000571 mmu-miR-331-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cagugguuuuacccuaugguag MIMAT0000573 rno-miR-140-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uaccacaggguagaaccacgg MIMAT0000574 rno-miR-140-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ucaagagcaauaacgaaaaaugu MIMAT0000575 rno-miR-335 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uucagcuccuauaugaugccuuu MIMAT0000577 rno-miR-337-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ucagcuccuauaugaugccuuu MIMAT0000578 mmu-miR-337-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ucagugcaucacagaacuuugu MIMAT0000579 rno-miR-148b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ucagugcaucacagaacuuugu MIMAT0000580 mmu-miR-148b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uccagcaucagugauuuuguuga MIMAT0000581 rno-miR-338-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uccagcaucagugauuuuguug MIMAT0000582 mmu-miR-338-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ucccuguccuccaggagcucacg MIMAT0000583 rno-miR-339-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ucccuguccuccaggagcucacg MIMAT0000584 mmu-miR-339-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uccgucucaguuacuuuauagcc MIMAT0000585 rno-miR-340-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uccgucucaguuacuuuauagc MIMAT0000586 mmu-miR-340-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ucucacacagaaaucgcacccgu MIMAT0000589 rno-miR-342-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ucucacacagaaaucgcacccgu MIMAT0000590 mmu-miR-342-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ugcugaccccuaguccagugc MIMAT0000594 rno-miR-345-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gcugaccccuaguccagugcuu MIMAT0000595 mmu-miR-345-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ugucugccugagugccugccucu MIMAT0000596 rno-miR-346 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugucugcccgagugccugccucu MIMAT0000597 mmu-miR-346-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cuuuuugcggucugggcuugc MIMAT0000600 rno-miR-129-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aagcccuuaccccaaaaagcau MIMAT0000601 rno-miR-129-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uaaagugcuuauagugcagguag MIMAT0000602 rno-miR-20a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence acugcauuacgagcacuuaca MIMAT0000603 rno-miR-20a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uggaagacuagugauuuuguugu MIMAT0000606 rno-miR-7a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence acaacaaaucacagucugccau MIMAT0000607 rno-miR-7a-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uauggcuuuucauuccuauguga MIMAT0000611 rno-miR-135b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uauggcuuuucauuccuauguga MIMAT0000612 mmu-miR-135b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ucgaggagcucacagucuagu MIMAT0000613 rno-miR-151-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cuagacugaggcuccuugagg MIMAT0000614 rno-miR-151-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uacaguacugugauagcugaa MIMAT0000615 rno-miR-101b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence guacaguacugugauagcu MIMAT0000616 mmu-miR-101b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaauacugccggguaaugaugga MIMAT0000617 hsa-miR-200c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuaaugcuaaucgugauaggggu MIMAT0000646 hsa-miR-155-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence agcagcauuguacagggcuauca MIMAT0000647 mmu-miR-107-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uacccuguagauccgaauuugug MIMAT0000648 mmu-miR-10a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence caaagugcuuacagugcagguag MIMAT0000649 mmu-miR-17-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence acugcagugagggcacuuguag MIMAT0000650 mmu-miR-17-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugugcaaaucuaugcaaaacuga MIMAT0000651 mmu-miR-19a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cauugcacuugucucggucuga MIMAT0000652 mmu-miR-25-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aaggagcucacagucuauugag MIMAT0000653 mmu-miR-28a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uauugcacauuacuaaguugca MIMAT0000654 mmu-miR-32-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aacccguagauccgaacuugug MIMAT0000655 mmu-miR-100-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ucuacagugcacgugucuccag MIMAT0000656 mmu-miR-139-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uaauacugccggguaaugaugga MIMAT0000657 mmu-miR-200c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cugugcgugugacagcggcuga MIMAT0000658 mmu-miR-210-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uaacagucuccagucacggcca MIMAT0000659 mmu-miR-212-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence accaucgaccguugauuguacc MIMAT0000660 mmu-miR-181a-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence acagcaggcacagacaggcagu MIMAT0000661 mmu-miR-214-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uaaucucagcuggcaacuguga MIMAT0000662 mmu-miR-216a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uugugcuugaucuaaccaugu MIMAT0000663 mmu-miR-218-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugauuguccaaacgcaauucu MIMAT0000664 mmu-miR-219a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugucaguuugucaaauacccca MIMAT0000665 mmu-miR-223-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aaaagcuggguugagagggcga MIMAT0000666 mmu-miR-320-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gugcauuguaguugcauugca MIMAT0000667 mmu-miR-33-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uucccuuugucauccuuugccu MIMAT0000668 mmu-miR-211-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence agcuacauugucugcuggguuuc MIMAT0000669 mmu-miR-221-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence agcuacaucuggcuacugggu MIMAT0000670 mmu-miR-222-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uaagucacuagugguuccguu MIMAT0000671 mmu-miR-224-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cccaguguuuagacuaccuguuc MIMAT0000672 mmu-miR-199b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aacauucauugcugucggugggu MIMAT0000673 mmu-miR-181b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aacauucaaccugucggugagu MIMAT0000674 mmu-miR-181c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uggaagacuagugauuuuguugu MIMAT0000677 mmu-miR-7a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uggaagacuugugauuuuguugu MIMAT0000678 mmu-miR-7b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uacugcaucaggaacugacugga MIMAT0000679 mmu-miR-217-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaaagugcugacagugcagau MIMAT0000680 hsa-miR-106b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uagcaccauuugaaaucgguua MIMAT0000681 hsa-miR-29c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaacacugucugguaacgaugu MIMAT0000682 hsa-miR-200a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acuuaaacguggauguacuugcu MIMAT0000683 hsa-miR-302a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaagugcuuccauguuuugguga MIMAT0000684 hsa-miR-302a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaggcagugucauuagcugauug MIMAT0000685 hsa-miR-34b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggcaguguaguuagcugauugc MIMAT0000686 hsa-miR-34c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaugugggaugguaaaccgcuu MIMAT0000687 hsa-miR-299-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cagugcaauaguauugucaaagc MIMAT0000688 hsa-miR-301a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cacccguagaaccgaccuugcg MIMAT0000689 hsa-miR-99b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agggcccccccucaauccugu MIMAT0000690 hsa-miR-296-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cagugcaaugaugaaagggcau MIMAT0000691 hsa-miR-130b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uguaaacauccuugacuggaag MIMAT0000692 hsa-miR-30e-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuuucagucggauguuuacagc MIMAT0000693 hsa-miR-30e-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuaucagaaucuccagggguac MIMAT0000703 hsa-miR-361-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uuaucagaaucuccagggguac MIMAT0000704 mmu-miR-361-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aauccuuggaaccuaggugugagu MIMAT0000705 hsa-miR-362-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aauccuuggaaccuaggugugaau MIMAT0000706 mmu-miR-362-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aauugcacgguauccaucugua MIMAT0000707 hsa-miR-363-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aauugcacgguauccaucugua MIMAT0000708 mmu-miR-363-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaaugccccuaaaaauccuuau MIMAT0000710 hsa-miR-365a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uaaugccccuaaaaauccuuau MIMAT0000711 mmu-miR-365-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acuuuaacauggaagugcuuuc MIMAT0000714 hsa-miR-302b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaagugcuuccauguuuuaguag MIMAT0000715 hsa-miR-302b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuuaacauggggguaccugcug MIMAT0000716 hsa-miR-302c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaagugcuuccauguuucagugg MIMAT0000717 hsa-miR-302c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaagugcuuccauguuugagugu MIMAT0000718 hsa-miR-302d-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aauugcacuuuagcaaugguga MIMAT0000719 hsa-miR-367-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aacauagaggaaauuccacgu MIMAT0000720 hsa-miR-376c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aauaauacaugguugaucuuu MIMAT0000721 hsa-miR-369-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gccugcugggguggaaccuggu MIMAT0000722 hsa-miR-370-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aagugccgccaucuuuugagugu MIMAT0000723 hsa-miR-371a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaagugcugcgacauuugagcgu MIMAT0000724 hsa-miR-372-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acucaaaaugggggcgcuuucc MIMAT0000725 hsa-miR-373-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaagugcuucgauuuuggggugu MIMAT0000726 hsa-miR-373-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuauaauacaaccugauaagug MIMAT0000727 hsa-miR-374a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuuguucguucggcucgcguga MIMAT0000728 hsa-miR-375 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aucauagaggaaaauccacgu MIMAT0000729 hsa-miR-376a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aucacacaaaggcaacuuuugu MIMAT0000730 hsa-miR-377-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuccugacuccagguccugugu MIMAT0000731 hsa-miR-378a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acuggacuuggagucagaaggc MIMAT0000732 hsa-miR-378a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugguagacuauggaacguagg MIMAT0000733 hsa-miR-379-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugguugaccauagaacaugcgc MIMAT0000734 hsa-miR-380-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uauguaauaugguccacaucuu MIMAT0000735 hsa-miR-380-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uauacaagggcaagcucucugu MIMAT0000736 hsa-miR-381-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaaguuguucgugguggauucg MIMAT0000737 hsa-miR-382-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agaucagaaggugauuguggcu MIMAT0000738 hsa-miR-383-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uuuguucguucggcucgcguga MIMAT0000739 mmu-miR-375-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aucguagaggaaaauccacgu MIMAT0000740 mmu-miR-376a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aucacacaaaggcaacuuuugu MIMAT0000741 mmu-miR-377-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cuccugacuccagguccugugu MIMAT0000742 mmu-miR-378a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugguagacuauggaacguagg MIMAT0000743 mmu-miR-379-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence augguugaccauagaacaugcg MIMAT0000744 mmu-miR-380-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uauguaguaugguccacaucuu MIMAT0000745 mmu-miR-380-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uauacaagggcaagcucucugu MIMAT0000746 mmu-miR-381-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gaaguuguucgugguggauucg MIMAT0000747 mmu-miR-382-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence agaucagaaggugacuguggcu MIMAT0000748 mmu-miR-383-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uccgucucaguuacuuuauagc MIMAT0000750 hsa-miR-340-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcaaagcacacggccugcagaga MIMAT0000751 hsa-miR-330-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuggcccucucugcccuuccgu MIMAT0000752 hsa-miR-328-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucucacacagaaaucgcacccgu MIMAT0000753 hsa-miR-342-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuccuauaugaugccuuucuuc MIMAT0000754 hsa-miR-337-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cacauuacacggucgaccucu MIMAT0000755 hsa-miR-323a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccucugggcccuuccuccag MIMAT0000756 hsa-miR-326 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuagacugaagcuccuugagg MIMAT0000757 hsa-miR-151a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uauggcuuuucauuccuauguga MIMAT0000758 hsa-miR-135b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucagugcaucacagaacuuugu MIMAT0000759 hsa-miR-148b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gccccugggccuauccuagaa MIMAT0000760 hsa-miR-331-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cgcauccccuagggcauuggugu MIMAT0000761 hsa-miR-324-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acugccccaggugcugcugg MIMAT0000762 hsa-miR-324-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uccagcaucagugauuuuguug MIMAT0000763 hsa-miR-338-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucccuguccuccaggagcucacg MIMAT0000764 hsa-miR-339-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucaagagcaauaacgaaaaaugu MIMAT0000765 hsa-miR-335-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ucaagagcaauaacgaaaaaugu MIMAT0000766 mmu-miR-335-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uuugguccccuucaaccagcua MIMAT0000769 mmu-miR-133b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuugguccccuucaaccagcua MIMAT0000770 hsa-miR-133b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccuaguagguguccaguaagugu MIMAT0000771 hsa-miR-325 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcugacuccuaguccagggcuc MIMAT0000772 hsa-miR-345-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugucugcccgcaugccugccucu MIMAT0000773 hsa-miR-346 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ugagguaguagguuguauaguu MIMAT0000774 rno-let-7a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ugagguaguagguugugugguu MIMAT0000775 rno-let-7b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ugagguaguagguuguaugguu MIMAT0000776 rno-let-7c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ugagguaggagguuguauaguu MIMAT0000777 rno-let-7e-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ugagguaguagauuguauaguu MIMAT0000778 rno-let-7f-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ugagguaguaguuugugcuguu MIMAT0000779 rno-let-7i-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uggaagacuugugauuuuguugu MIMAT0000780 rno-miR-7b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ucuuugguuaucuagcuguauga MIMAT0000781 rno-miR-9a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uacccuguagauccgaauuugug MIMAT0000782 rno-miR-10a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cccuguagaaccgaauuugugu MIMAT0000783 rno-miR-10b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uagcagcacaucaugguuuaca MIMAT0000784 rno-miR-15b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uagcagcacguaaauauuggcg MIMAT0000785 rno-miR-16-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence caaagugcuuacagugcagguag MIMAT0000786 rno-miR-17-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uaaggugcaucuagugcagauag MIMAT0000787 rno-miR-18a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ugugcaaauccaugcaaaacuga MIMAT0000788 rno-miR-19b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ugugcaaaucuaugcaaaacuga MIMAT0000789 rno-miR-19a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uagcuuaucagacugauguuga MIMAT0000790 rno-miR-21-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aagcugccaguugaagaacugu MIMAT0000791 rno-miR-22-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aucacauugccagggauuucc MIMAT0000792 rno-miR-23a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aucacauugccagggauuacc MIMAT0000793 rno-miR-23b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uggcucaguucagcaggaacag MIMAT0000794 rno-miR-24-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cauugcacuugucucggucuga MIMAT0000795 rno-miR-25-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uucaaguaauccaggauaggcu MIMAT0000796 rno-miR-26a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uucaaguaauucaggauaggu MIMAT0000797 rno-miR-26b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uucacaguggcuaaguucugc MIMAT0000798 rno-miR-27b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uucacaguggcuaaguuccgc MIMAT0000799 rno-miR-27a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aaggagcucacagucuauugag MIMAT0000800 rno-miR-28-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uagcaccauuugaaaucaguguu MIMAT0000801 rno-miR-29b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uagcaccaucugaaaucgguua MIMAT0000802 rno-miR-29a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uagcaccauuugaaaucgguua MIMAT0000803 rno-miR-29c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uguaaacauccuacacucucagc MIMAT0000804 rno-miR-30c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uguaaacauccuugacuggaag MIMAT0000805 rno-miR-30e-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uguaaacauccuacacucagcu MIMAT0000806 rno-miR-30b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uguaaacauccccgacuggaag MIMAT0000807 rno-miR-30d-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uguaaacauccucgacuggaag MIMAT0000808 rno-miR-30a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cuuucagucggauguuugcagc MIMAT0000809 rno-miR-30a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aggcaagaugcuggcauagcug MIMAT0000810 rno-miR-31a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uauugcacauuacuaaguugca MIMAT0000811 rno-miR-32-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence gugcauuguaguugcauugca MIMAT0000812 rno-miR-33-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aggcaguguaauuagcugauugu MIMAT0000813 rno-miR-34b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aggcaguguaguuagcugauugc MIMAT0000814 rno-miR-34c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uggcagugucuuagcugguugu MIMAT0000815 rno-miR-34a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uauugcacuugucccggccug MIMAT0000816 rno-miR-92a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence caaagugcuguucgugcagguag MIMAT0000817 rno-miR-93-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uuuggcacuagcacauuuuugcu MIMAT0000818 rno-miR-96-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ugagguaguaaguuguauuguu MIMAT0000819 rno-miR-98-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aacccguagauccgaucuugug MIMAT0000820 rno-miR-99a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cacccguagaaccgaccuugcg MIMAT0000821 rno-miR-99b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aacccguagauccgaacuugug MIMAT0000822 rno-miR-100-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uacaguacugugauaacugaa MIMAT0000823 rno-miR-101a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence agcagcauuguacagggcuauga MIMAT0000824 rno-miR-103-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uaaagugcugacagugcagau MIMAT0000825 rno-miR-106b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence agcagcauuguacagggcuauca MIMAT0000826 rno-miR-107-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uggagugugacaaugguguuug MIMAT0000827 rno-miR-122-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uaaggcacgcggugaaugcc MIMAT0000828 rno-miR-124-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ucccugagacccuuuaaccuguga MIMAT0000829 rno-miR-125a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ucccugagacccuaacuuguga MIMAT0000830 rno-miR-125b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cauuauuacuuuugguacgcg MIMAT0000831 rno-miR-126a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ucguaccgugaguaauaaugcg MIMAT0000832 rno-miR-126a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ucggauccgucugagcuuggcu MIMAT0000833 rno-miR-127-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ucacagugaaccggucucuuu MIMAT0000834 rno-miR-128-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cagugcaauguuaaaagggcau MIMAT0000836 rno-miR-130a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cagugcaaugaugaaagggcau MIMAT0000837 rno-miR-130b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uaacagucuacagccauggucg MIMAT0000838 rno-miR-132-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uuugguccccuucaaccagcug MIMAT0000839 rno-miR-133a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ugugacugguugaccagagggg MIMAT0000840 rno-miR-134-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uauggcuuuuuauuccuauguga MIMAT0000841 rno-miR-135a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence acuccauuuguuuugaugaugga MIMAT0000842 rno-miR-136-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uuauugcuuaagaauacgcguag MIMAT0000843 rno-miR-137-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence agcugguguugugaaucaggccg MIMAT0000844 rno-miR-138-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ucuacagugcacgugucuccag MIMAT0000845 rno-miR-139-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uaacacugucugguaaagaugg MIMAT0000846 rno-miR-141-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cauaaaguagaaagcacuacu MIMAT0000847 rno-miR-142-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uguaguguuuccuacuuuaugga MIMAT0000848 rno-miR-142-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ugagaugaagcacuguagcuca MIMAT0000849 rno-miR-143-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uacaguauagaugauguacu MIMAT0000850 rno-miR-144-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence guccaguuuucccaggaaucccu MIMAT0000851 rno-miR-145-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ugagaacugaauuccauggguu MIMAT0000852 rno-miR-146a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ucucccaacccuuguaccagug MIMAT0000853 rno-miR-150-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ucagugcaugacagaacuugg MIMAT0000854 rno-miR-152-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uugcauagucacaaaagugauc MIMAT0000855 rno-miR-153-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uagguuauccguguugccuucg MIMAT0000856 rno-miR-154-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aacauucaaccugucggugagu MIMAT0000857 rno-miR-181c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aacauucaacgcugucggugagu MIMAT0000858 rno-miR-181a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aacauucauugcugucggugggu MIMAT0000859 rno-miR-181b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uauggcacugguagaauucacu MIMAT0000860 rno-miR-183-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uggacggagaacugauaagggu MIMAT0000861 rno-miR-184 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uggagagaaaggcaguuccuga MIMAT0000862 rno-miR-185-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence caaagaauucuccuuuugggcu MIMAT0000863 rno-miR-186-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ucgugucuuguguugcagccgg MIMAT0000864 rno-miR-187-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ugauauguuugauauauuaggu MIMAT0000865 rno-miR-190a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence caacggaaucccaaaagcagcug MIMAT0000866 rno-miR-191a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cugaccuaugaauugacagcc MIMAT0000867 rno-miR-192-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aacuggccuacaaagucccagu MIMAT0000868 rno-miR-193a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uguaacagcaacuccaugugga MIMAT0000869 rno-miR-194-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uagcagcacagaaauauuggc MIMAT0000870 rno-miR-195-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uagguaguuucauguuguuggg MIMAT0000871 rno-miR-196a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cccaguguucagacuaccuguuc MIMAT0000872 rno-miR-199a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uaauacugccggguaaugaug MIMAT0000873 rno-miR-200c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uaacacugucugguaacgaugu MIMAT0000874 rno-miR-200a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uaauacugccugguaaugaugac MIMAT0000875 rno-miR-200b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence gugaaauguuuaggaccacuag MIMAT0000876 rno-miR-203a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uucccuuugucauccuaugccu MIMAT0000877 rno-miR-204-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uccuucauuccaccggagucugu MIMAT0000878 rno-miR-205 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uggaauguaaggaagugugugg MIMAT0000879 rno-miR-206-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence auaagacgagcaaaaagc MIMAT0000880 rno-miR-208a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cugugcgugugacagcggcuga MIMAT0000881 rno-miR-210-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uucccuuugucauccuuugccu MIMAT0000882 rno-miR-211-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uaacagucuccagucacggcca MIMAT0000883 rno-miR-212-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence accaucgaccguugauuguacc MIMAT0000884 rno-miR-181a-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence acagcaggcacagacaggcag MIMAT0000885 rno-miR-214-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uaaucucagcuggcaacuguga MIMAT0000886 rno-miR-216a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uacugcaucaggaacugacugg MIMAT0000887 rno-miR-217-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uugugcuugaucuaaccaugu MIMAT0000888 rno-miR-218a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ugauuguccaaacgcaauucu MIMAT0000889 rno-miR-219a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence agcuacauugucugcuggguuuc MIMAT0000890 rno-miR-221-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence agcuacaucuggcuacugggu MIMAT0000891 rno-miR-222-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ugucaguuugucaaauacccc MIMAT0000892 rno-miR-223-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ucucaaacuaugggggca MIMAT0000893 rno-miR-290 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence caucaaaguggaggcccucucu MIMAT0000894 rno-miR-291a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aaagugcuuccacuuugugugcc MIMAT0000895 rno-miR-291a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence acucaaacugggggcucuuuug MIMAT0000896 rno-miR-292-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aagugccgccagguuuugagugu MIMAT0000897 rno-miR-292-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence agggcccccccucaauccugu MIMAT0000898 rno-miR-296-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence auguaugugugcauguaugcaug MIMAT0000899 rno-miR-297 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ggcagaggagggcuguucuuccc MIMAT0000900 rno-miR-298-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ugguuuaccgucccacauacau MIMAT0000901 rno-miR-299a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uaugcaagggcaagcucucuuc MIMAT0000902 rno-miR-300-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aaaagcuggguugagagggcga MIMAT0000903 rno-miR-320-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence augaccuaugauuugacagac MIMAT0000904 mmu-miR-215-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auuccuagaaauuguucaua MIMAT0001075 hsa-miR-384 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence auuccuagaaauuguucacaau MIMAT0001076 mmu-miR-384-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uagguaguuuccuguuguuggg MIMAT0001080 hsa-miR-196b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uagguaguuuccuguuguuggg MIMAT0001081 mmu-miR-196b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uagguaguuuccuguuguuggg MIMAT0001082 rno-miR-196b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gaauguugcucggugaaccccu MIMAT0001090 mmu-miR-409-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aauauaacacagauggccugu MIMAT0001091 mmu-miR-410-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aucauagaggaacauccacuu MIMAT0001092 mmu-miR-376b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uauguaacacgguccacuaacc MIMAT0001093 mmu-miR-411-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uucaccugguccacuagccg MIMAT0001094 mmu-miR-412-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gccugcugggguggaaccuggu MIMAT0001095 mmu-miR-370-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uagcaccauuugaaaucgguu MIMAT0001096 gga-miR-29a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uagcaccauuugaaaucaguguu MIMAT0001097 gga-miR-29b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ugagguaguaguuugugcugu MIMAT0001098 gga-let-7i A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uauggcuuuuuauuccuauguga MIMAT0001099 gga-miR-135a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence gugcauuguaguugcauugc MIMAT0001100 gga-miR-33-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ugagguaguagguuguauaguu MIMAT0001101 gga-let-7a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ugagguaguagguugugugguu MIMAT0001102 gga-let-7b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence aacccguagauccgaucuugug MIMAT0001103 gga-miR-99a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ugagguaguagguuguaugguu MIMAT0001104 gga-let-7c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ucccugagacccuaacuuguga MIMAT0001105 gga-miR-125b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uuaaugcuaaucgugauagggg MIMAT0001106 gga-miR-155 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence agcuacaucuggcuacugggucuc MIMAT0001107 gga-miR-222a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence agcuacauugucugcuggguuuc MIMAT0001108 gga-miR-221-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uauugcacuugucccggccug MIMAT0001109 gga-miR-92-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ugugcaaauccaugcaaaacuga MIMAT0001110 gga-miR-19b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uaaagugcuuauagugcagguag MIMAT0001111 gga-miR-20a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ugugcaaaucuaugcaaaacuga MIMAT0001112 gga-miR-19a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uaaggugcaucuagugcagaua MIMAT0001113 gga-miR-18a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence caaagugcuuacagugcagguagu MIMAT0001114 gga-miR-17-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence acugcagugaaggcacuugu MIMAT0001115 gga-miR-17-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uagcagcacguaaauauuggug MIMAT0001116 gga-miR-16-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uagcagcacauaaugguuugu MIMAT0001117 gga-miR-15a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uucaaguaauccaggauaggc MIMAT0001118 gga-miR-26a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uugcauagucacaaaaguga MIMAT0001119 gga-miR-153-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ucagugcacuacagaacuuugu MIMAT0001120 gga-miR-148a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uagguaguuucauguuguugg MIMAT0001121 gga-miR-196-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence agcugguguugugaauc MIMAT0001122 gga-miR-138-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ucacagugaaccggucucuuu MIMAT0001123 gga-miR-128-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ucgugucuuguguugcagcc MIMAT0001124 gga-miR-187-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uauugcacauuacuaaguugc MIMAT0001125 gga-miR-32-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uugguccccuucaaccagcugu MIMAT0001126 gga-miR-133a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uggaauguaaagaaguaugua MIMAT0001127 gga-miR-1a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uuaaggcacgcggugaaugcca MIMAT0001128 gga-miR-124a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uguaaacauccccgacuggaag MIMAT0001129 gga-miR-30d A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uguaaacauccuacacucagcu MIMAT0001130 gga-miR-30b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uaaucucagcuggcaacugug MIMAT0001131 gga-miR-216a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uacugcaucaggaacugauuggau MIMAT0001132 gga-miR-217-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uguaacagcaacuccaugugga MIMAT0001133 gga-miR-194 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence augaccuaugaauugacagac MIMAT0001134 gga-miR-215-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uguaaacauccucgacuggaag MIMAT0001135 gga-miR-30a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence cuuucagucggauguuugcagc MIMAT0001136 gga-miR-30a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uguaaacauccuacacucucagcu MIMAT0001137 gga-miR-30c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uugguccccuucaaccagcua MIMAT0001138 gga-miR-133b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uggaauguaaggaagugugugg MIMAT0001139 gga-miR-206 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ugucaguuugucaaauacccc MIMAT0001140 gga-miR-223 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uaaggugcaucuagugcaguua MIMAT0001141 gga-miR-18b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence aaaagugcuuacagugcaggua MIMAT0001142 gga-miR-106-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence aagugcuuccauguuuuaguga MIMAT0001143 gga-miR-302a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uugugcuugaucuaaccaugu MIMAT0001144 gga-miR-218-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence agcagcauuguacagggcuauga MIMAT0001145 gga-miR-103-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence gugaaauguuuaggaccacuug MIMAT0001146 gga-miR-203a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence agcagcauuguacagggcuauca MIMAT0001147 gga-miR-107-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uacccuguagaaccgaauuugu MIMAT0001148 gga-miR-10b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence accaucgaccguugauuguacc MIMAT0001150 gga-miR-181a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence aacauucauugcugucgguggg MIMAT0001151 gga-miR-181b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence cccaguguucagacuaccuguuc MIMAT0001152 gga-miR-199-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uauugcuuaagaauacgcguag MIMAT0001153 gga-miR-137-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uagcagcacaucaugguuugca MIMAT0001154 gga-miR-15b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ugauauguuugauauauuaggu MIMAT0001155 gga-miR-190a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uucccuuugucauccuaugccu MIMAT0001156 gga-miR-204 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uggaagacuagugauuuuguug MIMAT0001157 gga-miR-7 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uggacggagaacugauaagggu MIMAT0001158 gga-miR-184-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence agugguuuuacccuaugguag MIMAT0001159 gga-miR-140-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ugagguaguaguuuguacagu MIMAT0001160 gga-let-7g-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence agagguaguggguugcauagu MIMAT0001161 gga-let-7d A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ugagguaguagauuguauaguu MIMAT0001162 gga-let-7f-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ugagaacugaauuccauggguu MIMAT0001163 gga-miR-146a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence cccuucauuccaccggaaucug MIMAT0001164 gga-miR-205b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence cagugcaauaaugaaagggcgu MIMAT0001165 gga-miR-130b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence cagugcaauaauauugucaaagcau MIMAT0001166 gga-miR-301a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence cagugcaauauuaaaagggcau MIMAT0001167 gga-miR-130a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence aacauucaacgcugucggugagu MIMAT0001168 gga-miR-181a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ucguaccgugaguaauaaugcgc MIMAT0001169 gga-miR-126-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ugauuguccaaacgcaauucu MIMAT0001170 gga-miR-219a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uaacacugucugguaacgaugu MIMAT0001171 gga-miR-200a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uaauacugccugguaaugaugau MIMAT0001172 gga-miR-200b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uggcagugucuuagcugguuguu MIMAT0001173 gga-miR-34a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uuaaggcacgcagugaaugcca MIMAT0001174 gga-miR-124b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uggaauguuaagaaguaugua MIMAT0001175 gga-miR-1b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uugguccccuucaaccagcugc MIMAT0001176 gga-miR-133c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uguaaacauccuugacugg MIMAT0001177 gga-miR-30e-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence aacccguagauccgaacuugug MIMAT0001178 gga-miR-100-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence caggcaguguaguuagcugauug MIMAT0001179 gga-miR-34b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence aggcaguguaguuagcugauugc MIMAT0001180 gga-miR-34c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ugagguaguagguuguauaguu MIMAT0001181 gga-let-7j-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ugagguaguagauugaauaguu MIMAT0001182 gga-let-7k-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uagcaccauuugaaaucggu MIMAT0001183 gga-miR-29c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uccuucauuccaccggagucug MIMAT0001184 gga-miR-205a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence guacaguacugugauaacugaa MIMAT0001185 gga-miR-101-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence aucacauugccagggauuacc MIMAT0001186 gga-miR-23b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uucacaguggcuaaguucugc MIMAT0001187 gga-miR-27b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uggcucaguucagcaggaacag MIMAT0001188 gga-miR-24-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence aggcaagauguuggcauagcug MIMAT0001189 gga-miR-31-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uggagugugacaaugguguuugu MIMAT0001190 gga-miR-122-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uauggcacugguagaauucacug MIMAT0001191 gga-miR-183 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uggaagacuagugauuuuuguu MIMAT0001192 gga-miR-7b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence cccauaaaguagaaagcacuac MIMAT0001193 gga-miR-142-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uguaguguuuccuacuuuaugg MIMAT0001194 gga-miR-142-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ucuuugguuaucuagcuguauga MIMAT0001195 gga-miR-9-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uggaagacuugugauuuuguu MIMAT0001265 dre-miR-7b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uggaagacuagugauuuuguugu MIMAT0001266 dre-miR-7a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uacccuguagauccgaauuugu MIMAT0001267 dre-miR-10a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uacccuguagaaccgaauuugug MIMAT0001268 dre-miR-10b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uggcagugucuuagcugguugu MIMAT0001269 dre-miR-34a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence aacauucauugcugucgguggg MIMAT0001270 dre-miR-181b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uuuggcaaugguagaacucaca MIMAT0001271 dre-miR-182-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence ugguucuagacuugccaacua MIMAT0001272 dre-miR-182-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uauggcacugguagaauucacug MIMAT0001273 dre-miR-183-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence ucgugucuuguguugcagcc MIMAT0001274 dre-miR-187 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence augaccuaugaauugacagcc MIMAT0001275 dre-miR-192 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uagguaguuucauguuguuggg MIMAT0001276 dre-miR-196a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence cccaguguucagacuaccuguuc MIMAT0001277 dre-miR-199-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence gugaaauguuuaggaccacuug MIMAT0001278 dre-miR-203a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uucccuuugucauccuaugccu MIMAT0001279 dre-miR-204-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uccuucauuccaccggagucug MIMAT0001280 dre-miR-205-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence cugugcgugugacagcggcuaa MIMAT0001281 dre-miR-210-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence accaucgaccguugauuguacc MIMAT0001282 dre-miR-181a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence acagcaggcacagacaggcag MIMAT0001283 dre-miR-214 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uaaucucagcuggcaacuguga MIMAT0001284 dre-miR-216a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uacugcaucaggaacugauugg MIMAT0001285 dre-miR-217 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence ugauuguccaaacgcaauucuu MIMAT0001286 dre-miR-219-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence agcuacauugucugcuggguuuc MIMAT0001288 dre-miR-221-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence agcuacaucuggcuacugggucuc MIMAT0001289 dre-miR-222a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence ugucaguuugucaaauacccc MIMAT0001290 dre-miR-223 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ggccucauuaaauguuuguug MIMAT0001320 rno-miR-421-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acuggacuuagggucagaaggc MIMAT0001339 hsa-miR-422a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agcucggucugaggccccucagu MIMAT0001340 hsa-miR-423-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cagcagcaauucauguuuugaa MIMAT0001341 hsa-miR-424-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aucgggaaugucguguccgcc MIMAT0001342 mmu-miR-425-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aucgggaaugucguguccgccc MIMAT0001343 hsa-miR-425-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence caaagugcucauagugcagguag MIMAT0001411 gga-miR-20b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaaggugcaucuagugcaguuag MIMAT0001412 hsa-miR-18b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caaagugcucauagugcagguag MIMAT0001413 hsa-miR-20b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugucuugcaggccgucaugca MIMAT0001418 mmu-miR-431-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uacggugagccugucauuauuc MIMAT0001419 mmu-miR-433-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aucaugaugggcuccucggugu MIMAT0001420 mmu-miR-433-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uugcauauguaggaugucccau MIMAT0001532 hsa-miR-448 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uugcauauguaggaugucccau MIMAT0001533 mmu-miR-448-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uugcauauguaggauguccca MIMAT0001534 rno-miR-448-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uugcauauguaggaugucccau MIMAT0001535 cfa-miR-448 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaauacugucugguaaaaccgu MIMAT0001536 hsa-miR-429 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uaauacugucugguaaugccgu MIMAT0001537 mmu-miR-429-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uaauacugucugguaaugccgu MIMAT0001538 rno-miR-429 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uaauacugucugguaaugccgu MIMAT0001539 cfa-miR-429 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uaaugccccuaaaaauccuuau MIMAT0001540 cfa-miR-365 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggcaguguauuguuagcuggu MIMAT0001541 hsa-miR-449a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uggcaguguauuguuagcuggu MIMAT0001542 mmu-miR-449a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uggcaguguauuguuagcuggu MIMAT0001543 rno-miR-449a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uggcaguguauuguuagcuggu MIMAT0001544 cfa-miR-449a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuuugcgauguguuccuaauau MIMAT0001545 hsa-miR-450a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uuuugcgauguguuccuaauau MIMAT0001546 mmu-miR-450a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uuuugcgauguguuccuaaugu MIMAT0001547 rno-miR-450a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uuuuugcgauguguuccuaaua MIMAT0001548 cfa-miR-450a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uaaugccccuaaaaauccuuau MIMAT0001549 rno-miR-365-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcugcgcuuggauuucgucccc MIMAT0001618 hsa-miR-191-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cagcagcaauucauguuuugga MIMAT0001619 rno-miR-322-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caucuuaccggacagugcugga MIMAT0001620 hsa-miR-200a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agaucgaccguguuauauucgc MIMAT0001621 hsa-miR-369-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence aacauucaacgcugucggugagu MIMAT0001623 dre-miR-181a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uaauacugucugguaaugccgu MIMAT0001624 dre-miR-429a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugucuugcaggccgucaugca MIMAT0001625 hsa-miR-431-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ugucuugcaggccgucaugca MIMAT0001626 rno-miR-431 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aucaugaugggcuccucggugu MIMAT0001627 hsa-miR-433-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aucaugaugggcuccucggugu MIMAT0001628 rno-miR-433-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aacacaccugguuaaccucuuu MIMAT0001629 hsa-miR-329-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agguuguccguggugaguucgca MIMAT0001630 hsa-miR-323b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaccguuaccauuacugaguu MIMAT0001631 hsa-miR-451a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aaaccguuaccauuacugaguu MIMAT0001632 mmu-miR-451a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aaaccguuaccauuacugaguu MIMAT0001633 rno-miR-451-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence aaaccguuaccauuacugaguu MIMAT0001634 dre-miR-451 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aacuguuugcagaggaaacuga MIMAT0001635 hsa-miR-452-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cucaucugcaaagaaguaagug MIMAT0001636 hsa-miR-452-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uguuugcagaggaaacugagac MIMAT0001637 mmu-miR-452-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agguuacccgagcaacuuugcau MIMAT0001638 hsa-miR-409-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaauguugcucggugaaccccu MIMAT0001639 hsa-miR-409-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence ugagguaguagguuguauaguu MIMAT0001759 dre-let-7a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence ugagguaguagguugugugguu MIMAT0001760 dre-let-7b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence ugagguaguagguuguaugguu MIMAT0001761 dre-let-7c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence ugagguaguugguuguaugguu MIMAT0001762 dre-let-7d-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence ugagguaguagauugaauaguu MIMAT0001763 dre-let-7e A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence ugagguaguagauuguauaguu MIMAT0001764 dre-let-7f A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence ugagguaguaguuuguauaguu MIMAT0001765 dre-let-7g A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence ugagguaguaaguuguguuguu MIMAT0001766 dre-let-7h A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence ugagguaguaguuugugcuguu MIMAT0001767 dre-let-7i A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uggaauguaaagaaguauguau MIMAT0001768 dre-miR-1 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence ucuuugguuaucuagcuguauga MIMAT0001769 dre-miR-9-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uacccuguagauccggauuugu MIMAT0001770 dre-miR-10c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uacccuguagaaccgaaugugug MIMAT0001771 dre-miR-10d-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uagcagcacagaaugguuugug MIMAT0001772 dre-miR-15a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uagcagcacaucaugguuugua MIMAT0001773 dre-miR-15b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uagcagcacguaaauauuggug MIMAT0001774 dre-miR-16a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uagcagcacguaaauauuggag MIMAT0001775 dre-miR-16b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uagcagcauguaaauauuggag MIMAT0001776 dre-miR-16c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence caaagugcuuacagugcaggua MIMAT0001777 dre-miR-17a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence caaagugcucacagugcagguag MIMAT0001778 dre-miR-20b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uaaggugcaucuagugcagaua MIMAT0001779 dre-miR-18a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uaaggugcauuuagugcagaua MIMAT0001780 dre-miR-18b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uaaggugcaucuuguguaguua MIMAT0001781 dre-miR-18c A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence ugugcaaaucuaugcaaaacuga MIMAT0001782 dre-miR-19a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence ugugcaaauccaugcaaaacuga MIMAT0001783 dre-miR-19b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence ugugcaaauccaugcaaaacucg MIMAT0001784 dre-miR-19c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence ugugcaaacccaugcaaaacuga MIMAT0001785 dre-miR-19d-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uaaagugcuuauagugcagguag MIMAT0001786 dre-miR-20a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uagcuuaucagacugguguuggc MIMAT0001787 dre-miR-21 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence aagcugccagcugaagaacugu MIMAT0001788 dre-miR-22a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence aagcugccaguugaagagcugu MIMAT0001789 dre-miR-22b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence aucacauugccagggauuucca MIMAT0001790 dre-miR-23a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence aucacauugccagggauuacca MIMAT0001791 dre-miR-23b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uggcucaguucagcaggaacag MIMAT0001792 dre-miR-24 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence cauugcacuugucucggucuga MIMAT0001793 dre-miR-25-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uucaaguaauccaggauaggcu MIMAT0001794 dre-miR-26a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uucaaguaauccaggauagguu MIMAT0001795 dre-miR-26b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uucacaguggcuaaguuccgcu MIMAT0001796 dre-miR-27a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uucacaguggcuaaguucugca MIMAT0001797 dre-miR-27b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uucacagugguuaaguucugc MIMAT0001798 dre-miR-27c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uucacaguggcuaaguucuuca MIMAT0001799 dre-miR-27d A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uucacaguggcuaaguucagug MIMAT0001800 dre-miR-27e A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uagcaccauuugaaaucagugu MIMAT0001801 dre-miR-29b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uagcaccauuugaaaucgguua MIMAT0001802 dre-miR-29a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uguaaacauucccgacuggaag MIMAT0001803 dre-miR-30a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uguaaacauccuacacucagcu MIMAT0001804 dre-miR-30b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uguaaacauccuacacucucag MIMAT0001805 dre-miR-30c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uguaaacauccccgacuggaag MIMAT0001806 dre-miR-30d A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uguaaacauccuugacuggaag MIMAT0001807 dre-miR-30e-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uauugcacuugucccggccugu MIMAT0001808 dre-miR-92a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uauugcacucgucccggccucc MIMAT0001809 dre-miR-92b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence aaaagugcuguuugugcaggua MIMAT0001810 dre-miR-93 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uuuggcacuagcacauuuuugcu MIMAT0001811 dre-miR-96-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence aacccguagauccgaucuugug MIMAT0001812 dre-miR-99 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence aacccguagauccgaacuugug MIMAT0001813 dre-miR-100-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uacaguacugugauaacugaag MIMAT0001814 dre-miR-101a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uacaguacuaugauaacugaag MIMAT0001815 dre-miR-101b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence agcagcauuguacagggcuauga MIMAT0001816 dre-miR-103 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence agcagcauuguacagggcuauca MIMAT0001817 dre-miR-107a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uggagugugacaaugguguuug MIMAT0001818 dre-miR-122 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uaaggcacgcggugaaugccaa MIMAT0001819 dre-miR-124-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence ucccugagacccuuaaccugug MIMAT0001820 dre-miR-125a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence ucccugagacccuaacuuguga MIMAT0001821 dre-miR-125b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence ucccugagacccuaacucguga MIMAT0001822 dre-miR-125c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence ucguaccgugaguaauaaugc MIMAT0001823 dre-miR-126a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence ucacagugaaccggucucuuuu MIMAT0001824 dre-miR-128-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence cuuuuugcggucugggcuugcu MIMAT0001825 dre-miR-129-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence cagugcaauguuaaaagggcau MIMAT0001826 dre-miR-130a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence cagugcaauaaugaaagggcau MIMAT0001827 dre-miR-130b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence cagugcaauauuaaaagggcau MIMAT0001828 dre-miR-130c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uaacagucuacagccauggucg MIMAT0001829 dre-miR-132-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uuugguccccuucaaccagcug MIMAT0001830 dre-miR-133a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uuugguccccuucaaccagcua MIMAT0001831 dre-miR-133b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uuuggucccuuucaaccagcua MIMAT0001832 dre-miR-133c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uauggcuuucuauuccuaugug MIMAT0001833 dre-miR-135c A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uuauugcuuaagaauacgcgua MIMAT0001834 dre-miR-137-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence agcugguguugugaaucaggcc MIMAT0001835 dre-miR-138-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence cagugguuuuacccuaugguag MIMAT0001836 dre-miR-140-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uaacacugucugguaacgaugc MIMAT0001837 dre-miR-141-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence cauaaaguagaaagcacuacu MIMAT0001838 dre-miR-142a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence cauaaaguagacagcacuacua MIMAT0001839 dre-miR-142b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence ugagaugaagcacuguagcuc MIMAT0001840 dre-miR-143 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uacaguauagaugauguacu MIMAT0001841 dre-miR-144-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence guccaguuuucccaggaauccc MIMAT0001842 dre-miR-145-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence ugagaacugaauuccauagaugg MIMAT0001843 dre-miR-146a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence ugagaacugaauuccaagggug MIMAT0001844 dre-miR-146b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence ucagugcauuacagaacuuugu MIMAT0001845 dre-miR-148 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence ucucccaauccuuguaccagug MIMAT0001846 dre-miR-150 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence ucagugcaugacagaacuuugg MIMAT0001847 dre-miR-152 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uugcauagucacaaaaaugagc MIMAT0001848 dre-miR-153b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uugcauagucacaaaagugauc MIMAT0001849 dre-miR-153a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uugcauagucacaaaaaugauc MIMAT0001850 dre-miR-153c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uuaaugcuaaucgugauagggg MIMAT0001851 dre-miR-155 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence cacauucauugcugucgguggg MIMAT0001852 dre-miR-181c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uggacggagaacugauaagggc MIMAT0001853 dre-miR-184 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence ugauauguuugauauauuaggu MIMAT0001854 dre-miR-190a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence aacuggccuacaaagucccagu MIMAT0001856 dre-miR-193a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence aacuggcccgcaaagucccgcu MIMAT0001857 dre-miR-193b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uguaacagcaacuccaugugg MIMAT0001858 dre-miR-194a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uguaacagccgcuccaugugga MIMAT0001859 dre-miR-194b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uagguaguuucaaguuguuggg MIMAT0001860 dre-miR-196b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uaacacugucugguaacgaugu MIMAT0001861 dre-miR-200a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uaauacugccugguaaugauga MIMAT0001862 dre-miR-200b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uaauacugccugguaaugaugc MIMAT0001863 dre-miR-200c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence agaggcauagggcaugggaaaa MIMAT0001864 dre-miR-202-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence gugaaauguucaggaccacuug MIMAT0001865 dre-miR-203b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uggaauguaaggaagugugugg MIMAT0001866 dre-miR-206-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uaaucucugcaggcaacuguga MIMAT0001867 dre-miR-216b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uugugcuugaucuaaccaugug MIMAT0001868 dre-miR-218a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uugugcuugaucuaaccaugca MIMAT0001869 dre-miR-218b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence cagugcaauaguauugucaaag MIMAT0001870 dre-miR-301a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence cagugcaauaguauugucauug MIMAT0001871 dre-miR-301b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence cagugcaauaguauugucauag MIMAT0001872 dre-miR-301c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uccagcaucagugauuuuguug MIMAT0001873 dre-miR-338 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence aauugcacgguauccaucugua MIMAT0001874 dre-miR-363-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uaaugccccuaaaaauccuuau MIMAT0001875 dre-miR-365 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uuuguucguucggcucgcguua MIMAT0001876 dre-miR-375 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uagugcaauauugcuaauaggg MIMAT0001877 dre-miR-454a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uagugcaauauugcuuauaggg MIMAT0001878 dre-miR-454b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uaugugcccuuggacuacaucg MIMAT0001879 dre-miR-455-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence aagcagcacaucaauauuggca MIMAT0001883 dre-miR-457a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence aagcagcacauaaauacuggag MIMAT0001884 dre-miR-457b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cauauacauacacacaccuaca MIMAT0002108 mmu-miR-467a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uucuuggacuggcacuggugagu MIMAT0002111 mmu-miR-470-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acuucaccugguccacuagccgu MIMAT0002170 hsa-miR-412-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aauauaacacagauggccugu MIMAT0002171 hsa-miR-410-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aucauagaggaaaauccauguu MIMAT0002172 hsa-miR-376b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucacuccucuccucccgucuu MIMAT0002173 hsa-miR-483-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucaggcucaguccccucccgau MIMAT0002174 hsa-miR-484 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agaggcuggccgugaugaauuc MIMAT0002175 hsa-miR-485-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gucauacacggcucuccucucu MIMAT0002176 hsa-miR-485-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uccuguacugagcugccccgag MIMAT0002177 hsa-miR-486-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaucauacagggacauccaguu MIMAT0002178 hsa-miR-487a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cccagauaauggcacucucaa MIMAT0002804 hsa-miR-488-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gugacaucacauauacggcagc MIMAT0002805 hsa-miR-489-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caaccuggaggacuccaugcug MIMAT0002806 hsa-miR-490-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aguggggaacccuuccaugagg MIMAT0002807 hsa-miR-491-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gugucuuuugcucugcaguca MIMAT0002808 hsa-miR-511-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugagaacugaauuccauaggcu MIMAT0002809 hsa-miR-146b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuccuaugcauauacuucuuug MIMAT0002810 hsa-miR-202-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agagguauagggcaugggaa MIMAT0002811 hsa-miR-202-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggaccugcgggacaagauucuu MIMAT0002812 hsa-miR-492 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuguacaugguaggcuuucauu MIMAT0002813 hsa-miR-493-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucuuggaguaggucauugggugg MIMAT0002814 hsa-miR-432-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuggauggcuccuccaugucu MIMAT0002815 hsa-miR-432-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugaaacauacacgggaaaccuc MIMAT0002816 hsa-miR-494-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaacaaacauggugcacuucuu MIMAT0002817 hsa-miR-495-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugaguauuacauggccaaucuc MIMAT0002818 hsa-miR-496 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aacuggcccucaaagucccgcu MIMAT0002819 hsa-miR-193b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cagcagcacacugugguuugu MIMAT0002820 hsa-miR-497-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aacauucauuguugucggugggu MIMAT0002821 hsa-miR-181d-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cacucagccuugagggcacuuuc MIMAT0002822 hsa-miR-512-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aagugcugucauagcugagguc MIMAT0002823 hsa-miR-512-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuucaagccagggggcguuuuuc MIMAT0002824 hsa-miR-498 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaagugcuuccuuuuugaggg MIMAT0002825 hsa-miR-520e A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uucuccaaaagaaagcacuuucug MIMAT0002826 hsa-miR-515-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gagugccuucuuuuggagcguu MIMAT0002827 hsa-miR-515-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uucuccaaaagggagcacuuuc MIMAT0002828 hsa-miR-519e-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aagugccuccuuuuagaguguu MIMAT0002829 hsa-miR-519e-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aagugcuuccuuuuagaggguu MIMAT0002830 hsa-miR-520f-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cucuagagggaagcgcuuucug MIMAT0002831 hsa-miR-519c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaagugcaucuuuuuagaggau MIMAT0002832 hsa-miR-519c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuccagagggaaguacuuucu MIMAT0002833 hsa-miR-520a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaagugcuucccuuuggacugu MIMAT0002834 hsa-miR-520a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cucuugagggaagcacuuucugu MIMAT0002835 hsa-miR-526b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaaagugcuuccuuuuagaggc MIMAT0002836 hsa-miR-526b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaagugcauccuuuuagagguu MIMAT0002837 hsa-miR-519b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuccagagggaugcacuuucu MIMAT0002838 hsa-miR-525-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaaggcgcuucccuuuagagcg MIMAT0002839 hsa-miR-525-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaacgcgcuucccuauagagggu MIMAT0002840 hsa-miR-523-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cucuagagggaagcacuuucuc MIMAT0002841 hsa-miR-518f-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaaagcgcuucucuuuagagg MIMAT0002842 hsa-miR-518f-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaagugcuuccuuuuagaggg MIMAT0002843 hsa-miR-520b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caaagcgcuccccuuuagaggu MIMAT0002844 hsa-miR-518b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cucuagagggaagcacuuucug MIMAT0002845 hsa-miR-526a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaagugcuuccuuuuagagggu MIMAT0002846 hsa-miR-520c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucucuggagggaagcacuuucug MIMAT0002847 hsa-miR-518c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caaagcgcuucucuuuagagugu MIMAT0002848 hsa-miR-518c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuacaaagggaagcacuuucuc MIMAT0002849 hsa-miR-524-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaaggcgcuucccuuuggagu MIMAT0002850 hsa-miR-524-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccucuagauggaagcacugucu MIMAT0002851 hsa-miR-517-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aucgugcaucccuuuagagugu MIMAT0002852 hsa-miR-517a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caaagugccucccuuuagagug MIMAT0002853 hsa-miR-519d-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aacgcacuucccuuuagagugu MIMAT0002854 hsa-miR-521 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuacaaagggaagcccuuuc MIMAT0002855 hsa-miR-520d-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaagugcuucucuuuggugggu MIMAT0002856 hsa-miR-520d-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aucgugcaucccuuuagagugu MIMAT0002857 hsa-miR-517b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acaaagugcuucccuuuagagugu MIMAT0002858 hsa-miR-520g-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aucuggagguaagaagcacuuu MIMAT0002859 hsa-miR-516b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugcuuccuuucagagggu MIMAT0002860 hsa-miR-516b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaagcgcuucccuucagagug MIMAT0002861 hsa-miR-518e-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cugcaaagggaagcccuuuc MIMAT0002862 hsa-miR-527 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaaagcgcuucccuuugcugga MIMAT0002863 hsa-miR-518a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caaagcgcuucccuuuggagc MIMAT0002864 hsa-miR-518d-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aucgugcauccuuuuagagugu MIMAT0002866 hsa-miR-517c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acaaagugcuucccuuuagagu MIMAT0002867 hsa-miR-520h A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaaugguucccuuuagagugu MIMAT0002868 hsa-miR-522-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaagugcauccuuuuagagugu MIMAT0002869 hsa-miR-519a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuaagacuugcagugauguuu MIMAT0002870 hsa-miR-499a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence augcaccugggcaaggauucug MIMAT0002871 hsa-miR-500a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aauccuuugucccugggugaga MIMAT0002872 hsa-miR-501-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auccuugcuaucugggugcua MIMAT0002873 hsa-miR-502-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uagcagcgggaacaguucugcag MIMAT0002874 hsa-miR-503-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agacccuggucugcacucuauc MIMAT0002875 hsa-miR-504-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cgucaacacuugcugguuuccu MIMAT0002876 hsa-miR-505-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uucacagggaggugucau MIMAT0002877 hsa-miR-513a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaaggcacccuucugaguaga MIMAT0002878 hsa-miR-506-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuuugcaccuuuuggagugaa MIMAT0002879 hsa-miR-507 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugauuguagccuuuuggaguaga MIMAT0002880 hsa-miR-508-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugauugguacgucuguggguag MIMAT0002881 hsa-miR-509-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uacucaggagaguggcaaucac MIMAT0002882 hsa-miR-510-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auugacacuucugugaguaga MIMAT0002883 hsa-miR-514a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caugccuugaguguaggaccgu MIMAT0002888 hsa-miR-532-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence caugccuugaguguaggaccgu MIMAT0002889 mmu-miR-532-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugguuuaccgucccacauacau MIMAT0002890 hsa-miR-299-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acugcccuaagugcuccuucugg MIMAT0002891 hsa-miR-18a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence agugacaucauauguacggcugc MIMAT0002940 dre-miR-489 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence ugagguaguuguuuguacaguu MIMAT0003015 dre-let-7j A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uauggcuuuuuauuccuaucug MIMAT0003032 dre-miR-135b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uaacagucuacagucauggcu MIMAT0003049 dre-miR-212 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aaugacaccacauauauggcagc MIMAT0003112 mmu-miR-489-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence augacaucacauauauggcagc MIMAT0003113 rno-miR-489-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cagaucagaaggugacugugg MIMAT0003114 rno-miR-383-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aauccuuugucccuggguga MIMAT0003116 rno-miR-501-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uuaucagaaucuccagggguac MIMAT0003117 rno-miR-361-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence augaccuaugauuugacagaca MIMAT0003118 rno-miR-215 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence caagucacuagugguuccguuu MIMAT0003119 rno-miR-224-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ucacuccuccccucccgucuu MIMAT0003120 mmu-miR-483-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cacuccuccccucccgucuugu MIMAT0003121 rno-miR-483-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence gccugcugggguggaaccuggu MIMAT0003122 rno-miR-370-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ugaaucacacaaaggcaacuuuu MIMAT0003123 rno-miR-377-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cuucaccugguccacuagccgu MIMAT0003124 rno-miR-412-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uggaauguaaagaaguguguau MIMAT0003125 rno-miR-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uuugguccccuucaaccagcua MIMAT0003126 rno-miR-133b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ucaggcucaguccccucccgau MIMAT0003127 mmu-miR-484 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence agaggcuggccgugaugaauuc MIMAT0003128 mmu-miR-485-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence agucauacacggcucuccucuc MIMAT0003129 mmu-miR-485-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uccuguacugagcugccccgag MIMAT0003130 mmu-miR-486a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaugugccuuuggacuacaucg MIMAT0003150 hsa-miR-455-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence acuggacuuggagucagaagg MIMAT0003151 mmu-miR-378a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aguucuucaguggcaagcuuua MIMAT0003152 rno-miR-22-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence gugccuacugagcugauaucag MIMAT0003153 rno-miR-24-1-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ugaccgauuucuccugguguuc MIMAT0003154 rno-miR-29c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uacaguagucugcacauugguu MIMAT0003155 dre-miR-199-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uaaagcuagauaaccgaaagu MIMAT0003156 dre-miR-9-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence cauuauuacuuuugguacgcg MIMAT0003157 dre-miR-126a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence aagcccuuaccccaaaaagcau MIMAT0003158 dre-miR-129-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uaccacaggguagaaccacggac MIMAT0003159 dre-miR-140-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uguaguguuuccuacuuuaugga MIMAT0003160 dre-miR-142a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugaaggucuacugugugccagg MIMAT0003161 hsa-miR-493-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence gcacauacuucuuuauguaccc MIMAT0003162 rno-miR-1-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggagaaauuauccuuggugugu MIMAT0003163 hsa-miR-539-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auucugcauuuuuagcaaguuc MIMAT0003164 hsa-miR-544a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucagcaaacauuuauugugugc MIMAT0003165 hsa-miR-545-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aaacauucgcggugcacuucuu MIMAT0003168 mmu-miR-543-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ggagaaauuauccuuggugugu MIMAT0003169 mmu-miR-539-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aagggauucugauguuggucacacu MIMAT0003170 mmu-miR-541-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cucggggaucaucaugucacga MIMAT0003171 mmu-miR-542-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugugacagauugauaacugaaa MIMAT0003172 mmu-miR-542-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aaacauucgcggugcacuucu MIMAT0003175 rno-miR-543-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ggagaaauuauccuuggugugu MIMAT0003176 rno-miR-539-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aagggauucugauguuggucacacu MIMAT0003177 rno-miR-541-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cucggggaucaucaugucacga MIMAT0003178 rno-miR-542-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ugugacagauugauaacugaaa MIMAT0003179 rno-miR-542-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaucguacagggucauccacuu MIMAT0003180 hsa-miR-487b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aauugcacuuuagcaaugguga MIMAT0003181 mmu-miR-367-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugaaacauacacgggaaaccuc MIMAT0003182 mmu-miR-494-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aacauagaggaaauuucacgu MIMAT0003183 mmu-miR-376c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aaucguacagggucauccacuu MIMAT0003184 mmu-miR-487b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence agaucgaccguguuauauucgc MIMAT0003185 mmu-miR-369-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aauaauacaugguugaucuuu MIMAT0003186 mmu-miR-369-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence caaagugcucauagugcagguag MIMAT0003187 mmu-miR-20b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uagcagcgggaacaguacugcag MIMAT0003188 mmu-miR-503-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gaucaaaguggaggcccucucc MIMAT0003189 mmu-miR-291b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aaagugcauccauuuuguuugu MIMAT0003190 mmu-miR-291b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ugaaggucuacugugugccag MIMAT0003191 rno-miR-493-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ugguagacuauggaacguagg MIMAT0003192 rno-miR-379-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ugaaacauacacgggaaaccucu MIMAT0003193 rno-miR-494-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aacauagaggaaauuucacgu MIMAT0003194 rno-miR-376c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence guggauauuccuucuaugguua MIMAT0003195 rno-miR-376b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aucauagaggaacauccacuu MIMAT0003196 rno-miR-376b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence gguagauucuccuucuaugag MIMAT0003197 rno-miR-376a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aucguagaggaaaauccacgu MIMAT0003198 rno-miR-376a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uauacaagggcaagcucu MIMAT0003199 rno-miR-381-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aaucguacagggucauccacuu MIMAT0003200 rno-miR-487b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence gaaguuguucgugguggauucg MIMAT0003201 rno-miR-382-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aaucauucacggacaacacuu MIMAT0003202 rno-miR-382-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence agaggcuggccgugaugaauuc MIMAT0003203 rno-miR-485-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence agguuacccgagcaacuuugcau MIMAT0003204 rno-miR-409a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aauguugcucggugaacccc MIMAT0003205 rno-miR-409a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence agaucgaccguguuauauucgc MIMAT0003206 rno-miR-369-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aauaauacaugguugaucuuu MIMAT0003207 rno-miR-369-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence auauaauacaaccugcuaagug MIMAT0003208 rno-miR-374-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cggguggaucacgaugcaauuu MIMAT0003209 rno-miR-363-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aauugcacgguauccaucugu MIMAT0003210 rno-miR-363-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence caaagugcucauagugcagguag MIMAT0003211 rno-miR-20b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence acugcagugugagcacuucugg MIMAT0003212 rno-miR-20b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uagcagcgggaacaguacugcag MIMAT0003213 rno-miR-503-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcgacccacucuugguuucca MIMAT0003214 hsa-miR-551a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aacaggugacugguuagacaa MIMAT0003215 hsa-miR-552-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaacggugagauuuuguuuu MIMAT0003216 hsa-miR-553 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcuaguccugacucagccagu MIMAT0003217 hsa-miR-554 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uauugcacucgucccggccucc MIMAT0003218 hsa-miR-92b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggguaagcugaaccucugau MIMAT0003219 hsa-miR-555 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaugagcucauuguaauaugag MIMAT0003220 hsa-miR-556-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence guuugcacgggugggccuugucu MIMAT0003221 hsa-miR-557 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugagcugcuguaccaaaau MIMAT0003222 hsa-miR-558 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaaaguaaauaugcaccaaaa MIMAT0003223 hsa-miR-559 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caaaguuuaagauccuugaagu MIMAT0003225 hsa-miR-561-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaguagcuguaccauuugc MIMAT0003226 hsa-miR-562 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agguugacauacguuuccc MIMAT0003227 hsa-miR-563 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggcacggugucagcaggc MIMAT0003228 hsa-miR-564 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gggcgccugugaucccaac MIMAT0003230 hsa-miR-566 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aguauguucuuccaggacagaac MIMAT0003231 hsa-miR-567 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auguauaaauguauacacac MIMAT0003232 hsa-miR-568 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcgacccauacuugguuucag MIMAT0003233 hsa-miR-551b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aguuaaugaauccuggaaagu MIMAT0003234 hsa-miR-569 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cgaaaacagcaauuaccuuugc MIMAT0003235 hsa-miR-570-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugaguuggccaucugagugag MIMAT0003236 hsa-miR-571 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence guccgcucggcgguggccca MIMAT0003237 hsa-miR-572 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cugaagugauguguaacugaucag MIMAT0003238 hsa-miR-573 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cacgcucaugcacacacccaca MIMAT0003239 hsa-miR-574-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gagccaguuggacaggagc MIMAT0003240 hsa-miR-575 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auucuaauuucuccacgucuuu MIMAT0003241 hsa-miR-576-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uagauaaaauauugguaccug MIMAT0003242 hsa-miR-577 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuucuugugcucuaggauugu MIMAT0003243 hsa-miR-578 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uucauuugguauaaaccgcgauu MIMAT0003244 hsa-miR-579-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uugagaaugaugaaucauuagg MIMAT0003245 hsa-miR-580-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucuuguguucucuagaucagu MIMAT0003246 hsa-miR-581 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuacaguuguucaaccaguuacu MIMAT0003247 hsa-miR-582-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caaagaggaaggucccauuac MIMAT0003248 hsa-miR-583 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuaugguuugccugggacugag MIMAT0003249 hsa-miR-584-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugggcguaucuguaugcua MIMAT0003250 hsa-miR-585-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caaaacuggcaauuacuuuugc MIMAT0003251 hsa-miR-548a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaugcauuguauuuuuaggucc MIMAT0003252 hsa-miR-586 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuuccauaggugaugagucac MIMAT0003253 hsa-miR-587 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caagaaccucaguugcuuuugu MIMAT0003254 hsa-miR-548b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuggccacaauggguuagaac MIMAT0003255 hsa-miR-588 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucagaacaaaugccgguucccaga MIMAT0003256 hsa-miR-589-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugucuuacucccucaggcacau MIMAT0003257 hsa-miR-550a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gagcuuauucauaaaagugcag MIMAT0003258 hsa-miR-590-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agaccauggguucucauugu MIMAT0003259 hsa-miR-591 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uugugucaauaugcgaugaugu MIMAT0003260 hsa-miR-592 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggcaccagccaggcauugcucagc MIMAT0003261 hsa-miR-593-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaagugugccguggugugucu MIMAT0003263 hsa-miR-595 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aagccugcccggcuccucggg MIMAT0003264 hsa-miR-596 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugugucacucgaugaccacugu MIMAT0003265 hsa-miR-597-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uacgucaucguugucaucguca MIMAT0003266 hsa-miR-598-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence guugugucaguuuaucaaac MIMAT0003267 hsa-miR-599 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acuuacagacaagagccuugcuc MIMAT0003268 hsa-miR-600 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggucuaggauuguuggaggag MIMAT0003269 hsa-miR-601 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gacacgggcgacagcugcggccc MIMAT0003270 hsa-miR-602 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cacacacugcaauuacuuuugc MIMAT0003271 hsa-miR-603 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggcugcggaauucaggac MIMAT0003272 hsa-miR-604 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaaaucccauggugccuucuccu MIMAT0003273 hsa-miR-605-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaacuacugaaaaucaaagau MIMAT0003274 hsa-miR-606 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence guucaaauccagaucuauaac MIMAT0003275 hsa-miR-607 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggggugguguugggacagcuccgu MIMAT0003276 hsa-miR-608 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggguguuucucucaucucu MIMAT0003277 hsa-miR-609 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugagcuaaaugugugcuggga MIMAT0003278 hsa-miR-610 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcgaggaccccucggggucugac MIMAT0003279 hsa-miR-611 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcugggcagggcuucugagcuccuu MIMAT0003280 hsa-miR-612 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggaauguuccuucuuugcc MIMAT0003281 hsa-miR-613 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaacgccuguucuugccaggugg MIMAT0003282 hsa-miR-614 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uccgagccugggucucccucuu MIMAT0003283 hsa-miR-615-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acucaaaacccuucagugacuu MIMAT0003284 hsa-miR-616-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caaaaaucucaauuacuuuugc MIMAT0003285 hsa-miR-548c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agacuucccauuugaagguggc MIMAT0003286 hsa-miR-617 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaacucuacuuguccuucugagu MIMAT0003287 hsa-miR-618 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaccuggacauguuugugcccagu MIMAT0003288 hsa-miR-619-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auggagauagauauagaaau MIMAT0003289 hsa-miR-620 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggcuagcaacagcgcuuaccu MIMAT0003290 hsa-miR-621 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acagucugcugagguuggagc MIMAT0003291 hsa-miR-622 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aucccuugcaggggcuguugggu MIMAT0003292 hsa-miR-623 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaguaccaguaccuuguguuca MIMAT0003293 hsa-miR-624-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agggggaaaguucuauagucc MIMAT0003294 hsa-miR-625-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agcugucugaaaaugucuu MIMAT0003295 hsa-miR-626 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gugagucucuaagaaaagagga MIMAT0003296 hsa-miR-627-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucuaguaagaguggcagucga MIMAT0003297 hsa-miR-628-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence guucucccaacguaagcccagc MIMAT0003298 hsa-miR-629-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aguauucuguaccagggaaggu MIMAT0003299 hsa-miR-630 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agaccuggcccagaccucagc MIMAT0003300 hsa-miR-631 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gugcauugcuguugcauugc MIMAT0003301 hsa-miR-33b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gugucugcuuccuguggga MIMAT0003302 hsa-miR-632 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuaauaguaucuaccacaauaaa MIMAT0003303 hsa-miR-633 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaccagcaccccaacuuuggac MIMAT0003304 hsa-miR-634 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acuugggcacugaaacaaugucc MIMAT0003305 hsa-miR-635 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugugcuugcucgucccgcccgca MIMAT0003306 hsa-miR-636 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acugggggcuuucgggcucugcgu MIMAT0003307 hsa-miR-637 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agggaucgcgggcggguggcggccu MIMAT0003308 hsa-miR-638 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aucgcugcgguugcgagcgcugu MIMAT0003309 hsa-miR-639 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence augauccaggaaccugccucu MIMAT0003310 hsa-miR-640 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaagacauaggauagagucaccuc MIMAT0003311 hsa-miR-641 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gucccucuccaaaugugucuug MIMAT0003312 hsa-miR-642a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acuuguaugcuagcucagguag MIMAT0003313 hsa-miR-643 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aguguggcuuucuuagagc MIMAT0003314 hsa-miR-644a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucuaggcugguacugcuga MIMAT0003315 hsa-miR-645 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aagcagcugccucugaggc MIMAT0003316 hsa-miR-646 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence guggcugcacucacuuccuuc MIMAT0003317 hsa-miR-647 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aagugugcagggcacuggu MIMAT0003318 hsa-miR-648 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaccuguguuguucaagaguc MIMAT0003319 hsa-miR-649 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggaggcagcgcucucaggac MIMAT0003320 hsa-miR-650 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuuaggauaagcuugacuuuug MIMAT0003321 hsa-miR-651-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aauggcgccacuaggguugug MIMAT0003322 hsa-miR-652-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caaaaaccacaguuucuuuugc MIMAT0003323 hsa-miR-548d-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugccugggucucuggccugcgcgu MIMAT0003324 hsa-miR-661 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucccacguuguggcccagcag MIMAT0003325 hsa-miR-662 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggcggggcgccgcgggaccgc MIMAT0003326 hsa-miR-663a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggcaguguauuguuagcuggc MIMAT0003327 hsa-miR-449b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence guguugaaacaaucucuacug MIMAT0003328 hsa-miR-653-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaguagaccguauagcguacg MIMAT0003329 hsa-miR-411-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggugggccgcagaacaugugc MIMAT0003330 hsa-miR-654-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auaauacaugguuaaccucuuu MIMAT0003331 hsa-miR-655-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aauauuauacagucaaccucu MIMAT0003332 hsa-miR-656-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugacaacuauggaugagcucu MIMAT0003333 hsa-miR-549a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggcagguucucacccucucuagg MIMAT0003335 hsa-miR-657 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggcggagggaaguagguccguuggu MIMAT0003336 hsa-miR-658 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuugguucagggagggucccca MIMAT0003337 hsa-miR-659-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uacccauugcauaucggaguug MIMAT0003338 hsa-miR-660-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aucaacagacauuaauugggcgc MIMAT0003339 hsa-miR-421 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucggggaucaucaugucacgaga MIMAT0003340 hsa-miR-542-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uaggcaguguuguuagcugauug MIMAT0003346 dre-miR-34b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence ggcaagauguuggcauagcug MIMAT0003347 dre-miR-31 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uauggcuuuuuauuccuauguga MIMAT0003348 dre-miR-135a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence ucuacagugcaugugucu MIMAT0003349 dre-miR-139-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uaaagcuagagaaccgaaugu MIMAT0003350 gga-miR-9-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ugagaacugaauuccauaggcg MIMAT0003351 gga-miR-146b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence gugugcggaaaugcuucugc MIMAT0003352 gga-miR-147 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence aacuggcccacaaagucccgcuuu MIMAT0003353 gga-miR-193b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uuuccuaugcauauacuucuuu MIMAT0003354 gga-miR-202-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence agaggcauagagcaugggaaaa MIMAT0003355 gga-miR-202-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence acuuuaacauggaggugcuuucu MIMAT0003356 gga-miR-302b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uaagugcuuccauguuuuaguag MIMAT0003357 gga-miR-302b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uuuaacauggagguaccugcug MIMAT0003358 gga-miR-302c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uaagugcuuccauguuucagugg MIMAT0003359 gga-miR-302c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uaagugcuuccauguuuuaguug MIMAT0003360 gga-miR-302d A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uaaugccccuaaaaauccuuau MIMAT0003361 gga-miR-365-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uuuguucguucggcucgcguua MIMAT0003362 gga-miR-375 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence agaucagaaggugauuguggcu MIMAT0003363 gga-miR-383-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uaugugcccuuggacuacaucg MIMAT0003364 gga-miR-455-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence agugacaucauauguacggcugc MIMAT0003365 gga-miR-489-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence caaccuggaggacuccaugcug MIMAT0003366 gga-miR-490-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uuaagacuuguagugauguuuag MIMAT0003367 gga-miR-499-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uucccuuugucauccuaugccu MIMAT0003368 gga-miR-211 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence aauugcacuuuagcaauggug MIMAT0003369 gga-miR-367 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uaauacugucugguaaugccgu MIMAT0003371 gga-miR-429-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uggcaguguauguuagcuggu MIMAT0003372 gga-miR-449a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence acuuuaacaugggaaugcuuucu MIMAT0003373 mmu-miR-302b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uaagugcuuccauguuuuaguag MIMAT0003374 mmu-miR-302b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gcuuuaacaugggguuaccugc MIMAT0003375 mmu-miR-302c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aagugcuuccauguuucagugg MIMAT0003376 mmu-miR-302c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uaagugcuuccauguuugagugu MIMAT0003377 mmu-miR-302d-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cuccugacuccagguccugugu MIMAT0003378 rno-miR-378a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence acuggacuuggagucagaagg MIMAT0003379 rno-miR-378a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence gucaacacuugcugguuucc MIMAT0003380 rno-miR-505-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uuaagacuugcagugauguuu MIMAT0003381 rno-miR-499-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uauucauuuacuccccagccua MIMAT0003382 rno-miR-664-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cagcagcacacugugguuugua MIMAT0003383 rno-miR-497-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cggguggaucacgaugcaauuu MIMAT0003385 hsa-miR-363-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence guagauucuccuucuaugagua MIMAT0003386 hsa-miR-376a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gguagauucuccuucuaugagu MIMAT0003387 mmu-miR-376a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence guggauauuccuucuaugguua MIMAT0003388 mmu-miR-376b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugugacagauugauaacugaaa MIMAT0003389 hsa-miR-542-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence caaauucgugucuuggggaaua MIMAT0003391 dre-miR-10a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence agccacugacuaacgcacauug MIMAT0003392 dre-miR-210-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaugacacgaucacucccguuga MIMAT0003393 hsa-miR-425-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence cagauucgguuuuaggggagua MIMAT0003394 dre-miR-10d-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence caggccguacugugcugcggca MIMAT0003395 dre-miR-15a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence acugcaguggaggcacuucuag MIMAT0003396 dre-miR-17a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence cugcccuaagugccccuucugg MIMAT0003397 dre-miR-18b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence cuaguuuugcauaguugcacua MIMAT0003398 dre-miR-19a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence aguuuugcugguuugcauucag MIMAT0003399 dre-miR-19b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence acugcagugugagcacuugaag MIMAT0003400 dre-miR-20a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence cuuaacccacuugugaacaaug MIMAT0003401 dre-miR-27c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence cuuucagucggauguuugcagc MIMAT0003402 dre-miR-30e-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence accguggcauuagauuguuacu MIMAT0003403 dre-miR-132-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence agcugguaaaauggaaccaaau MIMAT0003404 dre-miR-133a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence gcuggucaaauggaaccaaguc MIMAT0003405 dre-miR-133b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uuccuaugcauauaccucuuug MIMAT0003406 dre-miR-202-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence agugguucucaacaguucaaca MIMAT0003407 dre-miR-203b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uaagugccugcauguauaugcg MIMAT0003409 mmu-miR-467a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cccagauaauagcacucucaa MIMAT0003449 mmu-miR-488-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uugaaaggcuguuucuugguc MIMAT0003450 mmu-miR-488-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cagcagcacacugugguuugua MIMAT0003453 mmu-miR-497a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence agcucggucugaggccccucagu MIMAT0003454 mmu-miR-423-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aaacaaacauggugcacuucuu MIMAT0003456 mmu-miR-495-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aggcagugcauugcuagcugg MIMAT0003460 mmu-miR-449c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gcugguaaaauggaaccaaau MIMAT0003473 mmu-miR-133a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugagaacugaauuccauaggcu MIMAT0003475 mmu-miR-146b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aguuuugugugcaugugcaugu MIMAT0003476 mmu-miR-669b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aguugugugugcauguucaugucu MIMAT0003477 mmu-miR-669a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence auauacauacacacaccaacac MIMAT0003478 mmu-miR-467b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence auaguuguguguggaugugugu MIMAT0003479 mmu-miR-669c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence auguaugugugcaugaacaugu MIMAT0003480 mmu-miR-297b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uuaagacuugcagugauguuu MIMAT0003482 mmu-miR-499-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uaugugccuuuggacuacaucg MIMAT0003485 mmu-miR-455-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aguggggaacccuuccaugagg MIMAT0003486 mmu-miR-491-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence caacuagacugugagcuucuag MIMAT0003498 mmu-miR-708-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gggacccggggagagauguaag MIMAT0003501 mmu-miR-711 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aaugcaccugggcaaggguuca MIMAT0003507 mmu-miR-500-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aauccuuugucccugggugaaa MIMAT0003508 mmu-miR-501-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aaugcacccgggcaaggauuug MIMAT0003509 mmu-miR-501-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uuuugcaguauguuccugaaua MIMAT0003511 mmu-miR-450b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence auugggaacauuuugcaugcau MIMAT0003512 mmu-miR-450b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cgucaacacuugcugguuuucu MIMAT0003513 mmu-miR-505-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cuuccgcccggccgggugucg MIMAT0003514 mmu-miR-718 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aauggcgccacuaggguugug MIMAT0003711 mmu-miR-652-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uacaguagucugcacauugg MIMAT0003721 gga-miR-199-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ccacaggguagaaccacggac MIMAT0003722 gga-miR-140-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence cauuauuacuuuugguacgcg MIMAT0003723 gga-miR-126-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence cccuauggauucaguucugc MIMAT0003724 gga-miR-146b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uggugcggaaagggcccacagu MIMAT0003725 mmu-miR-675-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cuguaugcccuaaccgcucagu MIMAT0003726 mmu-miR-675-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence auauaauacaaccugcuaagug MIMAT0003727 mmu-miR-374b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gguuguauuaucauuguccgag MIMAT0003728 mmu-miR-374b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aaaucucugcaggcaaauguga MIMAT0003729 mmu-miR-216b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence auugugucaauaugcgaugaugu MIMAT0003730 mmu-miR-592-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aggaagcccuggaggggcuggag MIMAT0003731 mmu-miR-671-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugucacucggcucggcccacuacc MIMAT0003732 mmu-miR-668-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence accaggaggcugaggucccu MIMAT0003733 mmu-miR-665-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aucccugaguguauguggugaa MIMAT0003736 mmu-miR-670-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugaguauuacauggccaaucuc MIMAT0003738 mmu-miR-496a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gcaguccacgggcauauacac MIMAT0003742 mmu-miR-455-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence ugauauguuugauauucgguug MIMAT0003747 dre-miR-190b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uuaagacuugcagugauguuua MIMAT0003749 dre-miR-499-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence aggcagugcaguuaguugauuac MIMAT0003759 dre-miR-34c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence aagcagcgcgucaugguuuuc MIMAT0003764 dre-miR-15c A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence guaagacgaacaaaaaguuuu MIMAT0003767 dre-miR-736 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uagcuuaucagacugauguuga MIMAT0003774 gga-miR-21-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence aaaccguuaccauuacugaguuu MIMAT0003775 gga-miR-451 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence cuacaguauagaugauguacuc MIMAT0003776 gga-miR-144-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence caaccuggaggacuccaugcug MIMAT0003780 mmu-miR-490-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence acucuacaaccuuaggacuugc MIMAT0003781 mmu-miR-676-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ccguccugagguuguugagcu MIMAT0003782 mmu-miR-676-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uccgagccugggucucccucuu MIMAT0003783 mmu-miR-615-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuugugaccugguccacuaacc MIMAT0003879 hsa-miR-758-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggaagcccuggaggggcuggag MIMAT0003880 hsa-miR-671-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugucacucggcucggcccacuac MIMAT0003881 hsa-miR-668-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugcaccaugguugucugagcaug MIMAT0003882 hsa-miR-767-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucugcucauaccccaugguuucu MIMAT0003883 hsa-miR-767-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acccuaucaauauugucucugc MIMAT0003884 hsa-miR-454-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uagugcaauauugcuuauagggu MIMAT0003885 hsa-miR-454-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugagaccucuggguucugagcu MIMAT0003886 hsa-miR-769-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cugggaucuccggggucuugguu MIMAT0003887 hsa-miR-769-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acuccagccccacagccucagc MIMAT0003888 hsa-miR-766-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uuugugaccugguccacua MIMAT0003889 mmu-miR-758-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gcgacccauacuugguuucag MIMAT0003890 mmu-miR-551b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cgugggccugacguggagcugg MIMAT0003891 mmu-miR-770-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ggggcuggggccgggacagagc MIMAT0003892 mmu-miR-762 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gcagcagggugaaacugacaca MIMAT0003893 mmu-miR-761 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ggugcucacauguccuccu MIMAT0003894 mmu-miR-764-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aggaggccauaguggcaacugu MIMAT0003895 mmu-miR-764-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gcagagugcaaacaauuuugac MIMAT0003897 mmu-miR-759 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cggcucugggucugugggga MIMAT0003898 mmu-miR-760-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggaggagaaggaaggugaug MIMAT0003945 hsa-miR-765 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uccaguaccacgugucagggcca MIMAT0003948 hsa-miR-770-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caguaacaaagauucauccuugu MIMAT0004185 hsa-miR-802 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cagugcaaugguauugucaaagc MIMAT0004186 mmu-miR-301b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugcggggcuagggcuaacagca MIMAT0004187 mmu-miR-744-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ucaguaacaaagauucauccuu MIMAT0004188 mmu-miR-802-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gaaagacaccaagcugaguaga MIMAT0004238 mmu-miR-743a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggugcggagagggcccacagug MIMAT0004284 hsa-miR-675-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aacauucauuguugucggugggu MIMAT0004324 mmu-miR-181d-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auguaugugugcaugugcaug MIMAT0004450 hsa-miR-297 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuauacaaucuacugucuuuc MIMAT0004481 hsa-let-7a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuauacaaccuacugccuuccc MIMAT0004482 hsa-let-7b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuauacgaccugcugccuuucu MIMAT0004484 hsa-let-7d-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuauacggccuccuagcuuucc MIMAT0004485 hsa-let-7e-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuauacaaucuauugccuuccc MIMAT0004486 hsa-let-7f-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuauacagucuacugucuuucc MIMAT0004487 hsa-let-7f-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caggccauauugugcugccuca MIMAT0004488 hsa-miR-15a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccaguauuaacugugcugcuga MIMAT0004489 hsa-miR-16-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aguuuugcauaguugcacuaca MIMAT0004490 hsa-miR-19a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aguuuugcagguuugcauccagc MIMAT0004491 hsa-miR-19b-1-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aguuuugcagguuugcauuuca MIMAT0004492 hsa-miR-19b-2-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acugcauuaugagcacuuaaag MIMAT0004493 hsa-miR-20a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caacaccagucgaugggcugu MIMAT0004494 hsa-miR-21-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aguucuucaguggcaagcuuua MIMAT0004495 hsa-miR-22-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gggguuccuggggaugggauuu MIMAT0004496 hsa-miR-23a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugccuacugagcugaaacacag MIMAT0004497 hsa-miR-24-2-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggcggagacuugggcaauug MIMAT0004498 hsa-miR-25-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccuauucuugguuacuugcacg MIMAT0004499 hsa-miR-26a-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccuguucuccauuacuuggcuc MIMAT0004500 hsa-miR-26b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agggcuuagcugcuugugagca MIMAT0004501 hsa-miR-27a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cacuagauugugagcuccugga MIMAT0004502 hsa-miR-28-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acugauuucuuuugguguucag MIMAT0004503 hsa-miR-29a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugcuaugccaacauauugccau MIMAT0004504 hsa-miR-31-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caauuuagugugugugauauuu MIMAT0004505 hsa-miR-32-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caauguuuccacagugcaucac MIMAT0004506 hsa-miR-33a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agguugggaucgguugcaaugcu MIMAT0004507 hsa-miR-92a-1-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggguggggauuuguugcauuac MIMAT0004508 hsa-miR-92a-2-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acugcugagcuagcacuucccg MIMAT0004509 hsa-miR-93-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaucaugugcagugccaauaug MIMAT0004510 hsa-miR-96-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caagcucgcuucuaugggucug MIMAT0004511 hsa-miR-99a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caagcuuguaucuauagguaug MIMAT0004512 hsa-miR-100-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caguuaucacagugcugaugcu MIMAT0004513 hsa-miR-101-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcugguuucauauggugguuuaga MIMAT0004514 hsa-miR-29b-1-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cugguuucacaugguggcuuag MIMAT0004515 hsa-miR-29b-2-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acggauguuugagcaugugcua MIMAT0004516 hsa-miR-105-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cugcaauguaagcacuucuuac MIMAT0004517 hsa-miR-106a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccaauauuacugugcugcuuua MIMAT0004518 hsa-miR-16-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence acuguacaggccacugccuugc MIMAT0004519 mmu-let-7g-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cugcgcaagcuacugccuugcu MIMAT0004520 mmu-let-7i-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cgaaucauuauuugcugcucua MIMAT0004521 mmu-miR-15b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence agagcuuagcugauuggugaac MIMAT0004522 mmu-miR-27b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gcugguuucauauggugguuua MIMAT0004523 mmu-miR-29b-1-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cugggauguggauguuuacguc MIMAT0004524 mmu-miR-30b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence caagcucgugucuguggguccg MIMAT0004525 mmu-miR-99b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ucaguuaucacagugcugaugc MIMAT0004526 mmu-miR-101a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cguguucacagcggaccuugau MIMAT0004527 mmu-miR-124-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence acaggugagguucuugggagcc MIMAT0004528 mmu-miR-125a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence acaagucagguucuugggaccu MIMAT0004529 mmu-miR-125b-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cugaagcucagagggcucugau MIMAT0004530 mmu-miR-127-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uauagggauuggagccguggcg MIMAT0004531 mmu-miR-135a-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aucaucgucucaaaugagucuu MIMAT0004532 mmu-miR-136-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence caucuuccagugcaguguugga MIMAT0004533 mmu-miR-141-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence auuccuggaaauacuguucuug MIMAT0004534 mmu-miR-145a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cugguacaggccugggggauag MIMAT0004535 mmu-miR-150-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ucgaggagcucacagucuagu MIMAT0004536 mmu-miR-151-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aaucauacacgguugaccuauu MIMAT0004537 mmu-miR-154-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cagauucgauucuaggggaaua MIMAT0004538 mmu-miR-10b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gugaauuaccgaagggccauaa MIMAT0004539 mmu-miR-183-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gcccuaaggugaauuuuuuggg MIMAT0004540 mmu-miR-186-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cucccacaugcaggguuugca MIMAT0004541 mmu-miR-188-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gcugcacuuggauuucguuccc MIMAT0004542 mmu-miR-191-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cugccaauuccauaggucacag MIMAT0004543 hsa-miR-192-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugggucuuugcgggcaagauga MIMAT0004544 mmu-miR-193a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence caucuuacugggcagcauugga MIMAT0004545 mmu-miR-200b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uuccuaugcauauacuucuuu MIMAT0004546 mmu-miR-202-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence agugguucuugacaguucaaca MIMAT0004547 mmu-miR-203-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aagcccuuaccccaaaaaguau MIMAT0004548 hsa-miR-129-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaguucugagacacuccgacu MIMAT0004549 hsa-miR-148a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cugggagaaggcuguuuacucu MIMAT0004550 hsa-miR-30c-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuuucagucagauguuugcugc MIMAT0004551 hsa-miR-30d-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggagacgcggcccuguuggagu MIMAT0004552 hsa-miR-139-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caacaaaucacagucugccaua MIMAT0004553 hsa-miR-7-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caacaaaucccagucuaccuaa MIMAT0004554 hsa-miR-7-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caaauucguaucuaggggaaua MIMAT0004555 hsa-miR-10a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acagauucgauucuaggggaau MIMAT0004556 hsa-miR-10b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caaucagcaaguauacugcccu MIMAT0004557 hsa-miR-34a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence accacugaccguugacuguacc MIMAT0004558 hsa-miR-181a-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaccaucgaccguugaguggac MIMAT0004559 hsa-miR-181c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gugaauuaccgaagggccauaa MIMAT0004560 hsa-miR-183-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggcuacaacacaggacccgggc MIMAT0004561 hsa-miR-187-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cggcaacaagaaacugccugag MIMAT0004562 hsa-miR-196a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acaguagucugcacauugguua MIMAT0004563 hsa-miR-199b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugccugucuacacuugcugugc MIMAT0004564 hsa-miR-214-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence augguuccgucaagcaccaugg MIMAT0004565 hsa-miR-218-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caugguucugucaagcaccgcg MIMAT0004566 hsa-miR-218-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agaguugagucuggacgucccg MIMAT0004567 hsa-miR-219a-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence accuggcauacaauguagauuu MIMAT0004568 hsa-miR-221-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cucaguagccaguguagauccu MIMAT0004569 hsa-miR-222-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cguguauuugacaagcugaguu MIMAT0004570 hsa-miR-223-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caucuuacugggcagcauugga MIMAT0004571 hsa-miR-200b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aaagugccgccuaguuuuaagccc MIMAT0004572 mmu-miR-290a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence acucaaacugugugacauuuug MIMAT0004573 mmu-miR-293-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence acucaaaauggaggcccuaucu MIMAT0004574 mmu-miR-294-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence acucaaauguggggcacacuuc MIMAT0004575 mmu-miR-295-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gaggguuggguggaggcucucc MIMAT0004576 mmu-miR-296-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uaugugggacgguaaaccgcuu MIMAT0004577 mmu-miR-299a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uugaagagagguuauccuuugu MIMAT0004578 mmu-miR-300-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence acuuaaacgugguuguacuugc MIMAT0004579 mmu-miR-302a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aaucacuaaccacacagccagg MIMAT0004580 mmu-miR-34c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aaucacuaacuccacugccauc MIMAT0004581 mmu-miR-34b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ccgcacuguggguacuugcugc MIMAT0004582 mmu-miR-106b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence acucuuucccuguugcacuacu MIMAT0004583 mmu-miR-130b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuguacaggccacugccuugc MIMAT0004584 hsa-let-7g-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cugcgcaagcuacugccuugcu MIMAT0004585 hsa-let-7i-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cgaaucauuauuugcugcucua MIMAT0004586 hsa-miR-15b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggguuccuggcaugcugauuu MIMAT0004587 hsa-miR-23b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agagcuuagcugauuggugaac MIMAT0004588 hsa-miR-27b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cugggagguggauguuuacuuc MIMAT0004589 hsa-miR-30b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aacgccauuaucacacuaaaua MIMAT0004590 hsa-miR-122-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cguguucacagcggaccuugau MIMAT0004591 hsa-miR-124-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acggguuaggcucuugggagcu MIMAT0004592 hsa-miR-125b-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uucacauugugcuacugucugc MIMAT0004593 hsa-miR-130a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence accguggcuuucgauuguuacu MIMAT0004594 hsa-miR-132-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uauagggauuggagccguggcg MIMAT0004595 hsa-miR-135a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcuauuucacgacaccaggguu MIMAT0004596 hsa-miR-138-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaccacaggguagaaccacgg MIMAT0004597 hsa-miR-140-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caucuuccaguacaguguugga MIMAT0004598 hsa-miR-141-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggugcagugcugcaucucuggu MIMAT0004599 hsa-miR-143-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggauaucaucauauacuguaag MIMAT0004600 hsa-miR-144-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggauuccuggaaauacuguucu MIMAT0004601 hsa-miR-145-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acaggugagguucuugggagcc MIMAT0004602 hsa-miR-125a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucacaagucaggcucuugggac MIMAT0004603 hsa-miR-125b-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cugaagcucagagggcucugau MIMAT0004604 hsa-miR-127-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aagcccuuaccccaaaaagcau MIMAT0004605 hsa-miR-129-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caucaucgucucaaaugagucu MIMAT0004606 hsa-miR-136-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcuacuucacaacaccagggcc MIMAT0004607 hsa-miR-138-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccucugaaauucaguucuucag MIMAT0004608 hsa-miR-146a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agggagggacgggggcugugc MIMAT0004609 hsa-miR-149-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cugguacaggccugggggacag MIMAT0004610 hsa-miR-150-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggggcuggcuuuccucugguc MIMAT0004611 hsa-miR-185-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcccaaaggugaauuuuuuggg MIMAT0004612 hsa-miR-186-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cucccacaugcaggguuugca MIMAT0004613 hsa-miR-188-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugggucuuugcgggcgagauga MIMAT0004614 hsa-miR-193a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccaauauuggcugugcugcucc MIMAT0004615 hsa-miR-195-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cugggagaggguuguuuacucc MIMAT0004616 mmu-miR-30c-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aaaguucugagacacuccgacu MIMAT0004617 mmu-miR-148a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ucggcaacaagaaacugccuga MIMAT0004618 mmu-miR-196a-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence caucuuaccggacagugcugga MIMAT0004619 mmu-miR-200a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cuauacaaucuacugucuuucc MIMAT0004620 mmu-let-7a-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cuauacaaccuacugccuuccc MIMAT0004621 mmu-let-7b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cuguacaaccuucuagcuuucc MIMAT0004622 mmu-let-7c-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cuauacaaucuauugccuuccc MIMAT0004623 mmu-let-7f-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence caggccauacugugcugccuca MIMAT0004624 mmu-miR-15a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ccaguauugacugugcugcuga MIMAT0004625 mmu-miR-16-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence acugcccuaagugcuccuucug MIMAT0004626 mmu-miR-18a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence acugcauuacgagcacuuaaag MIMAT0004627 mmu-miR-20a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence caacagcagucgaugggcuguc MIMAT0004628 mmu-miR-21a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aguucuucaguggcaagcuuua MIMAT0004629 mmu-miR-22-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ccuguucuccauuacuuggcuc MIMAT0004630 mmu-miR-26b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence acugauuucuuuugguguucag MIMAT0004631 mmu-miR-29a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugaccgauuucuccugguguuc MIMAT0004632 mmu-miR-29c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence agggcuuagcugcuugugagca MIMAT0004633 mmu-miR-27a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugcuaugccaacauauugccauc MIMAT0004634 mmu-miR-31-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence agguggggauugguggcauuac MIMAT0004635 mmu-miR-92a-2-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence acugcugagcuagcacuucccg MIMAT0004636 mmu-miR-93-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aggugguccguggcgcguucgc MIMAT0004637 rno-miR-323-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aggugguccguggcgcguucgc MIMAT0004638 mmu-miR-323-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uuuauugagcaccuccuaucaa MIMAT0004639 rno-miR-325-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uuuauugagcaccuccuaucaa MIMAT0004640 mmu-miR-325-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ucucugggccugugucuuaggc MIMAT0004641 rno-miR-330-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ucucugggccugugucuuaggc MIMAT0004642 mmu-miR-330-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cuagguauggucccagggaucc MIMAT0004643 mmu-miR-331-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cggcgucaugcaggaguugauu MIMAT0004644 mmu-miR-337-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence gaaguucuguuauacacucagg MIMAT0004645 rno-miR-148b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aacaauauccuggugcugagug MIMAT0004646 rno-miR-338-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aacaauauccuggugcugagug MIMAT0004647 mmu-miR-338-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ugagcgccucgacgacagagcca MIMAT0004648 rno-miR-339-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugagcgccucggcgacagagccg MIMAT0004649 mmu-miR-339-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uuauaaagcaaugagacugauu MIMAT0004650 rno-miR-340-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uuauaaagcaaugagacugauu MIMAT0004651 mmu-miR-340-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aggggugcuaucugugauugag MIMAT0004652 rno-miR-342-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aggggugcuaucugugauugag MIMAT0004653 mmu-miR-342-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cccugaacuaggggucuggaga MIMAT0004655 rno-miR-345-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ccugaacuaggggucuggagac MIMAT0004656 mmu-miR-345-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cgucuuacccagcaguguuugg MIMAT0004657 hsa-miR-200c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuccuacauauuagcauuaaca MIMAT0004658 hsa-miR-155-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence caaauucguaucuaggggaaua MIMAT0004659 mmu-miR-10a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uaguuuugcauaguugcacuac MIMAT0004660 mmu-miR-19a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cacuagauugugagcugcugga MIMAT0004661 mmu-miR-28a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uggagacgcggcccuguuggag MIMAT0004662 mmu-miR-139-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cgucuuacccagcaguguuugg MIMAT0004663 mmu-miR-200c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugccugucuacacuugcugugc MIMAT0004664 mmu-miR-214-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aaacaugguuccgucaagcacc MIMAT0004665 mmu-miR-218-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence caauguuuccacagugcaucac MIMAT0004666 mmu-miR-33-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence acaguagucugcacauugguua MIMAT0004667 mmu-miR-199b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cggcuacuucacaacaccaggg MIMAT0004668 mmu-miR-138-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence acggguuaggcucuugggagcu MIMAT0004669 mmu-miR-125b-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence caacaaaucacagucugccaua MIMAT0004670 mmu-miR-7a-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccaguggggcugcuguuaucug MIMAT0004671 hsa-miR-194-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccgcacuguggguacuugcugc MIMAT0004672 hsa-miR-106b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugaccgauuucuccugguguuc MIMAT0004673 hsa-miR-29c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cugggagaggguuguuuacucc MIMAT0004674 hsa-miR-30c-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agaauuguggcuggacaucugu MIMAT0004675 hsa-miR-219a-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caaucacuaacuccacugccau MIMAT0004676 hsa-miR-34b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaucacuaaccacacggccagg MIMAT0004677 hsa-miR-34c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caagcucgugucuguggguccg MIMAT0004678 hsa-miR-99b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaggguuggguggaggcucucc MIMAT0004679 hsa-miR-296-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acucuuucccuguugcacuac MIMAT0004680 hsa-miR-130b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccuauucuugauuacuuguuuc MIMAT0004681 hsa-miR-26a-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucccccaggugugauucugauuu MIMAT0004682 hsa-miR-361-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aacacaccuauucaaggauuca MIMAT0004683 hsa-miR-362-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aacacaccuguucaaggauuca MIMAT0004684 mmu-miR-362-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acuuuaacauggaggcacuugc MIMAT0004685 hsa-miR-302d-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acuguugcuaauaugcaacucu MIMAT0004686 hsa-miR-367-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acucaaacugugggggcacu MIMAT0004687 hsa-miR-371a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuuaucagauuguauuguaauu MIMAT0004688 hsa-miR-374a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agagguugcccuuggugaauuc MIMAT0004689 hsa-miR-377-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uauguaacaugguccacuaacu MIMAT0004690 hsa-miR-379-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ucauucacggacaacacuuuuu MIMAT0004691 mmu-miR-382-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuauaaagcaaugagacugauu MIMAT0004692 hsa-miR-340-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucucugggccugugucuuaggc MIMAT0004693 hsa-miR-330-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggggugcuaucugugauuga MIMAT0004694 hsa-miR-342-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaacggcuucauacaggaguu MIMAT0004695 hsa-miR-337-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggugguccguggcgcguucgc MIMAT0004696 hsa-miR-323a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucgaggagcucacagucuagu MIMAT0004697 hsa-miR-151a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auguagggcuaaaagccauggg MIMAT0004698 hsa-miR-135b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaguucuguuauacacucaggc MIMAT0004699 hsa-miR-148b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuagguauggucccagggaucc MIMAT0004700 hsa-miR-331-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aacaauauccuggugcugagug MIMAT0004701 hsa-miR-338-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugagcgccucgacgacagagccg MIMAT0004702 hsa-miR-339-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuuuucauuauugcuccugacc MIMAT0004703 hsa-miR-335-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uuuuucauuauugcuccugacc MIMAT0004704 mmu-miR-335-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cuauacaaccuacugccuuccc MIMAT0004705 rno-let-7b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cuauacggccuccuagcuuucc MIMAT0004706 rno-let-7e-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cugcgcaagcuacugccuugcu MIMAT0004707 rno-let-7i-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence auaaagcuagauaaccgaaagu MIMAT0004708 rno-miR-9a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence caaauucguaucuaggggaaua MIMAT0004709 rno-miR-10a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence acugcagugaaggcacuugugg MIMAT0004710 rno-miR-17-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence caacagcagucgaugggcuguc MIMAT0004711 rno-miR-21-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence gggguuccuggggaugggauuu MIMAT0004712 rno-miR-23a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aggcggagacacgggcaauugc MIMAT0004713 rno-miR-25-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ccuguucuccauuacuuggcuc MIMAT0004714 rno-miR-26b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence agggcuuagcugcuugugagca MIMAT0004715 rno-miR-27a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cacuagauugugagcuccugga MIMAT0004716 rno-miR-28-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cugguuucacaugguggcuuag MIMAT0004717 rno-miR-29b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence acugauuucuuuugguguucag MIMAT0004718 rno-miR-29a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cugggagaggguuguuuacucc MIMAT0004719 rno-miR-30c-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cuuucagucggauguuuacagc MIMAT0004720 rno-miR-30e-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cugggauguggauguuuacguc MIMAT0004721 rno-miR-30b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cuuucagucagauguuugcugc MIMAT0004722 rno-miR-30d-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aaucacuaaccacacagccagg MIMAT0004723 rno-miR-34c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence caagcucguuucuaugggucug MIMAT0004724 rno-miR-99a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence caagcucgugucuguggguccg MIMAT0004725 rno-miR-99b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ucaguuaucacagugcugaugc MIMAT0004726 rno-miR-101a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ccgcacuguggguacuugcugc MIMAT0004727 rno-miR-106b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cguguucacagcggaccuugau MIMAT0004728 rno-miR-124-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence acaggugagguucuugggagcc MIMAT0004729 rno-miR-125a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence acggguuaggcucuugggagcu MIMAT0004730 rno-miR-125b-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uguagggauggaagccaugaaa MIMAT0004732 rno-miR-135a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence caucaucgucucaaaugagucu MIMAT0004733 rno-miR-136-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cggcuacuucacaacaccaggg MIMAT0004734 rno-miR-138-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uggagacgcggcccuguuggag MIMAT0004735 rno-miR-139-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ugggucuuugcgggcaagauga MIMAT0004736 rno-miR-193a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ucggcaacaagaaacugccuga MIMAT0004737 rno-miR-196a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence acaguagucugcacauugguua MIMAT0004738 rno-miR-199a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence gcugggaaggcaaagggacguu MIMAT0004739 rno-miR-204-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence caugguucugucaagcaccgcg MIMAT0004740 rno-miR-218a-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence agaguugcgucuggacgucccg MIMAT0004741 rno-miR-219a-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence gaggguuggguggaggcucucc MIMAT0004742 rno-miR-296-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uugaagagagguuauccuuugu MIMAT0004743 rno-miR-300-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uguaaacaauuccuaggcaaugu MIMAT0004745 mmu-miR-384-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence agguuacccgagcaacuuugcau MIMAT0004746 mmu-miR-409-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uaguagaccguauagcguacg MIMAT0004747 mmu-miR-411-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugaggggcagagagcgagacuuu MIMAT0004748 hsa-miR-423-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caaaacgugaggcgcugcuau MIMAT0004749 hsa-miR-424-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aaugacacgaucacucccguuga MIMAT0004750 mmu-miR-425-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugcccuaaaugccccuucuggc MIMAT0004751 hsa-miR-18b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acuguaguaugggcacuuccag MIMAT0004752 hsa-miR-20b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence caggucgucuugcagggcuucu MIMAT0004753 mmu-miR-431-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caggucgucuugcagggcuucu MIMAT0004757 hsa-miR-431-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aaccaguaccuuucugagaaga MIMAT0004760 mmu-miR-470-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aagacgggaggaaagaagggag MIMAT0004761 hsa-miR-483-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cggggcagcucaguacaggau MIMAT0004762 hsa-miR-486-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uugaaaggcuauuucuugguc MIMAT0004763 hsa-miR-488-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccauggaucuccaggugggu MIMAT0004764 hsa-miR-490-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuuaugcaagauucccuucuac MIMAT0004765 hsa-miR-491-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugcccuguggacucaguucugg MIMAT0004766 hsa-miR-146b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cgggguuuugagggcgagauga MIMAT0004767 hsa-miR-193b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caaaccacacugugguguuaga MIMAT0004768 hsa-miR-497-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uucucgaggaaagaagcacuuuc MIMAT0004770 hsa-miR-516a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aacaucacagcaagucugugcu MIMAT0004772 hsa-miR-499a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaauccuugcuaccugggugaga MIMAT0004773 hsa-miR-500a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaugcacccgggcaaggauucu MIMAT0004774 hsa-miR-501-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaugcaccugggcaaggauuca MIMAT0004775 hsa-miR-502-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gggagccaggaaguauugaugu MIMAT0004776 hsa-miR-505-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaaauuucaccuuucugagaagg MIMAT0004777 hsa-miR-513a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uacuccagagggcgucacucaug MIMAT0004778 hsa-miR-508-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uacugcagacaguggcaauca MIMAT0004779 hsa-miR-509-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccucccacacccaaggcuugca MIMAT0004780 hsa-miR-532-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ccucccacacccaaggcuugca MIMAT0004781 mmu-miR-532-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aagacgggagaagagaagggag MIMAT0004782 mmu-miR-483-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcaguccaugggcauauacac MIMAT0004784 hsa-miR-455-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucaguaaauguuuauuagauga MIMAT0004785 hsa-miR-545-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aaguugcccgcguguuuuucg MIMAT0004787 rno-miR-543-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence acugcagugugagcacuucuag MIMAT0004788 mmu-miR-20b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence auuggggaugcuuugcauucau MIMAT0004789 mmu-miR-450a-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gaguauuguuuccacugccugg MIMAT0004790 mmu-miR-503-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cuauguaacaugguccacuaac MIMAT0004791 rno-miR-379-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agggacgggacgcggugcagug MIMAT0004792 hsa-miR-92b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auauuaccauuagcucaucuuu MIMAT0004793 hsa-miR-556-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaaaucaagcgugggugagacc MIMAT0004794 hsa-miR-551b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugagugugugugugugagugugu MIMAT0004795 hsa-miR-574-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aagauguggaaaaauuggaauc MIMAT0004796 hsa-miR-576-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaacugguugaacaacugaacc MIMAT0004797 hsa-miR-582-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaaguaauugugguuuuggcc MIMAT0004798 hsa-miR-548b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugagaaccacgucugcucugag MIMAT0004799 hsa-miR-589-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agugccugagggaguaagagccc MIMAT0004800 hsa-miR-550a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaauuuuauguauaagcuagu MIMAT0004801 hsa-miR-590-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugucucugcugggguuucu MIMAT0004802 hsa-miR-593-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaaguaauugcgaguuuuacc MIMAT0004803 hsa-miR-548a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggggguccccggugcucggauc MIMAT0004804 hsa-miR-615-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agucauuggaggguuugagcag MIMAT0004805 hsa-miR-616-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaaguaauugcgguuuuugcc MIMAT0004806 hsa-miR-548c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cacaagguauugguauuaccu MIMAT0004807 hsa-miR-624-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gacuauagaacuuucccccuca MIMAT0004808 hsa-miR-625-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence augcugacauauuuacuagagg MIMAT0004809 hsa-miR-628-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggguuuacguugggagaacu MIMAT0004810 hsa-miR-629-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cagugccucggcagugcagccc MIMAT0004811 hsa-miR-33b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaaguaauugugguuuuugcc MIMAT0004812 hsa-miR-548d-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uauguaacacgguccacuaacc MIMAT0004813 hsa-miR-411-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaugucugcugaccaucaccuu MIMAT0004814 hsa-miR-654-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uccgguucucagggcuccacc MIMAT0004819 hsa-miR-671-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cuguugccacuaaccucaaccu MIMAT0004820 mmu-miR-744-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uccgguucucagggcuccacc MIMAT0004821 mmu-miR-671-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence agcaccacgugucugggccacg MIMAT0004822 mmu-miR-770-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugaggggcagagagcgagacuuu MIMAT0004825 mmu-miR-423-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gcccuagggacucaguucuggu MIMAT0004826 mmu-miR-146b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uauacauacacacauacccaua MIMAT0004827 mmu-miR-297b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aaggagcuuacaaucuagcuggg MIMAT0004828 mmu-miR-708-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ggggguccccggugcucggauc MIMAT0004837 mmu-miR-615-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uguucagacugguguccauca MIMAT0004839 mmu-miR-743b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gaaagacaucaugcugaauaga MIMAT0004840 mmu-miR-743b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uauucagauuagugccagucaug MIMAT0004841 mmu-miR-871-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugauauguuugauauuggguu MIMAT0004852 mmu-miR-190b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cugcccuggcccgagggaccga MIMAT0004853 mmu-miR-874-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uggauuucucugugaaucacua MIMAT0004854 mmu-miR-876-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uagugguuuacaaaguaauuca MIMAT0004855 mmu-miR-876-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ccaagugcucagaugcuuguggu MIMAT0004856 mmu-miR-105 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gugugcggaaaugcuucugcua MIMAT0004857 mmu-miR-147-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uaaggugcaucuagugcuguuag MIMAT0004858 mmu-miR-18b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aacuggcccacaaagucccgcu MIMAT0004859 mmu-miR-193b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence guagaggagauggcgcaggg MIMAT0004861 mmu-miR-877-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uguccucuucucccuccuccca MIMAT0004862 mmu-miR-877-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uauacauacacacauacccaua MIMAT0004864 mmu-miR-297a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence auguaugugugcauguacaugu MIMAT0004865 mmu-miR-297c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uauacauacacacauacccaua MIMAT0004866 mmu-miR-297c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aucaacagacauuaauugggcgc MIMAT0004869 mmu-miR-421-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uacgugugugugcaugugcaug MIMAT0004881 mmu-miR-466f-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cauacacacacacauacacac MIMAT0004882 mmu-miR-466f-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence auacagacacaugcacacaca MIMAT0004883 mmu-miR-466g A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugugugcaugugcuugugugua MIMAT0004884 mmu-miR-466h-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uaagugcgugcauguauaugug MIMAT0004885 mmu-miR-467c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uaagugcgcgcauguauaugcg MIMAT0004886 mmu-miR-467d-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence auauacauacacacaccuacac MIMAT0004887 mmu-miR-467d-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugaagguccuacugugugccagg MIMAT0004888 mmu-miR-493-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence agacccuggucugcacucuauc MIMAT0004889 mmu-miR-504-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uacuccagaauguggcaaucau MIMAT0004890 mmu-miR-509-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugauugacauuucuguaaugg MIMAT0004891 mmu-miR-509-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence auguauaaauguauacacac MIMAT0004892 mmu-miR-568 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugagugugugugugugagugugu MIMAT0004893 mmu-miR-574-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cacgcucaugcacacacccaca MIMAT0004894 mmu-miR-574-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gagcuuauucauaaaagugcag MIMAT0004895 mmu-miR-590-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uaauuuuauguauaagcuagu MIMAT0004896 mmu-miR-590-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugguaagcugcagaacaugugu MIMAT0004897 mmu-miR-654-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uaugucugcugaccaucaccuu MIMAT0004898 mmu-miR-654-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uauugcacucgucccggccucc MIMAT0004899 mmu-miR-92b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agcagaagcagggagguucuccca MIMAT0004901 hsa-miR-298 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugcaacgaaccugagccacuga MIMAT0004902 hsa-miR-891a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uauacaagggcagacucucucu MIMAT0004903 hsa-miR-300 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cacuguguccuuucugcguag MIMAT0004907 hsa-miR-892a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuuugcaauauguuccugaaua MIMAT0004909 hsa-miR-450b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uugggaucauuuugcauccaua MIMAT0004910 hsa-miR-450b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cugcccuggcccgagggaccga MIMAT0004911 hsa-miR-874-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uacuuggaaaggcaucaguug MIMAT0004912 hsa-miR-890 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugcaacuuaccugagucauuga MIMAT0004913 hsa-miR-891b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uacucaaaaagcugucaguca MIMAT0004916 hsa-miR-888-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gacugacaccucuuugggugaa MIMAT0004917 hsa-miR-888-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cacuggcuccuuucuggguaga MIMAT0004918 hsa-miR-892b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaggauucugcugucggucccacu MIMAT0004919 hsa-miR-541-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggugggcacagaaucuggacu MIMAT0004920 hsa-miR-541-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuaauaucggacaaccauugu MIMAT0004921 hsa-miR-889-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uauaccucaguuuuaucaggug MIMAT0004922 hsa-miR-875-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccuggaaacacugagguugug MIMAT0004923 hsa-miR-875-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggauuucuuugugaaucacca MIMAT0004924 hsa-miR-876-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggugguuuacaaaguaauuca MIMAT0004925 hsa-miR-876-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaggagcuuacaaucuagcuggg MIMAT0004926 hsa-miR-708-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caacuagacugugagcuucuag MIMAT0004927 hsa-miR-708-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gugugcggaaaugcuucugcua MIMAT0004928 hsa-miR-147b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugauauguuugauauuggguu MIMAT0004929 hsa-miR-190b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugugugugcguacauguacaug MIMAT0004930 mmu-miR-466d-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uauacauacacgcacacauag MIMAT0004931 mmu-miR-466d-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gcaggaacuugugagucuccu MIMAT0004936 mmu-miR-873a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uauaccucaguuuuaucaggug MIMAT0004937 mmu-miR-875-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ccugaaaauacugaggcuaug MIMAT0004938 mmu-miR-875-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence auaagacgaacaaaagguuugu MIMAT0004939 mmu-miR-208b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence augccuuuugcucugcacuca MIMAT0004940 mmu-miR-511-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence auucugcauuuuuagcaagcuc MIMAT0004941 mmu-miR-544-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uacgucaucgucgucaucguua MIMAT0004942 mmu-miR-598-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence guguugaaacaaucucuacug MIMAT0004943 mmu-miR-653-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugcggggcuagggcuaacagca MIMAT0004945 hsa-miR-744-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuguugccacuaaccucaaccu MIMAT0004946 hsa-miR-744-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uccauuacacuacccugccucu MIMAT0004947 hsa-miR-885-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggcagcgggguguaguggaua MIMAT0004948 hsa-miR-885-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence guagaggagauggcgcaggg MIMAT0004949 hsa-miR-877-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uccucuucucccuccucccag MIMAT0004950 hsa-miR-877-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gugaacgggcgccaucccgagg MIMAT0004951 hsa-miR-887-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence accaggaggcugaggccccu MIMAT0004952 hsa-miR-665 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcaggaacuugugagucuccu MIMAT0004953 hsa-miR-873-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaacauucgcggugcacuucuu MIMAT0004954 hsa-miR-543 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auauaauacaaccugcuaagug MIMAT0004955 hsa-miR-374b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuuagcagguuguauuaucauu MIMAT0004956 hsa-miR-374b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cggcucugggucugugggga MIMAT0004957 hsa-miR-760 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cagugcaaugauauugucaaagc MIMAT0004958 hsa-miR-301b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaucucugcaggcaaauguga MIMAT0004959 hsa-miR-216b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auaagacgaacaaaagguuugu MIMAT0004960 hsa-miR-208b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggggagcuguggaagcagua MIMAT0004970 hsa-miR-920 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuagugagggacagaaccaggauuc MIMAT0004971 hsa-miR-921 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcagcagagaauaggacuacguc MIMAT0004972 hsa-miR-922 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agagucuugugaugucuugc MIMAT0004974 hsa-miR-924 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uacugcagacguggcaaucaug MIMAT0004975 hsa-miR-509-3-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugugcgcagggagaccucuccc MIMAT0004976 hsa-miR-933 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugucuacuacuggagacacugg MIMAT0004977 hsa-miR-934 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccaguuaccgcuuccgcuaccgc MIMAT0004978 hsa-miR-935 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acaguagagggaggaaucgcag MIMAT0004979 hsa-miR-936 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auccgcgcucugacucucugcc MIMAT0004980 hsa-miR-937-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugcccuuaaaggugaacccagu MIMAT0004981 hsa-miR-938 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggggagcugaggcucugggggug MIMAT0004982 hsa-miR-939-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaggcagggcccccgcucccc MIMAT0004983 hsa-miR-940 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cacccggcugugugcacaugugc MIMAT0004984 hsa-miR-941 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucuucucuguuuuggccaugug MIMAT0004985 hsa-miR-942-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cugacuguugccguccuccag MIMAT0004986 hsa-miR-943 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaauuauuguacaucggaugag MIMAT0004987 hsa-miR-944 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uauguguguguguauguccaug MIMAT0005278 rno-miR-466b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ugugauguguguauguacaug MIMAT0005279 rno-miR-466c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence gaaagacaccauacugaauaga MIMAT0005280 rno-miR-743b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uauucagauuggugccggucacau MIMAT0005281 rno-miR-871-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cugcccuggcccgagggaccga MIMAT0005284 rno-miR-874-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence guagaggagauggcgcaggg MIMAT0005285 rno-miR-877 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence auacaguuguucaaccaguuac MIMAT0005291 mmu-miR-582-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uaaccuguugaacaacugaac MIMAT0005292 mmu-miR-582-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence auaagugugagcauguauaugu MIMAT0005293 mmu-miR-467e-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence auauacauacacacaccuauau MIMAT0005294 mmu-miR-467e-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence guggauauuccuucuauguuua MIMAT0005295 mmu-miR-376c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence gugugcggaaaugcuucugcua MIMAT0005297 rno-miR-147 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aacauucauuguugucggugggu MIMAT0005299 rno-miR-181d-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uuuggcaaugguagaacucacaccg MIMAT0005300 rno-miR-182 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence caucccuugcaugguggaggg MIMAT0005301 rno-miR-188-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ugauauguuugauauuagguu MIMAT0005302 rno-miR-190b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uagguaguuucguguuguuggg MIMAT0005303 rno-miR-196c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cagugcaaugguauugucaaagc MIMAT0005304 rno-miR-301b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uuuguucguucggcucgcguga MIMAT0005307 rno-miR-375-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence augguugaccauagaacaugcg MIMAT0005308 rno-miR-380-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uguaaacaauuccuaggcaaugu MIMAT0005309 rno-miR-384-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence auuccuagaaauuguucacaau MIMAT0005310 rno-miR-384-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aauauaacacagauggccugu MIMAT0005311 rno-miR-410-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uaguagaccguauagcguacg MIMAT0005312 rno-miR-411-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence agcucggucugaggccccucagu MIMAT0005313 rno-miR-423-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aaugacacgaucacucccguuga MIMAT0005314 rno-miR-425-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uaugugccuuuggacuacaucg MIMAT0005316 rno-miR-455-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ucaggcucaguccccucccgau MIMAT0005319 rno-miR-484 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aaacaaacauggugcacuucuu MIMAT0005320 rno-miR-495 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aaugcaccugggcaaggguuca MIMAT0005321 rno-miR-500-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence caugccuugaguguaggacugu MIMAT0005322 rno-miR-532-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ccucccacacccaaggcuugca MIMAT0005323 rno-miR-532-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence gcggugaugccgauggugcgag MIMAT0005324 rno-miR-598-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uacgucaucgucgucaucguua MIMAT0005325 rno-miR-598-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uccgguucucagggcuccacc MIMAT0005326 rno-miR-671 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aaggagcuuacaaucuagcuggg MIMAT0005331 rno-miR-708-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence caacuagacugugagcuucuag MIMAT0005332 rno-miR-708-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence gaaagacgccaaacuggguaga MIMAT0005334 rno-miR-743a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uuugugaccugguccacuaacc MIMAT0005335 rno-miR-758-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ccccucaggccaccagagcccg MIMAT0005336 rno-miR-760-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cggcucugggucugugggga MIMAT0005337 rno-miR-760-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence agcaccacgugucugggccacg MIMAT0005338 rno-miR-770-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence gcaggaacuugugagucuccu MIMAT0005339 rno-miR-873-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uauugcacucgucccggccucc MIMAT0005340 rno-miR-92b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uugaaaggcuguuucuugguc MIMAT0005341 rno-miR-488-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aauggcgccacuaggguugug MIMAT0005342 rno-miR-652-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cugggagaaggcuguuuacucu MIMAT0005438 mmu-miR-30c-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cuauacaaucuacugucuuucc MIMAT0005439 mmu-let-7c-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gugccuacugagcugaaacagu MIMAT0005440 mmu-miR-24-2-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence gugccuacugagcugaaacagu MIMAT0005441 rno-miR-24-2-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cugggagaaggcuguuuacucu MIMAT0005442 rno-miR-30c-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence accgaccguugacuguaccuug MIMAT0005443 mmu-miR-181a-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence caugguucugucaagcaccgcg MIMAT0005444 mmu-miR-218-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uuucauauggugguuuagauuu MIMAT0005445 rno-miR-29b-1-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence agaauuguggcuggacaucugu MIMAT0005446 rno-miR-219a-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aggcaguguuguuagcuggc MIMAT0005447 mmu-miR-449b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence guaagugccugcauguauaug MIMAT0005448 mmu-miR-467b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cucuagagggaagcgcuuucug MIMAT0005449 hsa-miR-523-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cucuagagggaagcgcuuucug MIMAT0005450 hsa-miR-518e-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cucuagagggaagcgcuuucug MIMAT0005451 hsa-miR-522-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cucuagagggaagcgcuuucug MIMAT0005452 hsa-miR-519a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cucuagagggaagcgcuuucug MIMAT0005454 hsa-miR-519b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cucuagagggaagcacuuucug MIMAT0005455 hsa-miR-520c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cucuagagggaagcacuuucug MIMAT0005456 hsa-miR-518d-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cugcaaagggaagcccuuuc MIMAT0005457 hsa-miR-518a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gugaggacucgggaggugg MIMAT0005458 hsa-miR-1224-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccccaccuccucucuccucag MIMAT0005459 hsa-miR-1224-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gugaggacuggggagguggag MIMAT0005460 mmu-miR-1224-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence guggguacggcccagugggggg MIMAT0005572 hsa-miR-1225-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugagccccugugccgcccccag MIMAT0005573 hsa-miR-1225-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gugagggcaugcaggccuggaugggg MIMAT0005576 hsa-miR-1226-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucaccagcccuguguucccuag MIMAT0005577 hsa-miR-1226-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cgugccacccuuuuccccag MIMAT0005580 hsa-miR-1227-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gugggcgggggcaggugugug MIMAT0005582 hsa-miR-1228-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucacaccugccucgcccccc MIMAT0005583 hsa-miR-1228-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cucucaccacugcccucccacag MIMAT0005584 hsa-miR-1229-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gugucugggcggacagcugc MIMAT0005586 hsa-miR-1231 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugagcccuguccucccgcag MIMAT0005588 hsa-miR-1233-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucggccugaccacccaccccac MIMAT0005589 hsa-miR-1234-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccucuuccccuugucucuccag MIMAT0005591 hsa-miR-1236-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uccuucugcuccgucccccag MIMAT0005592 hsa-miR-1237-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuuccucgucugucugcccc MIMAT0005593 hsa-miR-1238-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ugagaacugaauuccauaggcugu MIMAT0005595 rno-miR-146b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ggcgacccauacuugguuucagu MIMAT0005596 rno-miR-551b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uucacaaggaggugucauuuau MIMAT0005788 hsa-miR-513b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uucucaaggaggugucguuuau MIMAT0005789 hsa-miR-513c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caagucuuauuugagcaccuguu MIMAT0005791 hsa-miR-1264 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaagcuggguugagagggcaa MIMAT0005792 hsa-miR-320b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaagcuggguugagagggu MIMAT0005793 hsa-miR-320c A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuagggcccuggcuccaucucc MIMAT0005794 hsa-miR-1296-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucaaaacugaggggcauuuucu MIMAT0005795 hsa-miR-1323 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuuggcaccuagcaagcacuca MIMAT0005796 hsa-miR-1271-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uugcagcugccugggagugacuuc MIMAT0005797 hsa-miR-1301-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agaggauacccuuuguauguu MIMAT0005798 hsa-miR-1185-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucuacaaaggaaagcgcuuucu MIMAT0005799 hsa-miR-1283 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uucauucggcuguccagaugua MIMAT0005800 hsa-miR-1298-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uugcucacuguucuucccuag MIMAT0005823 hsa-miR-1178-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aagcauucuuucauugguugg MIMAT0005824 hsa-miR-1179 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuuccggcucgcgugggugugu MIMAT0005825 hsa-miR-1180-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccgucgccgccacccgagccg MIMAT0005826 hsa-miR-1181 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gagggucuugggagggaugugac MIMAT0005827 hsa-miR-1182 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cacuguaggugauggugagagugggca MIMAT0005828 hsa-miR-1183 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccugcagcgacuugauggcuucc MIMAT0005829 hsa-miR-1184 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uauaaauacaugcacacauauu MIMAT0005830 mmu-miR-466l-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uaugcauauacacgcaugcaa MIMAT0005831 mmu-miR-669k-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugcauuguauguguugacaugau MIMAT0005832 mmu-miR-669g A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence acuugugugugcauguauaugu MIMAT0005833 mmu-miR-669d-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence auacacacacacauacacacua MIMAT0005834 mmu-miR-466i-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uacauacuucuuuacauucca MIMAT0005835 mmu-miR-1b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugcauauacucacaugcaaaca MIMAT0005838 mmu-miR-669j A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cauauacauacacacacacguau MIMAT0005839 mmu-miR-669f-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugcauauacacacaugcauac MIMAT0005840 mmu-miR-669i A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence augcauggguguauaguugagugc MIMAT0005841 mmu-miR-669h-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uaugcauauacacacaugcaca MIMAT0005842 mmu-miR-669h-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence auauacacacacacaccuaca MIMAT0005846 mmu-miR-467f A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugugugcaugugcauguguguaa MIMAT0005848 mmu-miR-466j A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uaggucacccguuuuacuauc MIMAT0005851 mmu-miR-1193-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugucuugugugugcauguucau MIMAT0005853 mmu-miR-669e-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uauacauacacacacauauau MIMAT0005854 mmu-miR-467g A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence auaagugugugcauguauaugu MIMAT0005855 mmu-miR-467h A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uaggacacauggucuacuucu MIMAT0005858 mmu-miR-1197-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ucugagucccggucgcgcgg MIMAT0005860 mmu-miR-1199-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuccugagccauucugagccuc MIMAT0005863 hsa-miR-1200 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gugccagcugcagugggggag MIMAT0005865 hsa-miR-1202 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cccggagccaggaugcagcuc MIMAT0005866 hsa-miR-1203 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gguggcccggccgugccugagg MIMAT0005867 hsa-miR-663b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucguggccuggucuccauuau MIMAT0005868 hsa-miR-1204 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucugcaggguuugcuuugag MIMAT0005869 hsa-miR-1205 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uguucauguagauguuuaagc MIMAT0005870 hsa-miR-1206 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggcagggaggcugggagggg MIMAT0005871 hsa-miR-1207-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucagcuggcccucauuuc MIMAT0005872 hsa-miR-1207-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucacuguucagacaggcgga MIMAT0005873 hsa-miR-1208 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaaacugagacuacuuuugca MIMAT0005874 hsa-miR-548e-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaaguaauugcggucuuuggu MIMAT0005875 hsa-miR-548j-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucugggcaacaaagugagaccu MIMAT0005876 hsa-miR-1285-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugcaggaccaagaugagcccu MIMAT0005877 hsa-miR-1286 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugcuggaucagugguucgaguc MIMAT0005878 hsa-miR-1287-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggaguccaggaaucugcauuuu MIMAT0005879 hsa-miR-1289 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggauuuuuggaucaggga MIMAT0005880 hsa-miR-1290 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggcccugacugaagaccagcagu MIMAT0005881 hsa-miR-1291 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaaguacuugcggauuuugcu MIMAT0005882 hsa-miR-548k A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggguggucuggagauuugugc MIMAT0005883 hsa-miR-1293 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugugagguuggcauuguugucu MIMAT0005884 hsa-miR-1294 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuaggccgcagaucuggguga MIMAT0005885 hsa-miR-1295a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uucaaguaauucaggug MIMAT0005886 hsa-miR-1297 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uucuggaauucugugugaggga MIMAT0005887 hsa-miR-1299 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaaguauuugcggguuuuguc MIMAT0005889 hsa-miR-548l A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uugggacauacuuaugcuaaa MIMAT0005890 hsa-miR-1302 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuuagagacggggucuugcucu MIMAT0005891 hsa-miR-1303 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuugaggcuacagugagaugug MIMAT0005892 hsa-miR-1304-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuuucaacucuaaugggagaga MIMAT0005893 hsa-miR-1305 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aacuggaucaauuauaggagug MIMAT0005894 hsa-miR-1243 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaaacuguaauuacuuuu MIMAT0005895 hsa-miR-548f-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaguaguugguuuguaugagaugguu MIMAT0005896 hsa-miR-1244 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aagugaucuaaaggccuacau MIMAT0005897 hsa-miR-1245a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aauggauuuuuggagcagg MIMAT0005898 hsa-miR-1246 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acccgucccguucguccccgga MIMAT0005899 hsa-miR-1247-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence accuucuuguauaagcacugugcuaaa MIMAT0005900 hsa-miR-1248 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acgcccuucccccccuucuuca MIMAT0005901 hsa-miR-1249-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acggugcuggauguggccuuu MIMAT0005902 hsa-miR-1250-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acucuagcugccaaaggcgcu MIMAT0005903 hsa-miR-1251-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agagaagaagaucagccugca MIMAT0005904 hsa-miR-1253 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agccuggaagcuggagccugcagu MIMAT0005905 hsa-miR-1254 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggaugagcaaagaaaguagauu MIMAT0005906 hsa-miR-1255a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggcauugacuucucacuagcu MIMAT0005907 hsa-miR-1256 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agugaaugauggguucugacc MIMAT0005908 hsa-miR-1257 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aguuaggauuaggucguggaa MIMAT0005909 hsa-miR-1258 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aucccaccucugccacca MIMAT0005911 hsa-miR-1260a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaacuguaauuacuuuuguac MIMAT0005912 hsa-miR-548g-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auggauaaggcuuuggcuu MIMAT0005913 hsa-miR-1261 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence augggugaauuuguagaaggau MIMAT0005914 hsa-miR-1262 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence augguacccuggcauacugagu MIMAT0005915 hsa-miR-1263 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caaaaguaauuguggauuuugu MIMAT0005916 hsa-miR-548n A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caaagguauuugugguuuuug MIMAT0005917 hsa-miR-548m A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caggauguggucaaguguuguu MIMAT0005918 hsa-miR-1265 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccaaaacugcaguuacuuuugc MIMAT0005919 hsa-miR-548o-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccucagggcuguagaacagggcu MIMAT0005920 hsa-miR-1266-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccuguugaaguguaaucccca MIMAT0005921 hsa-miR-1267 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cgggcguggugguggggg MIMAT0005922 hsa-miR-1268a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuggacugagccgugcuacugg MIMAT0005923 hsa-miR-1269a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuggagauauggaagagcugugu MIMAT0005924 hsa-miR-1270 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaugaugauggcagcaaauucugaaa MIMAT0005925 hsa-miR-1272 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gggcgacaaagcaagacucuuucuu MIMAT0005926 hsa-miR-1273a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaaguaaucgcgguuuuuguc MIMAT0005928 hsa-miR-548h-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gugggggagaggcuguc MIMAT0005929 hsa-miR-1275 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaaagagcccuguggagaca MIMAT0005930 hsa-miR-1276 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaagugcuuccaugcuu MIMAT0005931 hsa-miR-302e A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaauugcuuccauguuu MIMAT0005932 hsa-miR-302f A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uacguagauauauauguauuuu MIMAT0005933 hsa-miR-1277-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uagcaaaaacugcaguuacuuu MIMAT0005934 hsa-miR-548p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaaguaauugcggauuuugcc MIMAT0005935 hsa-miR-548i A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaguacugugcauaucaucuau MIMAT0005936 hsa-miR-1278 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucauauugcuucuuucu MIMAT0005937 hsa-miR-1279 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucgccuccuccucuccc MIMAT0005939 hsa-miR-1281 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucguuugccuuuuucugcuu MIMAT0005940 hsa-miR-1282 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucuauacagacccuggcuuuuc MIMAT0005941 hsa-miR-1284 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggacugcccugaucuggaga MIMAT0005942 hsa-miR-1288-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugggaacggguuccggcagacgcug MIMAT0005943 hsa-miR-1292-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agaaggaaauugaauucauuua MIMAT0005944 hsa-miR-1252-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cggaugagcaaagaaagugguu MIMAT0005945 hsa-miR-1255b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acuggcuagggaaaaugauuggau MIMAT0005948 hsa-miR-664a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uauucauuuauccccagccuaca MIMAT0005949 hsa-miR-664a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acguuggcucugguggug MIMAT0005950 hsa-miR-1306-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acucggcguggcgucggucgug MIMAT0005951 hsa-miR-1307-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cagggaggugaaugugau MIMAT0005952 hsa-miR-1321 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaugaugcugcugaugcug MIMAT0005953 hsa-miR-1322 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaggacacauggucuacuucu MIMAT0005955 hsa-miR-1197 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccagacagaauucuaugcacuuuc MIMAT0005956 hsa-miR-1324 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence aaaucucugcaggcaaauguga MIMAT0006592 cfa-miR-216b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence gugcauuguaguugcauugc MIMAT0006593 cfa-miR-33a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ugagguaguagguuguauaguu MIMAT0006594 cfa-let-7a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uucaaguaauccaggauaggcu MIMAT0006595 cfa-miR-26a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uauugcacauuacuaaguugcau MIMAT0006597 cfa-miR-32 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uucccuuugucauccuaugccu MIMAT0006598 cfa-miR-204 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence aggcaagaugcuggcauagcugu MIMAT0006599 cfa-miR-31 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uacaguacugugauaacuga MIMAT0006600 cfa-miR-101 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence cuuaugcaagauucccuucua MIMAT0006601 cfa-miR-491 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ucucccaacccuuguaccagug MIMAT0006602 cfa-miR-150 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uaugugccuuuggacuacaucg MIMAT0006603 cfa-miR-455 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uguaaacauccucgacuggaagc MIMAT0006604 cfa-miR-30a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uguaaacauccuacacucucagcu MIMAT0006605 cfa-miR-30c A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uggaauguaaggaagugugugg MIMAT0006606 cfa-miR-206 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence cacccguagaaccgaccuugcg MIMAT0006607 cfa-miR-99b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ugagguaggagguuguauaguu MIMAT0006608 cfa-let-7e A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ucccugagacccuuuaaccugu MIMAT0006609 cfa-miR-125a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ugagguaguagauuguauaguu MIMAT0006610 cfa-let-7f A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ugauuguccaaacgcaauucu MIMAT0006611 cfa-miR-219-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence aucacauugccagggauua MIMAT0006612 cfa-miR-23b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uucacaguggcuaaguucugc MIMAT0006613 cfa-miR-27b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uggcucaguucagcaggaacagg MIMAT0006614 cfa-miR-24 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ucgaggagcucacagucuagu MIMAT0006615 cfa-miR-151 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uguaaacauccccgacuggaagcu MIMAT0006616 cfa-miR-30d A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uguaaacauccuacacucagcu MIMAT0006617 cfa-miR-30b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uggagugugacaaugguguuug MIMAT0006619 cfa-miR-122 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uagguaguuuccuguuguuggga MIMAT0006620 cfa-miR-196b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uauggcacugguagaauucacu MIMAT0006621 cfa-miR-183 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ucagugcacuacagaacuuugu MIMAT0006622 cfa-miR-148a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence cuuuuugcggucugggcuugc MIMAT0006623 cfa-miR-129 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ucaagagcaauaacgaaaaaugu MIMAT0006624 cfa-miR-335 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uagcaccauuugaaaucaguguu MIMAT0006625 cfa-miR-29b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uagcaccaucugaaaucgguua MIMAT0006626 cfa-miR-29a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence cuuucagucggauguuuacagc MIMAT0006627 cfa-miR-30e A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uguagggauggaagccaugaaa MIMAT0006628 cfa-miR-135a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence agaucagaaggugauuguggcu MIMAT0006629 cfa-miR-383 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence cagugcaauguuaaaagggcau MIMAT0006631 cfa-miR-130a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence cugaccuaugaauugacagcc MIMAT0006632 cfa-miR-192 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ucacagugaaccggucucuuu MIMAT0006633 cfa-miR-128 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uggaagacuagugauuuuguugu MIMAT0006634 cfa-miR-7 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence aacauucaaccugucggugaguu MIMAT0006635 cfa-miR-181c A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence aacauucauuguugucggugggu MIMAT0006636 cfa-miR-181d A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ugagguaguaguuuguacaguu MIMAT0006637 cfa-let-7g A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence caacggaaucccaaaagcagcu MIMAT0006638 cfa-miR-191 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence aaugacacgaucacucccguuga MIMAT0006639 cfa-miR-425 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence aucacauugccagggauuu MIMAT0006640 cfa-miR-23a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uucacaguggcuaaguuccg MIMAT0006641 cfa-miR-27a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence acaguagucugcacauugguu MIMAT0006642 cfa-miR-199 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence aaggagcuuacaaucuagcuggg MIMAT0006643 cfa-miR-708 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uggagacgcggcccuguuggaa MIMAT0006645 cfa-miR-139 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence agcugguguugugaaucaugccga MIMAT0006646 cfa-miR-138b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uagcagcacauaaugguuugu MIMAT0006647 cfa-miR-15a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uagcagcacguaaauauuggcg MIMAT0006648 cfa-miR-16 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence acugcagugaaggcacuuguag MIMAT0006649 cfa-miR-17 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ugugcaaaucuaugcaaaacuga MIMAT0006650 cfa-miR-19a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uaaagugcuuauagugcagguag MIMAT0006651 cfa-miR-20a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ugugcaaauccaugcaaaacug MIMAT0006652 cfa-miR-19b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uauugcacuugucccggccugu MIMAT0006653 cfa-miR-92a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence agcugguguugugaaucaggccg MIMAT0006654 cfa-miR-138a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uuaagacuugcagugauguuu MIMAT0006655 cfa-miR-499 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uggaauguaaagaaguaugua MIMAT0006656 cfa-miR-1 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uaaggcacgcggugaaugcca MIMAT0006657 cfa-miR-124 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence aaaagcuggguugagagggcga MIMAT0006658 cfa-miR-320 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence cagugcaaugaugaaagggcau MIMAT0006659 cfa-miR-130b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uggagagaaaggcaguuccuga MIMAT0006660 cfa-miR-185 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ccaccuccccugcaaacgucc MIMAT0006661 cfa-miR-1306 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uagguaguuucauguuguuggg MIMAT0006662 cfa-miR-196a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ucagugcaucacagaacuuugu MIMAT0006663 cfa-miR-148b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uaauacugccggguaaugaugga MIMAT0006664 cfa-miR-200c A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence acucggcguggcgucggucgug MIMAT0006665 cfa-miR-1307 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence agcagcauuguacagggcuau MIMAT0006666 cfa-miR-107 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ugagaacugaauuccauaggcu MIMAT0006667 cfa-miR-146b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence aacccguagauccgaucuugu MIMAT0006668 cfa-miR-99a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ugagguaguagguuguaugguu MIMAT0006669 cfa-let-7c A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ucccugagacccuaacuuguga MIMAT0006670 cfa-miR-125b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uuaaugcuaaucgugauaggggu MIMAT0006671 cfa-miR-155 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uugugcuugaucuaaccaugu MIMAT0006672 cfa-miR-218 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence cacgcucaugcacacacccaca MIMAT0006673 cfa-miR-574 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ucuuugguuaucuagcuguauga MIMAT0006674 cfa-miR-9 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence cacuagauugugagcuccugga MIMAT0006675 cfa-miR-28 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uagcagcacaucaugguuua MIMAT0006676 cfa-miR-15b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uucaaguaauucaggauagguu MIMAT0006678 cfa-miR-26b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ugggcuaggaaaaaugauugga MIMAT0006680 cfa-miR-664 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uguaacagcaacuccaugugga MIMAT0006681 cfa-miR-194 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ugagaugaagcacuguagcuc MIMAT0006682 cfa-miR-143 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence acuggacuuggagucagaaggc MIMAT0006683 cfa-miR-378 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ugagaacugaauuccauggguu MIMAT0006684 cfa-miR-146a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence cuuggcaccuaguaagcacu MIMAT0006685 cfa-miR-1271 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence agcagcauuguacagggcuauga MIMAT0006687 cfa-miR-103 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence cuggcccucucugcccuuccgu MIMAT0006688 cfa-miR-328 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence accacaggguagaaccacgga MIMAT0006689 cfa-miR-140 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uggcagugucuuagcugguugu MIMAT0006690 cfa-miR-34a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence cagcagcacacugugguuugu MIMAT0006691 cfa-miR-497 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uagcagcacagaaauauuggca MIMAT0006692 cfa-miR-195 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence aggcaguguaguuagcugauugc MIMAT0006693 cfa-miR-34c A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence caaagaauucuccuuuugggcu MIMAT0006694 cfa-miR-186 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uaaagugcugacagugcagau MIMAT0006695 cfa-miR-106b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence caaagugcuguucgugcagguag MIMAT0006696 cfa-miR-93 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence cauugcacuugucucggucuga MIMAT0006697 cfa-miR-25 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uucaccaccuucuccacccagc MIMAT0006698 cfa-miR-197 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence cgggguuuugagggcgagauga MIMAT0006699 cfa-miR-193b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uaauuuuauguauaagcuagu MIMAT0006700 cfa-miR-590 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uuauugcuuaagaauacgcgu MIMAT0006702 cfa-miR-137 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uauugcacucgucccggccucc MIMAT0006703 cfa-miR-92b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uagcaccauuugaaaucgguua MIMAT0006705 cfa-miR-29c A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence aacauucaacgcugucggugag MIMAT0006707 cfa-miR-181a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence aacauucauugcugucggug MIMAT0006708 cfa-miR-181b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ucucacacagaaaucgcacccgu MIMAT0006709 cfa-miR-342 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ccugaacuaggggucuggagg MIMAT0006710 cfa-miR-345 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ugaaggucuacugugugccag MIMAT0006711 cfa-miR-493 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence aucaugaugggcuccucggugu MIMAT0006712 cfa-miR-433 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ucggauccgucugagcuuggcu MIMAT0006713 cfa-miR-127 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence acuccauuuguuuugaugaugga MIMAT0006714 cfa-miR-136 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ugguagacuauggaacguagg MIMAT0006715 cfa-miR-379 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence auaguagaccguauagcguacg MIMAT0006716 cfa-miR-411 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uauguaauaugguccacgucu MIMAT0006717 cfa-miR-380 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence cacauuacacggucgaccucu MIMAT0006718 cfa-miR-323 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence agagguuuucuggguuucuguuu MIMAT0006719 cfa-miR-329a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence aaacauucgcggugcacuucuu MIMAT0006720 cfa-miR-543 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence aaacaaacauggugcacuucuu MIMAT0006721 cfa-miR-495 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence aucauagaggaaaauccacgu MIMAT0006722 cfa-miR-376a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence aaucguacagggucauccacuu MIMAT0006723 cfa-miR-487b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence aaucauucacggacaacacuuu MIMAT0006724 cfa-miR-382 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence agaggcuggccgugaugaauucg MIMAT0006725 cfa-miR-485 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence aauguugcucguugaaccccu MIMAT0006726 cfa-miR-409 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence aauaauacaugguuggucuuu MIMAT0006727 cfa-miR-369 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence aauauaacacagauggccugu MIMAT0006728 cfa-miR-410 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence agaauuguggcuggacaucugu MIMAT0006729 cfa-miR-219-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence cauuauuacuuuugguacgcg MIMAT0006730 cfa-miR-126 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence accuuggcucuagacugcuuacu MIMAT0006731 cfa-miR-212 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uaacagucuacagccauggucgc MIMAT0006732 cfa-miR-132 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence aagcugccaguugaagaacugu MIMAT0006733 cfa-miR-22 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uacaguauagaugauguacuag MIMAT0006734 cfa-miR-144 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ugggucuuugcgggcgagauga MIMAT0006735 cfa-miR-193a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence cccauaaaguagaaagcacua MIMAT0006736 cfa-miR-142 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uacccuguagauccgaauuugu MIMAT0006737 cfa-miR-10a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ucagugcaugacagaacuugg MIMAT0006738 cfa-miR-152 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uccagcaucagugauuuuguuga MIMAT0006739 cfa-miR-338 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uagcuuaucagacugauguuga MIMAT0006741 cfa-miR-21 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ugaggggcagagagcgagacuuu MIMAT0006742 cfa-miR-423a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence aauggcgccacuaggguugugc MIMAT0006743 cfa-miR-652 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence caagucacuagugguuccguuu MIMAT0006744 cfa-miR-224 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence caaaacgugaggcgcugcuau MIMAT0006745 cfa-miR-424 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uagcagcgggaacaguacug MIMAT0006746 cfa-miR-503 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ugugacagauugauaacugaaa MIMAT0006747 cfa-miR-542 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uuuugcaauauguuccugaau MIMAT0006748 cfa-miR-450b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence aaagugcuuacagugcagguag MIMAT0006749 cfa-miR-106a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence aauugcacgguauccaucuguaa MIMAT0006750 cfa-miR-363 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uuaucagaaucuccagggguac MIMAT0006751 cfa-miR-361 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence auuccuagaaauuguucacaau MIMAT0006752 cfa-miR-384 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uuauaauacaaccugauaagu MIMAT0006753 cfa-miR-374a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence auauaauacaaccugcuaagug MIMAT0006754 cfa-miR-374b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence aucaacagacauuaauugggcg MIMAT0006755 cfa-miR-421 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ugagguaguaaguuguauuguu MIMAT0006756 cfa-miR-98 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence agcuacauugucugcuggguuu MIMAT0006757 cfa-miR-221 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence caugccuugaguguaggaccgu MIMAT0006758 cfa-miR-532 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence augcaccugggcaaggauucu MIMAT0006759 cfa-miR-500 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uacccauugcauaucggaguug MIMAT0006760 cfa-miR-660 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence aaugcaccugggcaaggauuca MIMAT0006761 cfa-miR-502 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence cucuucaaucucaggacucgc MIMAT0006762 cfa-miR-676 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaagcuggguugagagga MIMAT0006764 hsa-miR-320d A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uccagugcccuccucucc MIMAT0006765 hsa-miR-1825 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugaggcaguagauugaau MIMAT0006767 hsa-miR-1827 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugcuuccuuucagagggu MIMAT0006778 hsa-miR-516a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence caagcucgcuucuaugggucu MIMAT0006781 gga-miR-99a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ugcaguccaugggcauauacac MIMAT0006788 gga-miR-455-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuccguuugccuguuucgcug MIMAT0006789 hsa-miR-1468-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuguaugcccucaccgcuca MIMAT0006790 hsa-miR-675-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence aguucuucaguggcaagcuuua MIMAT0007287 gga-miR-22-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence aagcugccaguugaagaacugu MIMAT0007288 gga-miR-22-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence gaaaucaaggguggguaagaccu MIMAT0007289 gga-miR-551-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence gcgacccauacuugguuucag MIMAT0007290 gga-miR-551-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uccuaaccuuaaggaugag MIMAT0007291 gga-miR-454-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uagugcaauauugcuuauagggu MIMAT0007292 gga-miR-454-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uggacguuggcucugguggugau MIMAT0007329 gga-miR-1306-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence aucucuacagguaauugugaga MIMAT0007339 gga-miR-216c A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cucggcgcggggcgcgggcucc MIMAT0007347 hsa-miR-1469 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcccuccgcccgugcaccccg MIMAT0007348 hsa-miR-1470 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcccgcguguggagccaggugu MIMAT0007349 hsa-miR-1471 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaaccgucuaguuacaguugu MIMAT0007399 hsa-miR-1537-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cggcccgggcugcugcuguuccu MIMAT0007400 hsa-miR-1538 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uccugcgcgucccagaugccc MIMAT0007401 hsa-miR-1539 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucauagcccuguacaaugcugcu MIMAT0007402 hsa-miR-103b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uacccuguagauccgaauuugu MIMAT0007731 gga-miR-10a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence aaauucguaucuaggggaaua MIMAT0007732 gga-miR-10a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence gcccuuuuuauguuguacuacu MIMAT0007733 gga-miR-130c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence cagugcaauguuaaaagggcau MIMAT0007734 gga-miR-130c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ugagaacugaauuccauggacug MIMAT0007735 gga-miR-146c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence aguccaugguauucaguucucu MIMAT0007736 gga-miR-146c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uagcagcacaucaugguuugua MIMAT0007737 gga-miR-15c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence cagaccauucugggcugccuca MIMAT0007738 gga-miR-15c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uagcagcacguaaauacuggag MIMAT0007739 gga-miR-16c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence aacuggccuacaaagucccagu MIMAT0007740 gga-miR-193a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence gcucugacuuuauugcacuacu MIMAT0007741 gga-miR-301b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence cagugcaauaguauugucaaagcau MIMAT0007742 gga-miR-301b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence aggcagugugcuguuagcggcug MIMAT0007743 gga-miR-449b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence cagucacuaccacacugccac MIMAT0007744 gga-miR-449b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence acucaaaaaauggcggcacuuu MIMAT0007747 cfa-miR-371 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence aaaucucugcaggcaaauguga MIMAT0007748 gga-miR-216b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence acagcaggcacagacaggcag MIMAT0007751 gga-miR-214 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ggggcuuuggggagggagggga MIMAT0007752 gga-miR-762 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cggcggggacggcgauugguc MIMAT0007881 hsa-miR-1908-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugagugccggugccugcccug MIMAT0007882 hsa-miR-1909-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cgcaggggccgggugcucaccg MIMAT0007883 hsa-miR-1909-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccaguccugugccugccgccu MIMAT0007884 hsa-miR-1910-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugaguaccgccaugucuguuggg MIMAT0007885 hsa-miR-1911-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caccaggcauuguggucucc MIMAT0007886 hsa-miR-1911-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uacccagagcaugcagugugaa MIMAT0007887 hsa-miR-1912 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucugcccccuccgcugcugcca MIMAT0007888 hsa-miR-1913 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cccugugcccggcccacuucug MIMAT0007889 hsa-miR-1914-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggaggggucccgcacugggagg MIMAT0007890 hsa-miR-1914-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence accuugccuugcugcccgggcc MIMAT0007891 hsa-miR-1915-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccccagggcgacgcggcggg MIMAT0007892 hsa-miR-1915-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agcuucuuuacagugcugccuug MIMAT0009196 hsa-miR-103a-2-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gauuucaguggagugaaguuc MIMAT0009197 hsa-miR-205-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaauggugcccuagugacuaca MIMAT0009198 hsa-miR-224-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agggacuuuugggggcagaugug MIMAT0009199 hsa-miR-365a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucgacagcacgacacugccuuc MIMAT0009201 hsa-miR-196b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cagccacaacuacccugccacu MIMAT0009203 hsa-miR-449b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auuugugcuuggcucugucac MIMAT0009206 hsa-miR-2113 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence acguuggcucugguggugaug MIMAT0009411 mmu-miR-1306-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aguugugugugcauguauaugu MIMAT0009418 mmu-miR-669l-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence auauacauccacacaaacauau MIMAT0009419 mmu-miR-669m-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uaguugugugugcauguuuaugu MIMAT0009421 mmu-miR-669o-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucaggccaggcacaguggcuca MIMAT0009447 hsa-miR-1972 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence accgugcaaagguagcaua MIMAT0009448 hsa-miR-1973 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccuccugcccuccuugcugu MIMAT0009451 hsa-miR-1976 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence caaagugcucacagugcaggua MIMAT0009830 cfa-miR-20b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uaaggugcaucuagugcaguua MIMAT0009831 cfa-miR-18b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uaaggugcaucuagugcagaua MIMAT0009832 cfa-miR-18a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uugguccccuucaaccagcug MIMAT0009833 cfa-miR-133c A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uugguccccuucaaccagcugu MIMAT0009834 cfa-miR-133a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uuugguccccuucaaccagcua MIMAT0009835 cfa-miR-133b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ugagguaguagguugugugguu MIMAT0009836 cfa-let-7b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence cccuguagaaccgaauuugugu MIMAT0009837 cfa-miR-10b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence aggcaguguaauuagcugauug MIMAT0009838 cfa-miR-34b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uauggcuuuucauuccuauguga MIMAT0009839 cfa-miR-135b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uugcauagucacaaaaguga MIMAT0009840 cfa-miR-153 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uuuggcaaugguagaacucacacu MIMAT0009841 cfa-miR-182 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uggacggagaacugauaagggu MIMAT0009842 cfa-miR-184 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ucgugucuuguguugcagccgg MIMAT0009843 cfa-miR-187 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uuccuaugcauauacuucuuug MIMAT0009844 cfa-miR-202 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uccuucauuccaccggagucug MIMAT0009845 cfa-miR-205 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence acugugcgugugacagcggcuga MIMAT0009846 cfa-miR-210 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence acagcaggcacagacaggcagu MIMAT0009847 cfa-miR-214 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence augaccuacgaauugauagaca MIMAT0009848 cfa-miR-215 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uaaucucagcuggcaacugug MIMAT0009849 cfa-miR-216a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uacugcaucaggaacugauuggau MIMAT0009850 cfa-miR-217 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence agcuacaucuggcuacugggu MIMAT0009851 cfa-miR-222 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ugucaguuugucaaauacccc MIMAT0009852 cfa-miR-223 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence cagugcaauaguauugucaaagc MIMAT0009853 cfa-miR-301a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence cagugcaaugauauugucaaagc MIMAT0009854 cfa-miR-301b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence acuuaaacguggauguacuugcu MIMAT0009855 cfa-miR-302a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence acuuuaacauggaaguacuuuc MIMAT0009856 cfa-miR-302b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uuuaacauggggguaccugcug MIMAT0009857 cfa-miR-302c A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence acuuuaacauggaggcacuugc MIMAT0009858 cfa-miR-302d A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence acuguugcuaauaugcaacucu MIMAT0009859 cfa-miR-367 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence gugacaucacauauacggcggc MIMAT0009860 cfa-miR-489 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uuuggcacuagcacauuuuugcu MIMAT0009861 cfa-miR-96 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence gugcauugcuguugcauugc MIMAT0009862 cfa-miR-33b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence guccaguuuucccaggaaucccu MIMAT0009863 cfa-miR-145 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence caucuuacugggcagcauugga MIMAT0009864 cfa-miR-200b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence caucuuaccggacagugcugga MIMAT0009865 cfa-miR-200a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence gugaaauguuuaggaccacuag MIMAT0009866 cfa-miR-203 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uucccuuugucauccuuugccu MIMAT0009867 cfa-miR-211 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence auaagacgagcaaaaagcuugu MIMAT0009868 cfa-miR-208a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence auaagacgaacaaaagguuugu MIMAT0009869 cfa-miR-208b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence aaaccguuaccauuacugaguu MIMAT0009870 cfa-miR-451 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uuuguucguucggcucgcguga MIMAT0009871 cfa-miR-375 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ugauauguuugauauauuaggu MIMAT0009872 cfa-miR-190a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ugauauguuugauauuggguu MIMAT0009873 cfa-miR-190b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence gugugcggaaaugcuucugcua MIMAT0009874 cfa-miR-147 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence caaccuggaggacuccaugcug MIMAT0009875 cfa-miR-490 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence aacacugucugguaaagaugg MIMAT0009876 cfa-miR-141 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ugauugacaccucugugagugga MIMAT0009877 cfa-miR-514 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uucaacggguauuuauugagca MIMAT0009878 cfa-miR-95 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ucaaaugcucagacuccugu MIMAT0009879 cfa-miR-105a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence caucccuugcaugguggagggu MIMAT0009880 cfa-miR-188 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ugugacugguugaccagagggg MIMAT0009883 cfa-miR-134 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ucuggcuccgugucuucacuccc MIMAT0009884 cfa-miR-149 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ugguuuaccgucccacauacau MIMAT0009885 cfa-miR-299 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence aauccuuggaaccuaggugugagu MIMAT0009886 cfa-miR-362 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence aucauagaggaaaauccauguu MIMAT0009887 cfa-miR-376b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence guggauauuccuucuauguuua MIMAT0009888 cfa-miR-376c A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence gccugcugggguggaaccuggu MIMAT0009889 cfa-miR-370 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence agagguugcccuuggugaauuc MIMAT0009890 cfa-miR-377 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uauacaagggcaagcucucugu MIMAT0009891 cfa-miR-381 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uuauaaagcaaugagacugauu MIMAT0009892 cfa-miR-340 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ucucugggccugugucuuaggc MIMAT0009893 cfa-miR-330 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ccucugggcccuuccuccag MIMAT0009894 cfa-miR-326 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence gccccugggccuauccuagaa MIMAT0009895 cfa-miR-331 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence cgcauccccuagggcauuggugu MIMAT0009896 cfa-miR-324 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ccuaguagguguucaguaagugu MIMAT0009897 cfa-miR-325 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ugucugcccgcaugccugccucu MIMAT0009898 cfa-miR-346 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence aacacaccugguuaaccucuuu MIMAT0009899 cfa-miR-329b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence aacuguuugcagaggaaacuga MIMAT0009900 cfa-miR-452 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ucacuccuccccucccgucuu MIMAT0009901 cfa-miR-483 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence aaucauacagggacauccagu MIMAT0009902 cfa-miR-487a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence cccagauaauggcacucucaa MIMAT0009903 cfa-miR-488 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ucuuggaguaggucauugggugg MIMAT0009904 cfa-miR-432 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ugaaacauacacgggaaaccuc MIMAT0009905 cfa-miR-494 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ugaguauuacauggccaaucuc MIMAT0009906 cfa-miR-496 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence agacccuggucugcacucuauc MIMAT0009907 cfa-miR-504 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence gggagccaggaaguauugaugu MIMAT0009908 cfa-miR-505 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ggagaaauuauccuuggugugu MIMAT0009909 cfa-miR-539 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence auucugcauuuuuagcaaguuc MIMAT0009910 cfa-miR-544 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ucaguaaauguuuauuggaug MIMAT0009911 cfa-miR-545 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence gcgacccacucuugguuucca MIMAT0009912 cfa-miR-551a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence gcgacccauacuugguuucag MIMAT0009913 cfa-miR-551b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence auguauaaauguauacacac MIMAT0009914 cfa-miR-568 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uacaguuguucaaccaguuacu MIMAT0009916 cfa-miR-582 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ugagaaccaugucugaucagag MIMAT0009917 cfa-miR-589 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence auugugucaauaugcgaugaugu MIMAT0009918 cfa-miR-592 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence guugugucaguuuaucaaac MIMAT0009919 cfa-miR-599 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ggggguccccggagcucgg MIMAT0009920 cfa-miR-615 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence augcugacauauuuacuagagg MIMAT0009921 cfa-miR-628 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence gaccuggcccagaccucagc MIMAT0009922 cfa-miR-631 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence gugucuguuuccuguggga MIMAT0009923 cfa-miR-632 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence guguugaaacaaucucuauug MIMAT0009924 cfa-miR-653 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uuugugaccugguccacuaacc MIMAT0009925 cfa-miR-758 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uccgguucucagggcuccacc MIMAT0009926 cfa-miR-671 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uagugcaauauugcuuauaggg MIMAT0009927 cfa-miR-454 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence caguaacaaagauucauccuugu MIMAT0009928 cfa-miR-802 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uugaagagagguuauccuucgu MIMAT0009929 cfa-miR-300 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence cugcccuggcccgagggaccga MIMAT0009930 cfa-miR-874 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uauaccucaguuuuaucaggug MIMAT0009931 cfa-miR-875 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uggauuucuuugugaaucacca MIMAT0009932 cfa-miR-876 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uccauuacacuacccugccucu MIMAT0009933 cfa-miR-885 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence accaggaggcuaaggccccu MIMAT0009934 cfa-miR-665 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence gcagcagggugaaacugacaca MIMAT0009936 cfa-miR-761 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ggugcucacuuguccuccu MIMAT0009937 cfa-miR-764 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence gcagagugcaaacaauuuugcc MIMAT0009938 cfa-miR-759 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence cuuccgccccgccgggcgccg MIMAT0009939 cfa-miR-718 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uguuuugauaacaguaaugu MIMAT0009977 hsa-miR-2052 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence guguuaauuaaaccucuauuuac MIMAT0009978 hsa-miR-2053 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuguaauauaaauuuaauuuauu MIMAT0009979 hsa-miR-2054 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuggggaaacggccgcugagug MIMAT0010133 hsa-miR-2110 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuguacagccuccuagcuuucc MIMAT0010195 hsa-let-7a-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uauggcuuuuuauuccuauguga MIMAT0010196 cfa-miR-135a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ucaaaugcucagacuccuug MIMAT0010198 cfa-miR-105b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucgaggagcucacagucu MIMAT0010214 hsa-miR-151b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaggcaguguauugcuagcggcugu MIMAT0010251 hsa-miR-449c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggggcuggggccggggccgagc MIMAT0010313 hsa-miR-762 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gucccugaguguauguggug MIMAT0010357 hsa-miR-670-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcagcagggugaaacugacaca MIMAT0010364 hsa-miR-761 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcaggugcucacuuguccuccu MIMAT0010367 hsa-miR-764 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcagagugcaaacaauuuugac MIMAT0010497 hsa-miR-759 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence acgcccuucccccccuucuuca MIMAT0010560 mmu-miR-1249-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uccuguacugagcugccccga MIMAT0011132 cfa-miR-486 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ucccuguccuccaggagcu MIMAT0011134 cfa-miR-339 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uagucccuuccuugaagcgguc MIMAT0011156 hsa-miR-2114-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cgagccucaagcaagggacuu MIMAT0011157 hsa-miR-2114-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agcuuccaugacuccugaugga MIMAT0011158 hsa-miR-2115-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caucagaauucauggaggcuag MIMAT0011159 hsa-miR-2115-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gguucuuagcauaggaggucu MIMAT0011160 hsa-miR-2116-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccucccaugccaagaacuccc MIMAT0011161 hsa-miR-2116-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uguucucuuugccaaggacag MIMAT0011162 hsa-miR-2117 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcuggugcaaaaguaauggcgg MIMAT0011163 hsa-miR-548q A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uaauacugccugguaaugccau MIMAT0011291 dre-miR-429b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uagguaguuugauguuguuggg MIMAT0011298 dre-miR-196c A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence agcagcauuguacagggcuuu MIMAT0011301 dre-miR-107b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence guaugugcccuuggacuacauu MIMAT0011302 dre-miR-455-2-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence agcuacaucugaauacuggguca MIMAT0011303 dre-miR-222b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence ucguaccgugaguaauagugca MIMAT0011306 dre-miR-126b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence cauuauuacuuuugguacgcg MIMAT0011307 dre-miR-126b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uagguaguuuuauguuguuggg MIMAT0011313 dre-miR-196d A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucugcaagugucagaggcgagg MIMAT0011775 hsa-miR-2276-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugacagcgcccugccuggcuc MIMAT0011777 hsa-miR-2277-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gagagcaguguguguugccugg MIMAT0011778 hsa-miR-2278 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gggacccagggagagacguaag MIMAT0012734 hsa-miR-711 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuuccgccccgccgggcgucg MIMAT0012735 hsa-miR-718 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ucuuggaguagaucagugggcag MIMAT0012771 mmu-miR-432 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uugugucaguuuaucaaac MIMAT0012772 mmu-miR-599 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugcaccaugguugucugagca MIMAT0012773 mmu-miR-767 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uauucauuuacuccccagccua MIMAT0012774 mmu-miR-664-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uuccuaugcauauacuucu MIMAT0012822 rno-miR-202-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence caaccuggaggacuccaugcug MIMAT0012823 rno-miR-490-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence caagugcucagaugucuguggu MIMAT0012825 rno-miR-105 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence gugaggacuggggagguggag MIMAT0012827 rno-miR-1224 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aauccuuggaaccuaggugugaau MIMAT0012828 rno-miR-362-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence agacccuggucugcacucuguc MIMAT0012830 rno-miR-504 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence auucugcauuuuuagcaagcu MIMAT0012831 rno-miR-544-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence auguauaaauguauacacac MIMAT0012832 rno-miR-568 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uacaguuguucaaccaguuacu MIMAT0012833 rno-miR-582-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence auugugucaauaugcgaugaugu MIMAT0012834 rno-miR-592 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ggggguccccggugcucggauc MIMAT0012835 rno-miR-615 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence augcugacauauuuacgagagg MIMAT0012836 rno-miR-628 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence gugucuguuuccugccgga MIMAT0012837 rno-miR-632 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uugaaacauucucuacugaac MIMAT0012838 rno-miR-653-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ugucacucggcucggcccacuacc MIMAT0012839 rno-miR-668 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ucaguaacaaagauucauccu MIMAT0012840 rno-miR-802-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uggugcggaaagggcccacagu MIMAT0012841 rno-miR-675-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uauaccucaguuuuaucaggug MIMAT0012842 rno-miR-875 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uggauuucucugugaaucacca MIMAT0012843 rno-miR-876 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence accaggaggcugaggucccuua MIMAT0012844 rno-miR-665 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ccaguuaccgcuuccgcuaccgc MIMAT0012845 rno-miR-935 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cacucaguaaggcauuguuc MIMAT0012846 rno-miR-201-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence acucaaacugugugacacuuu MIMAT0012847 rno-miR-293-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cucaaaauggaggcccuaucu MIMAT0012848 rno-miR-294 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence acucaaauguggggcacacuucu MIMAT0012849 rno-miR-295-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence gcagcagggugaaacugacaca MIMAT0012853 rno-miR-761 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ggugcucacauguccuccucca MIMAT0012854 rno-miR-764-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence gcagagugcaaacaauuuugac MIMAT0012856 rno-miR-759 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence gggacccugggagagauguaag MIMAT0012859 rno-miR-711 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aguauuacauggccaaucucc MIMAT0012860 rno-miR-496-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence guuuuaccaccuccaggagacu MIMAT0013515 hsa-miR-2681-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaucauggaguugguaaagcac MIMAT0013516 hsa-miR-2681-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caggcagugacuguucagacguc MIMAT0013517 hsa-miR-2682-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cgccucuucagcgcugucuucc MIMAT0013518 hsa-miR-2682-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uugcuaguugcacuccucucugu MIMAT0013771 hsa-miR-449c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggggccuggcggugggcgg MIMAT0013802 hsa-miR-2861 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ggggccuggcggcgggcgg MIMAT0013803 mmu-miR-2861 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence guuagggccaacaucucuugg MIMAT0013863 hsa-miR-2909 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence acccgucccguucguccccgga MIMAT0014800 mmu-miR-1247-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cgggaacgucgagacuggagc MIMAT0014801 mmu-miR-1247-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence agguccucaauaaguauuuguu MIMAT0014802 mmu-miR-1264-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence caaaucuuauuugagcaccugu MIMAT0014803 mmu-miR-1264-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aggagggaggggaugggccaaguuc MIMAT0014804 mmu-miR-1249-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uucauucggcuguccagaugua MIMAT0014809 mmu-miR-1298-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence caucugggcaacugauugaacu MIMAT0014810 mmu-miR-1298-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence acucuagcugccaaaggcgcu MIMAT0014824 mmu-miR-1251-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cgcuuugcucagccaguguag MIMAT0014825 mmu-miR-1251-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ucuggcuguuguggugugcaaa MIMAT0014834 mmu-miR-3064-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugccacacugcaacaccuuaca MIMAT0014835 mmu-miR-3064-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ucaacaaaaucacugaugcugg MIMAT0014836 mmu-miR-3065-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ucagcaccaggauauuguugggg MIMAT0014837 mmu-miR-3065-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence guuccugcugaacugagccagu MIMAT0014856 mmu-miR-3074-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gauaucagcucaguaggcaccg MIMAT0014857 mmu-miR-3074-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugugugcaugugcauguguguau MIMAT0014882 mmu-miR-466m-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uacauacacacauacacacgca MIMAT0014883 mmu-miR-466m-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence auauacauacacacccauauac MIMAT0014884 mmu-miR-669d-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugauguguguguacauguacau MIMAT0014885 mmu-miR-466o-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uacauacaugcacacauaagac MIMAT0014886 mmu-miR-466o-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aguugugugugcauguucaugucu MIMAT0014889 mmu-miR-669p-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cauaacauacacacacacacguau MIMAT0014890 mmu-miR-669p-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gugugugcguacauguacaugu MIMAT0014893 mmu-miR-466n-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uauacaugagagcauacauaga MIMAT0014894 mmu-miR-466n-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uccuguacugagcugccccgag MIMAT0014943 mmu-miR-486b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cggggcagcucaguacagga MIMAT0014944 mmu-miR-486b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uguuucagcucaguaggcac MIMAT0014946 mmu-miR-3074-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence auaauacaaccugcuaagug MIMAT0014953 mmu-miR-374c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence acuuagcagguuguauuau MIMAT0014954 mmu-miR-374c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugcucauugcaugggcugugua MIMAT0014957 mmu-miR-1912-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cacagaacaugcagugagaacu MIMAT0014958 mmu-miR-1912-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auauggguuuacuaguuggu MIMAT0014977 hsa-miR-3115 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugccuggaacauaguagggacu MIMAT0014978 hsa-miR-3116 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auaggacucauauagugccag MIMAT0014979 hsa-miR-3117-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugugacugcauuaugaaaauucu MIMAT0014980 hsa-miR-3118 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggcuuuuaacuuugauggc MIMAT0014981 hsa-miR-3119 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cacagcaaguguagacaggca MIMAT0014982 hsa-miR-3120-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaaauagaguaggcaaaggaca MIMAT0014983 hsa-miR-3121-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence guugggacaagaggacggucuu MIMAT0014984 hsa-miR-3122 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cagagaauuguuuaauc MIMAT0014985 hsa-miR-3123 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uucgcgggcgaaggcaaaguc MIMAT0014986 hsa-miR-3124-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auggccaaaacugcaguuauuuu MIMAT0014987 hsa-miR-548s A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uagaggaagcuguggagaga MIMAT0014988 hsa-miR-3125 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugagggacagaugccagaagca MIMAT0014989 hsa-miR-3126-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aucagggcuuguggaaugggaag MIMAT0014990 hsa-miR-3127-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucuggcaaguaaaaaacucucau MIMAT0014991 hsa-miR-3128 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcaguaguguagagauugguuu MIMAT0014992 hsa-miR-3129-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcugcaccggagacuggguaa MIMAT0014994 hsa-miR-3130-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uacccagucuccggugcagcc MIMAT0014995 hsa-miR-3130-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucgaggacugguggaagggccuu MIMAT0014996 hsa-miR-3131 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggguagagaaggagcucagagga MIMAT0014997 hsa-miR-3132 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaaagaacucuuaaaacccaau MIMAT0014998 hsa-miR-3133 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acuggacuuggaggcagaa MIMAT0014999 hsa-miR-378b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugauggauaaaagacuacauauu MIMAT0015000 hsa-miR-3134 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugccuaggcugagacugcagug MIMAT0015001 hsa-miR-3135a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auacacauacacgcaacacacau MIMAT0015002 hsa-miR-466 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cugacugaauagguagggucauu MIMAT0015003 hsa-miR-3136-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence accugagguugugcauuucuaa MIMAT0015004 hsa-miR-544b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucuguagccugggagcaauggggu MIMAT0015005 hsa-miR-3137 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uguggacagugagguagagggagu MIMAT0015006 hsa-miR-3138 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaggagcucaacagaugccuguu MIMAT0015007 hsa-miR-3139 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agcuuuugggaauucagguagu MIMAT0015008 hsa-miR-3140-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caaaagugaucgugguuuuug MIMAT0015009 hsa-miR-548t-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gagggcggguggaggagga MIMAT0015010 hsa-miR-3141 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaggccuuucugaaccuucaga MIMAT0015011 hsa-miR-3142 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auaacauuguaaagcgcuucuuucg MIMAT0015012 hsa-miR-3143 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caaagacugcaauuacuuuugcg MIMAT0015013 hsa-miR-548u A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggggaccaaagagauauauag MIMAT0015014 hsa-miR-3144-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auauaccuguucggucucuuua MIMAT0015015 hsa-miR-3144-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agauauuuugaguguuuggaauug MIMAT0015016 hsa-miR-3145-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggcgacaaaacgagacccuguc MIMAT0015017 hsa-miR-1273c A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caugcuaggauagaaagaaugg MIMAT0015018 hsa-miR-3146 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gguugggcagugaggaggguguga MIMAT0015019 hsa-miR-3147 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agcuacaguuacuuuugcacca MIMAT0015020 hsa-miR-548v A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggaaaaaacuggugugugcuu MIMAT0015021 hsa-miR-3148 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuuguauggauauguguguguau MIMAT0015022 hsa-miR-3149 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuggggagauccucgagguugg MIMAT0015023 hsa-miR-3150a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gguggggcaaugggaucaggu MIMAT0015024 hsa-miR-3151-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uguguuagaauaggggcaauaa MIMAT0015025 hsa-miR-3152-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggggaaagcgaguagggacauuu MIMAT0015026 hsa-miR-3153 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gauaucagcucaguaggcaccg MIMAT0015027 hsa-miR-3074-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cagaaggggaguugggagcaga MIMAT0015028 hsa-miR-3154 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccaggcucugcagugggaacu MIMAT0015029 hsa-miR-3155a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaagaucuggaagugggagaca MIMAT0015030 hsa-miR-3156-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uucagccaggcuagugcagucu MIMAT0015031 hsa-miR-3157-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aagggcuuccucucugcaggac MIMAT0015032 hsa-miR-3158-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaggauuacaagugucggccac MIMAT0015033 hsa-miR-3159 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agagcugagacuagaaagccca MIMAT0015034 hsa-miR-3160-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cugauaagaacagaggcccagau MIMAT0015035 hsa-miR-3161 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuagggaguagaaggguggggag MIMAT0015036 hsa-miR-3162-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uauaaaaugagggcaguaagac MIMAT0015037 hsa-miR-3163 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugugacuuuaagggaaauggcg MIMAT0015038 hsa-miR-3164 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agguggaugcaaugugaccuca MIMAT0015039 hsa-miR-3165 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cgcagacaaugccuacuggccua MIMAT0015040 hsa-miR-3166 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aucccaccacugccaccau MIMAT0015041 hsa-miR-1260b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggauuucagaaauacuggugu MIMAT0015042 hsa-miR-3167 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaguucuacagucagac MIMAT0015043 hsa-miR-3168 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaggacugugcuuggcacauag MIMAT0015044 hsa-miR-3169 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cugggguucugagacagacagu MIMAT0015045 hsa-miR-3170 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agauguauggaaucuguauauauc MIMAT0015046 hsa-miR-3171 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaggaggaaauaggcaggcca MIMAT0015048 hsa-miR-3173-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gggaugguagaccggugacgugc MIMAT0015049 hsa-miR-1193 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cccaauacacggucgaccucuu MIMAT0015050 hsa-miR-323b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uagugaguuagagaugcagagcc MIMAT0015051 hsa-miR-3174 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cggggagagaacgcagugacgu MIMAT0015052 hsa-miR-3175 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acuggccugggacuaccgg MIMAT0015053 hsa-miR-3176 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugcacggcacuggggacacgu MIMAT0015054 hsa-miR-3177-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggggcgcggccggaucg MIMAT0015055 hsa-miR-3178 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agaaggggugaaauuuaaacgu MIMAT0015056 hsa-miR-3179 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuuccagacgcuccgccccacgucg MIMAT0015057 hsa-miR-3180-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggggcggagcuuccggaggcc MIMAT0015058 hsa-miR-3180-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaaguaacugcgguuuuugccu MIMAT0015060 hsa-miR-548w A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aucgggcccucggcgccgg MIMAT0015061 hsa-miR-3181 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcuucuguaguguaguc MIMAT0015062 hsa-miR-3182 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gccucucucggagucgcucgga MIMAT0015063 hsa-miR-3183 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugaggggccucagaccgagcuuuu MIMAT0015064 hsa-miR-3184-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agaagaaggcggucggucugcgg MIMAT0015065 hsa-miR-3185 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucaacaaaaucacugaugcugga MIMAT0015066 hsa-miR-3065-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caggcgucugucuacguggcuu MIMAT0015067 hsa-miR-3186-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucacgcggagagauggcuuug MIMAT0015068 hsa-miR-3186-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuggccauggggcugcgcgg MIMAT0015069 hsa-miR-3187-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agaggcuuugugcggauacgggg MIMAT0015070 hsa-miR-3188 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cccuugggucugaugggguag MIMAT0015071 hsa-miR-3189-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaagcuggguugagaagg MIMAT0015072 hsa-miR-320e A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucuggccagcuacgucccca MIMAT0015073 hsa-miR-3190-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggggacguagcuggccagacag MIMAT0015075 hsa-miR-3191-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucugggagguuguagcaguggaa MIMAT0015076 hsa-miR-3192-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uccugcguaggaucugaggagu MIMAT0015077 hsa-miR-3193 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggccagccaccaggagggcug MIMAT0015078 hsa-miR-3194-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cgcgccgggcccggguu MIMAT0015079 hsa-miR-3195 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cggggcggcaggggccuc MIMAT0015080 hsa-miR-3196 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaaaaacugcaauuacuuuc MIMAT0015081 hsa-miR-548x-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggaggcgcaggcucggaaaggcg MIMAT0015082 hsa-miR-3197 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence guggaguccuggggaauggaga MIMAT0015083 hsa-miR-3198 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agggacugccuuaggagaaaguu MIMAT0015084 hsa-miR-3199 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caccuugcgcuacucaggucug MIMAT0015085 hsa-miR-3200-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gggauaugaagaaaaau MIMAT0015086 hsa-miR-3201 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uucucaagagggaggcaaucau MIMAT0015087 hsa-miR-514b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auugacaccucugugagugga MIMAT0015088 hsa-miR-514b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggaagggagaagagcuuuaau MIMAT0015089 hsa-miR-3202 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaacccaugagguugaggcugcagu MIMAT0015090 hsa-miR-1273d A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_6239), with sequence cuaugcaauuuucuaccuuacc MIMAT0015091 cel-let-7-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_6239), with sequence acggcuaccuucacugccaccc MIMAT0015093 cel-miR-34-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_6239), with sequence gcaugcacccuagugacuuuagu MIMAT0015111 cel-miR-124-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caucuggcauccgucacacaga MIMAT0015377 hsa-miR-3126-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucagcaccaggauauuguuggag MIMAT0015378 hsa-miR-3065-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence aggcagacugugacuuguugu MIMAT0016378 gga-miR-3529 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence cacaagaauugcguuuggacaa MIMAT0016380 gga-miR-219b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cagugcaauguuuuccuu MIMAT0016844 hsa-miR-4295 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence augugggcucaggcuca MIMAT0016845 hsa-miR-4296 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugccuuccugucugug MIMAT0016846 hsa-miR-4297 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acuggacuuggagucagaagagugg MIMAT0016847 hsa-miR-378c A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cagccugacaggaacag MIMAT0016848 hsa-miR-4293 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gggagucuacagcaggg MIMAT0016849 hsa-miR-4294 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucccacuacuucacuuguga MIMAT0016850 hsa-miR-4301 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcuggugacaugagaggc MIMAT0016851 hsa-miR-4299 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cugggacaggaggaggaggcag MIMAT0016852 hsa-miR-4298 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugggagcuggacuacuuc MIMAT0016853 hsa-miR-4300 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccggcauguccagggca MIMAT0016854 hsa-miR-4304 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccaguguggcucagcgag MIMAT0016855 hsa-miR-4302 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uucugagcugaggacag MIMAT0016856 hsa-miR-4303 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccuagacaccuccaguuc MIMAT0016857 hsa-miR-4305 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggagagaaaggcagua MIMAT0016858 hsa-miR-4306 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuggagucuaggauucca MIMAT0016859 hsa-miR-4309 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aauguuuuuuccuguuucc MIMAT0016860 hsa-miR-4307 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucccuggaguuucuucuu MIMAT0016861 hsa-miR-4308 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcagcauucauguccc MIMAT0016862 hsa-miR-4310 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaaagagagcugagugug MIMAT0016863 hsa-miR-4311 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggccuuguuccugucccca MIMAT0016864 hsa-miR-4312 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agcccccuggccccaaaccc MIMAT0016865 hsa-miR-4313 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccgcuuucugagcuggac MIMAT0016866 hsa-miR-4315 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggugaggcuagcuggug MIMAT0016867 hsa-miR-4316 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cucugggaaaugggacag MIMAT0016868 hsa-miR-4314 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cacuguggguacaugcu MIMAT0016869 hsa-miR-4318 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucccugagcaaagccac MIMAT0016870 hsa-miR-4319 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gggauucuguagcuuccu MIMAT0016871 hsa-miR-4320 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acauugccagggaguuu MIMAT0016872 hsa-miR-4317 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cugugggcucagcgcgugggg MIMAT0016873 hsa-miR-4322 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuagcgguggaccgcccugcg MIMAT0016874 hsa-miR-4321 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cagccccacagccucaga MIMAT0016875 hsa-miR-4323 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cccugagacccuaaccuuaa MIMAT0016876 hsa-miR-4324 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aucugaccugaugaaggu MIMAT0016877 hsa-miR-4256 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccagagguggggacugag MIMAT0016878 hsa-miR-4257 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccccgccaccgccuugg MIMAT0016879 hsa-miR-4258 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caguugggucuaggggucagga MIMAT0016880 hsa-miR-4259 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuuggggcauggaguccca MIMAT0016881 hsa-miR-4260 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agggcauguccagggggu MIMAT0016882 hsa-miR-4253 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccugagaaaagggccaa MIMAT0016883 hsa-miR-4251 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gccuggagcuacuccaccaucuc MIMAT0016884 hsa-miR-4254 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caguguucagagaugga MIMAT0016885 hsa-miR-4255 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggccacugagucagcacca MIMAT0016886 hsa-miR-4252 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uugcacuugucucaguga MIMAT0016887 hsa-miR-4325 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uguuccucugucucccagac MIMAT0016888 hsa-miR-4326 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggcuugcaugggggacugg MIMAT0016889 hsa-miR-4327 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggaaacagggaccca MIMAT0016890 hsa-miR-4261 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cugugggcucagcucuggg MIMAT0016891 hsa-miR-4265 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuaggaggccuuggcc MIMAT0016892 hsa-miR-4266 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uccagcucgguggcac MIMAT0016893 hsa-miR-4267 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gacauucagacuaccug MIMAT0016894 hsa-miR-4262 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auccccagauacaauggacaa MIMAT0016895 hsa-miR-2355-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggcuccuccucucaggaugug MIMAT0016896 hsa-miR-4268 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcaggcacagacagcccuggc MIMAT0016897 hsa-miR-4269 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auucuaagugccuuggcc MIMAT0016898 hsa-miR-4263 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acucagucauggucauu MIMAT0016899 hsa-miR-4264 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucagggagucaggggagggc MIMAT0016900 hsa-miR-4270 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gggggaagaaaaggugggg MIMAT0016901 hsa-miR-4271 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cauucaacuagugauugu MIMAT0016902 hsa-miR-4272 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence guguucucugauggacag MIMAT0016903 hsa-miR-4273 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cucagugacucaugugc MIMAT0016904 hsa-miR-4276 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccaauuaccacuucuuu MIMAT0016905 hsa-miR-4275 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cagcagucccucccccug MIMAT0016906 hsa-miR-4274 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gggucccggggagggggg MIMAT0016907 hsa-miR-4281 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcaguucugagcacaguacac MIMAT0016908 hsa-miR-4277 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cucuccucccggcuuc MIMAT0016909 hsa-miR-4279 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuaggggguuugcccuug MIMAT0016910 hsa-miR-4278 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaguguaguucugagcagagc MIMAT0016911 hsa-miR-4280 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaaaauuugcauccagga MIMAT0016912 hsa-miR-4282 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcggcgaguccgacucau MIMAT0016913 hsa-miR-4285 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggggcucagcgaguuu MIMAT0016914 hsa-miR-4283 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gggcucacaucaccccau MIMAT0016915 hsa-miR-4284 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence accccacuccugguacc MIMAT0016916 hsa-miR-4286 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucucccuugagggcacuuu MIMAT0016917 hsa-miR-4287 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uugucugcugaguuucc MIMAT0016918 hsa-miR-4288 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccccugggccggccuugg MIMAT0016919 hsa-miR-4292 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcauugugcagggcuauca MIMAT0016920 hsa-miR-4289 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugcccuccuuucuucccuc MIMAT0016921 hsa-miR-4290 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uucagcaggaacagcu MIMAT0016922 hsa-miR-4291 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccugagacccuaguuccac MIMAT0016923 hsa-miR-4329 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccucagaucagagccuugc MIMAT0016924 hsa-miR-4330 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aauccuugcuaccugggu MIMAT0016925 hsa-miR-500b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccaguuuucccaggauu MIMAT0016926 hsa-miR-4328 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence acauacuucuuuauaugcccaua MIMAT0016979 mmu-miR-1a-1-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ggguuccuggcaugcugauuu MIMAT0016980 mmu-miR-23b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence caagcucguuucuaugggucu MIMAT0016981 mmu-miR-99a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cggggccguagcacugucuga MIMAT0016982 mmu-miR-128-1-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gcucuuuucacauugugcuacu MIMAT0016983 mmu-miR-130a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aaccguggcuuucgauuguuac MIMAT0016984 mmu-miR-132-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cugugggccaccuagucacc MIMAT0016985 mmu-miR-134-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence acggguauucuuggguggauaau MIMAT0016986 mmu-miR-137-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gcuauuucacgacaccagggu MIMAT0016987 mmu-miR-138-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ggauaucaucauauacuguaagu MIMAT0016988 mmu-miR-144-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ccugugaaauucaguucuucag MIMAT0016989 mmu-miR-146a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gagggagggacgggggcggugc MIMAT0016990 mmu-miR-149-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uagguucugugauacacuccgacu MIMAT0016991 mmu-miR-152-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uuugugacguugcagcu MIMAT0016992 mmu-miR-153-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cuccuaccuguuagcauuaac MIMAT0016993 mmu-miR-155-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aagcccuuaccccaaaaaguau MIMAT0016994 mmu-miR-129-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gugguucuagacuugccaacu MIMAT0016995 mmu-miR-182-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aggggcuggcuuuccucuggu MIMAT0016996 mmu-miR-185-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aggcuacaacacaggacccggg MIMAT0016997 mmu-miR-187-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence acuauauaucaagcauauuccu MIMAT0016998 mmu-miR-190a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ccaguggagcugcuguuacuuc MIMAT0016999 mmu-miR-194-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ccaauauuggcugugcugcucc MIMAT0017000 mmu-miR-195a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugaacagugccuuucuguguagg MIMAT0017001 mmu-miR-201-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gcugggaaggcaaagggacgu MIMAT0017002 mmu-miR-204-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gauuucaguggagugaagcuca MIMAT0017003 mmu-miR-205-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence acaugcuucuuuauauccucaua MIMAT0017004 mmu-miR-206-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aaacgccauuaucacacuaa MIMAT0017005 mmu-miR-122-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ggugcagugcugcaucucugg MIMAT0017006 mmu-miR-143-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gaggaacuagccuucucucagc MIMAT0017007 mmu-miR-298-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gcucugacuuuauugcacuacu MIMAT0017008 mmu-miR-301a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence acugcagugccagcacuucuuac MIMAT0017009 mmu-miR-106a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aguuuugcagauuugcaguucagc MIMAT0017010 mmu-miR-19b-2-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cuuucagucagauguuugcugc MIMAT0017011 mmu-miR-30d-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cugccaauuccauaggucacag MIMAT0017012 mmu-miR-192-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence caacgacaucaaaccaccugau MIMAT0017013 mmu-miR-196a-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gagcuuuuggcccggguuauac MIMAT0017014 mmu-miR-208a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cuguacagccuccuagcuuuc MIMAT0017015 mmu-let-7a-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cuauacggccuccuagcuuucc MIMAT0017016 mmu-let-7e-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cuauacagucuacugucuuuc MIMAT0017017 mmu-let-7f-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence accaauauuauugugcugcuuu MIMAT0017018 mmu-miR-16-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gggguuccuggggaugggauuu MIMAT0017019 mmu-miR-23a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ccuauucuugguuacuugcacg MIMAT0017020 mmu-miR-26a-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence caaucauguguagugccaauau MIMAT0017021 mmu-miR-96-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aaucagcaaguauacugcccu MIMAT0017022 mmu-miR-34a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cuauacaacuuacuacuuuccu MIMAT0017023 mmu-miR-98-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ggcuucuuuacagugcugccuug MIMAT0017024 mmu-miR-103-1-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence agcuucuuuacagugcugccuug MIMAT0017025 mmu-miR-103-2-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence gcucugacuuuauugcacuac MIMAT0017026 rno-miR-301a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gggggcagggccuuugugaaggcg MIMAT0017027 mmu-miR-326-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence gggggcagggccuuugugaa MIMAT0017028 rno-miR-326-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ggggggcaggaggggcuca MIMAT0017029 rno-miR-328a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ggggggcaggaggggcucaggg MIMAT0017030 mmu-miR-328-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence agagguuuucugggucucuguuuc MIMAT0017031 rno-miR-329-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence agagguuuucugggucucuguu MIMAT0017032 mmu-miR-329-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ggucuuguuuggguuuguu MIMAT0017033 rno-miR-331-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cggcgucaugcaggaguugau MIMAT0017035 rno-miR-337-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gaaguucuguuauacacucaggcu MIMAT0017036 mmu-miR-148b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aggcaggggcugggccugcagc MIMAT0017039 mmu-miR-346-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence auguagggcuaaaagccauggg MIMAT0017043 rno-miR-135b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence auguagggcuaaaagccauggg MIMAT0017044 mmu-miR-135b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ucgguuaucaugguaccgaugc MIMAT0017045 rno-miR-101b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ucgguuaucaugguaccgaugcu MIMAT0017046 mmu-miR-101b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence acauacuucuuuauguacccaua MIMAT0017047 mmu-miR-1a-2-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence agcuucuuuacaguguugccuug MIMAT0017048 mmu-miR-107-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aggcggagacuugggcaauugc MIMAT0017049 mmu-miR-25-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence caauuuagugugugugauauu MIMAT0017050 mmu-miR-32-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence acaagcuugugucuauagguau MIMAT0017051 mmu-miR-100-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence agccacugcccaccgcacacug MIMAT0017052 mmu-miR-210-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence accuuggcucuagacugcuuacu MIMAT0017053 mmu-miR-212-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cacaguggucucugggauuaug MIMAT0017054 mmu-miR-216a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence agaguugcgucuggacgucccg MIMAT0017055 mmu-miR-219a-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cguguauuugacaagcugaguug MIMAT0017056 mmu-miR-223-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gccuucucuucccgguucuucc MIMAT0017057 mmu-miR-320-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ccuguucuugauuacuuguuuc MIMAT0017058 mmu-miR-26a-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gcaaggacagcaaaggggggc MIMAT0017059 mmu-miR-211-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence accuggcauacaauguagauuucugu MIMAT0017060 mmu-miR-221-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ucaguagccaguguagauccu MIMAT0017061 mmu-miR-222-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aaauggugcccuagugacuaca MIMAT0017062 mmu-miR-224-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cugguuucacaugguggcuuagauu MIMAT0017063 mmu-miR-29b-2-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uguagggauggaagccaugaa MIMAT0017064 mmu-miR-135a-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aguuuugcagguuugcauccagc MIMAT0017065 mmu-miR-19b-1-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence agguugggauuugucgcaaugcu MIMAT0017066 mmu-miR-92a-1-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cucacugaacaaugaaugc MIMAT0017067 mmu-miR-181b-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence accaucgaccguugaguggacc MIMAT0017068 mmu-miR-181c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gggggccgaugcacuguaagaga MIMAT0017069 mmu-miR-128-2-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence caacaagucccagucugccaca MIMAT0017070 mmu-miR-7a-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence caacaagucacagccagccuca MIMAT0017071 mmu-miR-7b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence caucaguuccuaaugcauugccu MIMAT0017072 mmu-miR-217-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ccaguggggcugcuguuaucug MIMAT0017073 mmu-miR-194-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ucccccaggugugauucugauuugu MIMAT0017075 mmu-miR-361-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cagguggaacacgaugcaauuu MIMAT0017076 mmu-miR-363-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence agggacuuuugggggcagaugug MIMAT0017077 mmu-miR-365-1-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gcgacgagccccucgcacaaac MIMAT0017078 mmu-miR-375-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence agagguugcccuuggugaauuc MIMAT0017079 mmu-miR-377-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uauguaacaugguccacuaacu MIMAT0017080 mmu-miR-379-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence agcgagguugcccuuuguauauu MIMAT0017081 mmu-miR-381-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ccacagcacugccuggucaga MIMAT0017082 mmu-miR-383-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gcuggucaaacggaaccaaguc MIMAT0017083 mmu-miR-133b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cucacugaucaaugaaugcaaa MIMAT0017084 mmu-miR-181b-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cuauacaaucuacugucuuucc MIMAT0017085 rno-let-7a-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cuguacagccuccuagcuuucc MIMAT0017086 rno-let-7a-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cuguacaaccuucuagcuuucc MIMAT0017087 rno-let-7c-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cuauacaaucuacugucuuucc MIMAT0017088 rno-let-7c-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cuauacaaucuauugccuucc MIMAT0017089 rno-let-7f-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cuauacagucuacugucuuuc MIMAT0017090 rno-let-7f-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence caacaagucccagucugccaca MIMAT0017091 rno-miR-7a-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence acagauucgauucuaggggaa MIMAT0017092 rno-miR-10b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cgaaucauuauuugcugcucua MIMAT0017093 rno-miR-15b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence accaauauuauugugcugcuu MIMAT0017094 rno-miR-16-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence acugcccuaagugcuccuucu MIMAT0017095 rno-miR-18a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aguuuugcagguuugcauccag MIMAT0017096 rno-miR-19b-1-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aguuuugcagauuugcaguucag MIMAT0017097 rno-miR-19b-2-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ucguuuugcauaguugcacu MIMAT0017098 rno-miR-19a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ggguuccuggcaugcugauuu MIMAT0017099 rno-miR-23b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ccuauucuugguuacuugcac MIMAT0017100 rno-miR-26a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence agagcuuagcugauuggugaacag MIMAT0017101 rno-miR-27b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ugcuaugccaacauauugccauc MIMAT0017102 rno-miR-31a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence gcaauuuagugugugugauauu MIMAT0017103 rno-miR-32-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence caauguuuccacagugcauca MIMAT0017104 rno-miR-33-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aaucacuaacuccacugccauc MIMAT0017105 rno-miR-34b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aaucagcaaguauacugcccua MIMAT0017106 rno-miR-34a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence agguugggauuugucgcaaugcu MIMAT0017107 rno-miR-92a-1-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence agguggggauuagugccauuac MIMAT0017108 rno-miR-92a-2-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence acugcugagcuagcacuucccga MIMAT0017109 rno-miR-93-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence caaucaugugcagugccaauau MIMAT0017110 rno-miR-96-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cuauacaacuuacuacuuucc MIMAT0017111 rno-miR-98-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence caagcuugugucuauaggu MIMAT0017112 rno-miR-100-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence agcuucuuuacagugcu MIMAT0017113 rno-miR-103-2-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ggcuucuuuacagugcugccuugu MIMAT0017114 rno-miR-103-1-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence agcuucuuuacaguguugccuugu MIMAT0017115 rno-miR-107-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aacgccaucaucacacuaa MIMAT0017116 rno-miR-122-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cugaagcucagagggcucugauu MIMAT0017117 rno-miR-127-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cggggccguagcacugucuga MIMAT0017118 rno-miR-128-1-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence gggggccgaugcacuguaaga MIMAT0017119 rno-miR-128-2-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aagcccuuaccccaaaaag MIMAT0017120 rno-miR-129-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence gcucuuuucacauugugcuacu MIMAT0017121 rno-miR-130a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence acucuuucccuguugcacuacu MIMAT0017122 rno-miR-130b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence accguggcuuucgauuguuacu MIMAT0017123 rno-miR-132-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence agcugguaaaauggaaccaaau MIMAT0017124 rno-miR-133a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cugugggccaccuagucaccaa MIMAT0017125 rno-miR-134-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence acggguauucuuggguggauaa MIMAT0017126 rno-miR-137-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence gcuauuucacgacaccagggu MIMAT0017127 rno-miR-138-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uccaucuuccagugcaguguug MIMAT0017128 rno-miR-141-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ggugcagugcugcaucucugg MIMAT0017129 rno-miR-143-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ggauaucaucauauacuguaagu MIMAT0017130 rno-miR-144-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ggauuccuggaaauacuguuc MIMAT0017131 rno-miR-145-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence accugugaaguucaguucuuu MIMAT0017132 rno-miR-146a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cugguacaggccuggggga MIMAT0017133 rno-miR-150-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence agguucugugauacacuccgacu MIMAT0017134 rno-miR-152-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence gucauuuuugugauguugcagcu MIMAT0017135 rno-miR-153-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aaucauacacgguugaccuauu MIMAT0017136 rno-miR-154-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence accaucgaccguugaguggacc MIMAT0017137 rno-miR-181c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence accaccaaccguugacugu MIMAT0017138 rno-miR-181a-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cucacugaacaaugaaugcaa MIMAT0017139 rno-miR-181b-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cucacuggucaaugaaugcaaa MIMAT0017140 rno-miR-181b-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ugaauuaccgaagggccauaa MIMAT0017141 rno-miR-183-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uuuccucugguccuucucu MIMAT0017142 rno-miR-185-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence gcccaaaggugaauuuuuugg MIMAT0017143 rno-miR-186-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aggcuacaacacaggacc MIMAT0017144 rno-miR-187-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence acuauauaucaagcauauuccu MIMAT0017145 rno-miR-190a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence gcugcacuuggauuucguuccc MIMAT0017146 rno-miR-191a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cugccaguuccauaggucacag MIMAT0017147 rno-miR-192-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ccaguggggcugcuguuaucu MIMAT0017148 rno-miR-194-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ccaauauuggcugugcugcucca MIMAT0017149 rno-miR-195-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cgucuuacccagcaguguuug MIMAT0017150 rno-miR-200c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence caucuuaccggacagugcugg MIMAT0017151 rno-miR-200a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence caucuuacugggcagcauugga MIMAT0017152 rno-miR-200b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence agugguucuuaacaguucaac MIMAT0017153 rno-miR-203a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence acaugcuucuuuauauccucau MIMAT0017154 rno-miR-206-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence gagcuuuuggcccggguuauac MIMAT0017155 rno-miR-208a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence agccacugcccacagcacacug MIMAT0017156 rno-miR-210-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ggcaaggacagcaaaggggg MIMAT0017157 rno-miR-211-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence accuuggcucuagacugcuuacug MIMAT0017158 rno-miR-212-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence agaguugucaugugucu MIMAT0017159 rno-miR-214-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cacaguggucucugggauuaug MIMAT0017160 rno-miR-216a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aucaguuccuaaugcauugccu MIMAT0017161 rno-miR-217-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aaacaugguuccgucaagcac MIMAT0017162 rno-miR-218a-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence accuggcauacaauguagauuuc MIMAT0017163 rno-miR-221-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ggcucaguagccaguguagau MIMAT0017164 rno-miR-222-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cguguauuugacaagcugaguug MIMAT0017165 rno-miR-223-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aggaacuagccuucucucugcu MIMAT0017166 rno-miR-298-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uaugugggacgguaaaccgcu MIMAT0017167 rno-miR-299a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence gccuucucuucccgguucuucc MIMAT0017168 rno-miR-320-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ucugucauucuguaggccaau MIMAT0017169 mmu-miR-215-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ucgacagcacgacacugccuuc MIMAT0017170 mmu-miR-196b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ucgacagcacgacacugccuuca MIMAT0017171 rno-miR-196b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence agguugucugugaugaguucg MIMAT0017172 mmu-miR-410-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uggucgaccagcuggaaaguaau MIMAT0017173 mmu-miR-412-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence caggucacgucucugcaguu MIMAT0017174 mmu-miR-370-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aucaacagacauuaauuggg MIMAT0017175 rno-miR-421-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gaacauccugcauagugcugcc MIMAT0017176 mmu-miR-448-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aacauccugcauagugcugcca MIMAT0017177 rno-miR-448-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gucuuaccagacaugguuaga MIMAT0017178 mmu-miR-429-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence agggacuuucaggggcagcugug MIMAT0017179 mmu-miR-365-2-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cagcuaacaugcgacugcucuc MIMAT0017180 mmu-miR-449a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cagcuaacaugcaacugcucuc MIMAT0017181 rno-miR-449a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence auugggaacauuuugcauaaau MIMAT0017182 mmu-miR-450a-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uauugggaacauuuugcauaa MIMAT0017183 rno-miR-450a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence gagggacuuucaggggc MIMAT0017184 rno-miR-365-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uacggugagccugucauuauuc MIMAT0017192 rno-miR-433-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence augguaaugguucucuugcugcu MIMAT0017193 rno-miR-451-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ucagucucaucugcaaagaggu MIMAT0017194 mmu-miR-452-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ugucguaugcgugaugacacguuc MIMAT0017196 rno-miR-489-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ccacagcacugccuggucaga MIMAT0017197 rno-miR-383-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aaugcacccgggcaaggauuugg MIMAT0017198 rno-miR-501-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cccccaggugugauucugauucgu MIMAT0017199 rno-miR-361-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aaauggugcccuagugacuaca MIMAT0017200 rno-miR-224-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aagacgggagaagagaagggag MIMAT0017201 rno-miR-483-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence caggucacgucucugcaguuacac MIMAT0017202 rno-miR-370-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence agagguugcccuuggugaauuc MIMAT0017203 rno-miR-377-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uggucgaccagcuggaaagu MIMAT0017204 rno-miR-412-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence gcuggucaaacggaaccaagu MIMAT0017205 rno-miR-133b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cggggcagcucaguacaggau MIMAT0017206 mmu-miR-486a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aaguugcccgcguguuuuucg MIMAT0017207 mmu-miR-543-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cauacaaggauaauuucuuuuu MIMAT0017208 mmu-miR-539-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uggcgaacacagaauccauacu MIMAT0017209 mmu-miR-541-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cauacaaggguaauuucuuuuc MIMAT0017212 rno-miR-539-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aguggcgaacacagaauccauac MIMAT0017213 rno-miR-541-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence acuguugcuaacaugcaacuc MIMAT0017214 mmu-miR-367-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence agguuguccguguugucuucuc MIMAT0017215 mmu-miR-494-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugguuaucccuguccucuucg MIMAT0017216 mmu-miR-487b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uuguacaugguaggcuuucauu MIMAT0017217 rno-miR-493-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence agguuguccguguugucuucuc MIMAT0017218 rno-miR-494-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence guggauauuccuucuauguuu MIMAT0017219 rno-miR-376c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence agcgagguugcccuuuguauau MIMAT0017220 rno-miR-381-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence agugguuaucccuguccucuucg MIMAT0017221 rno-miR-487b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cauacacggcucuccucucuuc MIMAT0017222 rno-miR-485-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cuuagcacguuguauuauuauu MIMAT0017223 rno-miR-374-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ggaguauuguuuccgcugccugg MIMAT0017224 rno-miR-503-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence acuuuaacauggaggcacuugcu MIMAT0017225 mmu-miR-302d-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence gggagccaggaaguauugauguu MIMAT0017226 rno-miR-505-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aacaucacagcaagucugugcu MIMAT0017227 rno-miR-499-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cuggcuggggaaaaagauugg MIMAT0017228 rno-miR-664-1-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cuggcuggggaaaaugauugg MIMAT0017229 rno-miR-664-2-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ccaaaccacacugugguguuaga MIMAT0017230 rno-miR-497-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ccccaccucuucucuccucag MIMAT0017231 mmu-miR-1224-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gcucugacuagguugcacuacu MIMAT0017232 mmu-miR-301b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence acacuuaccuguagagauucuu MIMAT0017233 mmu-miR-216b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ucaucacguggugacgcaacau MIMAT0017234 mmu-miR-592-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugguugaccagagagcacacg MIMAT0017235 mmu-miR-758-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gaaaucaagcuugggugagaccu MIMAT0017236 mmu-miR-551b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence guaagugugccucgggugagcaug MIMAT0017237 mmu-miR-668-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aggggccucugccucuauccaggauu MIMAT0017238 mmu-miR-665-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence acggagagucuuugucacucag MIMAT0017240 mmu-miR-802-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uuuccucauauccauucaggagugu MIMAT0017242 mmu-miR-670-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence acauaacauacacacacacguau MIMAT0017243 mmu-miR-669a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence agguugcccaugguguguuca MIMAT0017244 mmu-miR-496a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ccccucaggccaccagagcccgg MIMAT0017245 mmu-miR-760-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence caaaccacacugugguguuag MIMAT0017247 mmu-miR-497a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gaaguugcccauguuauuuuucg MIMAT0017249 mmu-miR-495-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cauauacauacacacaaacauau MIMAT0017250 mmu-miR-669b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence acauaacauacacacacauguau MIMAT0017251 mmu-miR-669a-3-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uacacacacacacacaaguaaa MIMAT0017253 mmu-miR-669c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gaacaucacagcaagucugugcu MIMAT0017254 mmu-miR-499-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cuuaugcaagauucccuucuac MIMAT0017255 mmu-miR-491-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aauccuugcuaucugggugcuuagu MIMAT0017258 mmu-miR-500-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gggagccaggaaguauugauguu MIMAT0017259 mmu-miR-505-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence caacccuaggagggggugccauuc MIMAT0017260 mmu-miR-652-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ccauggaucuccaggugggu MIMAT0017261 mmu-miR-490-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uauucagauuggugccugucau MIMAT0017263 mmu-miR-743a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cccaccgggggaugaauguca MIMAT0017264 mmu-miR-181d-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugacuggcaccauucuggauaau MIMAT0017265 mmu-miR-871-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence acugaaugucaagcauacucuca MIMAT0017267 mmu-miR-190b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cggccccacgcaccaggguaag MIMAT0017268 mmu-miR-874-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uggaaacauuucugcacaaacuag MIMAT0017269 mmu-miR-147-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uacugcccuaaaugccccuucu MIMAT0017270 mmu-miR-18b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cgggguuuugagggcgagauga MIMAT0017271 mmu-miR-193b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cucauuaaauguuuguugaau MIMAT0017273 mmu-miR-421-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uacgcacgcacacacacac MIMAT0017274 mmu-miR-466h-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence auauacauacacacaccuauac MIMAT0017275 mmu-miR-467c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uuguacaugguaggcuuuc MIMAT0017276 mmu-miR-493-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence agggagagcagggcaggguuuc MIMAT0017277 mmu-miR-504-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence agggacgggacguggugcaguguu MIMAT0017278 mmu-miR-92b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gagacugacaaguucccggga MIMAT0017279 mmu-miR-873a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aagcuuuuugcucgcguuaugu MIMAT0017280 mmu-miR-208b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aauguguagcaaaagacaggau MIMAT0017281 mmu-miR-511-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ucuuguuaaaaagcagagucu MIMAT0017282 mmu-miR-544-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gcggugaugccgauggugcgagc MIMAT0017283 mmu-miR-598-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uucacuggaguuuguuucagu MIMAT0017284 mmu-miR-653-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence auacauacacacacacauacac MIMAT0017285 rno-miR-466b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence auauacauacacacauacaca MIMAT0017286 rno-miR-466b-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uauacaugcacacauacacac MIMAT0017287 rno-miR-466c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uguucagacugguguccaucau MIMAT0017288 rno-miR-743b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ugacuggcaccauacuggauaa MIMAT0017289 rno-miR-871-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cggccccacgcaccaggguaa MIMAT0017290 rno-miR-874-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence acugcacugcaagcacuucuuac MIMAT0017295 rno-miR-17-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ccaccgggggaugaauguca MIMAT0017296 rno-miR-181d-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cucccacaugcaggguuugc MIMAT0017297 rno-miR-188-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aacuaaaugucaaacauucu MIMAT0017298 rno-miR-190b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence acaacaacaccaaaccaccuga MIMAT0017299 rno-miR-196c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence gcucugacuagguugcacuacu MIMAT0017300 rno-miR-301b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence gcgacgagccccucgcacaaacc MIMAT0017301 rno-miR-375-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uauguaguaugguccacaucu MIMAT0017302 rno-miR-380-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence agguugucugugaugaguucg MIMAT0017303 rno-miR-410-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uauguaacacgguccacuaa MIMAT0017304 rno-miR-411-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ugaggggcagagagcgagacuuuu MIMAT0017305 rno-miR-423-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aucgggaauaucguguccgcc MIMAT0017306 rno-miR-425-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence gcaguccacgggcauauacacu MIMAT0017308 rno-miR-455-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aauccuugcuaucugggugcuuag MIMAT0017311 rno-miR-500-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uauucagauuggugccugucau MIMAT0017315 rno-miR-743a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ugguugaccagagagcacacg MIMAT0017316 rno-miR-758-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence gugggccugacguggag MIMAT0017317 rno-miR-770-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence gagacugacaaguucccggga MIMAT0017318 rno-miR-873-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence agggacgggacgcggugcaguguu MIMAT0017319 rno-miR-92b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cccagauaauggcacucucaa MIMAT0017320 rno-miR-488-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence acaacccuaggagggggugccau MIMAT0017321 rno-miR-652-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uuguguguacauguacauguau MIMAT0017322 mmu-miR-466l-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugugcauguguguauaguugugugc MIMAT0017323 mmu-miR-669k-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uauacauacacacccauauac MIMAT0017324 mmu-miR-669d-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugugugugugugugugugug MIMAT0017325 mmu-miR-466i-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uggguacauaaagaaguaugugc MIMAT0017326 mmu-miR-1b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aguugugugugcaugugcaugugu MIMAT0017327 mmu-miR-669f-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugguagaccggugacguaca MIMAT0017329 mmu-miR-1193-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugaauauacacacacuuacac MIMAT0017330 mmu-miR-669e-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cgguugaccaugguguguacg MIMAT0017331 mmu-miR-1197-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugcggccggugcucagucggc MIMAT0017333 mmu-miR-1199-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ccuagggacucaguucuggug MIMAT0017334 rno-miR-146b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence gaaaucaagcuugggugagaccu MIMAT0017335 rno-miR-551b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence auauacauacacacccauauau MIMAT0017345 mmu-miR-669l-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugugugcaugugcauguguguau MIMAT0017346 mmu-miR-669m-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence acauaacauacacacacacguau MIMAT0017347 mmu-miR-669o-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agcgcgggcugagcgcugccaguc MIMAT0017352 hsa-miR-2277-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cuggcuggggaaaaugacugg MIMAT0017353 mmu-miR-664-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence agagguauagcgcaugggaaa MIMAT0017355 rno-miR-202-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ccauggaucuccaggugggu MIMAT0017356 rno-miR-490-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aacacaccuguucaaggauuca MIMAT0017357 rno-miR-362-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cuuguuaaaaagcagauucu MIMAT0017359 rno-miR-544-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aaccuguugaacaacugaaccc MIMAT0017360 rno-miR-582-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uucacugggguuuguuucacua MIMAT0017361 rno-miR-653-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence acggagagucuuugucacucagu MIMAT0017362 rno-miR-802-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uguaugcccuaaccgcucagu MIMAT0017363 rno-miR-675-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ugaacagcgccuuucuguguag MIMAT0017364 rno-miR-201-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence agugccgcaaaguuugcagugu MIMAT0017365 rno-miR-293-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aagugcuacuacuuuugggugu MIMAT0017366 rno-miR-295-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence gaggaggccauaguggcaacugu MIMAT0017370 rno-miR-764-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence agguuguccaugguguguuc MIMAT0017372 rno-miR-496-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaucugagaaggcgcacaaggu MIMAT0017392 hsa-miR-3200-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence agugguccuaaacauuucac MIMAT0017799 rno-miR-203b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uugaacuguuaagaaccacugg MIMAT0017800 rno-miR-203b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence auaacccgggccaaaagcucac MIMAT0017801 rno-miR-3546 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aggcagugcauugcuagcugg MIMAT0017803 rno-miR-449c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uagaacuucgucccaac MIMAT0017804 rno-miR-449c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cagcacuguccgguaagaugcc MIMAT0017806 rno-miR-3548 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aucuugcccgcaaagaccc MIMAT0017807 rno-miR-3549 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ucuucaccaugguguuuuugacau MIMAT0017809 rno-miR-3551-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ugaaauucaccaugguggguaaa MIMAT0017810 rno-miR-3551-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence gauaucagcucaguaggcaccg MIMAT0017815 rno-miR-3074 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cuaugccagcaucuugccu MIMAT0017816 rno-miR-31b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence gaacgaaauccaagugcagcu MIMAT0017817 rno-miR-191b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence gccuucugacuccaaguccagu MIMAT0017819 rno-miR-3557-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence acacaggaccuggagucaggag MIMAT0017820 rno-miR-3557-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aaagugcauccauuuuguuagu MIMAT0017822 rno-miR-291b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cuauacaaucuacuaccuca MIMAT0017823 rno-miR-3596d A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence auguguguguauguccuuuugu MIMAT0017824 rno-miR-466d A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cgguuuaccgucccacauac MIMAT0017833 rno-miR-299b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uaugugggacgguaaac MIMAT0017834 rno-miR-299b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uucgguuaucuagcuuuau MIMAT0017835 rno-miR-9b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence auacagcuagauaaccaa MIMAT0017836 rno-miR-9b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ucaacaaaaucacugaugcu MIMAT0017839 rno-miR-3065-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ucagcaccaggauauuguugggga MIMAT0017840 rno-miR-3065-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uaccaaaaguaauaaugugcug MIMAT0017843 rno-miR-126b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aagcuuuuugcucgcguuau MIMAT0017844 rno-miR-208b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence auaagacgaacaaaaggu MIMAT0017845 rno-miR-208b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aaaucucugcaggcaaauguga MIMAT0017846 rno-miR-216b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cacacuuacuuguagagauu MIMAT0017847 rno-miR-216b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uacacacuucuuuacauuccaua MIMAT0017851 rno-miR-3571 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence augguaaaccggugacgugc MIMAT0017858 rno-miR-1193-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uaggucacccguuuuacuaucc MIMAT0017859 rno-miR-1193-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence acugcuggguaagacgag MIMAT0017861 rno-miR-3575 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ugcucauugcaugggcuaugu MIMAT0017864 rno-miR-1912-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cacagaacaugcagugaga MIMAT0017865 rno-miR-1912-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence agggguucaccgagcaacauucg MIMAT0017870 rno-miR-409b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aacuaugcaaccuacuaccu MIMAT0017871 rno-miR-3596b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cagcugguugaaggggaccaa MIMAT0017872 rno-miR-133c A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uucacaagaaggugucuuucau MIMAT0017878 rno-miR-3585-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ugaacggcccuuguuguga MIMAT0017879 rno-miR-3585-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ucccuguccucaaggag MIMAT0017880 rno-miR-3586-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence auacuagacugugagcuccucga MIMAT0017881 rno-miR-3586-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence agauguccagccacaauucucg MIMAT0017882 rno-miR-219b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ucacaaguuagggucucaggga MIMAT0017887 rno-miR-3588 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence acgcccuucccccccuucuuca MIMAT0017892 rno-miR-1249 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aacaccauugucacacucca MIMAT0017893 rno-miR-3591 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cacagcaaguguagacaggca MIMAT0017900 rno-miR-3120 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uacauagauugguaccuauca MIMAT0017901 rno-miR-741-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aaagaugccacgcuauguagau MIMAT0017902 rno-miR-741-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence guggauuuuccucuacgau MIMAT0017903 rno-miR-3595 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auuguccuugcuguuuggagau MIMAT0017950 hsa-miR-2355-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugaggauggauagcaaggaagcc MIMAT0017981 hsa-miR-3605-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccuccguguuaccuguccucuag MIMAT0017982 hsa-miR-3605-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuagugaaggcuauuuuaauu MIMAT0017983 hsa-miR-3606-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcaugugaugaagcaaaucagu MIMAT0017984 hsa-miR-3607-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acuguaaacgcuuucugaug MIMAT0017985 hsa-miR-3607-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caaagugaugaguaauacuggcug MIMAT0017986 hsa-miR-3609 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaaucggaaaggaggcgccg MIMAT0017987 hsa-miR-3610 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uugugaagaaagaaauucuua MIMAT0017988 hsa-miR-3611 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggaggcaucuugagaaaugga MIMAT0017989 hsa-miR-3612 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uguuguacuuuuuuuuuuguuc MIMAT0017990 hsa-miR-3613-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acaaaaaaaaaagcccaacccuuc MIMAT0017991 hsa-miR-3613-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccacuuggaucugaaggcugccc MIMAT0017992 hsa-miR-3614-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uagccuucagaucuugguguuuu MIMAT0017993 hsa-miR-3614-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucucucggcuccucgcggcuc MIMAT0017994 hsa-miR-3615 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence augaagugcacucaugauaugu MIMAT0017995 hsa-miR-3616-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cgagggcauuucaugaugcaggc MIMAT0017996 hsa-miR-3616-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaagacauaguugcaagauggg MIMAT0017997 hsa-miR-3617-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugucuacauuaaugaaaagagc MIMAT0017998 hsa-miR-3618 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucagcaggcaggcuggugcagc MIMAT0017999 hsa-miR-3619-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aucacauugccagugauuaccc MIMAT0018000 hsa-miR-23c A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucacccugcaucccgcacccag MIMAT0018001 hsa-miR-3620-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cgcgggucggggucugcagg MIMAT0018002 hsa-miR-3621 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caggcacgggagcucaggugag MIMAT0018003 hsa-miR-3622a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucaccugaccucccaugccugu MIMAT0018004 hsa-miR-3622a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggcaugggaggucagguga MIMAT0018005 hsa-miR-3622b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucaccugagcucccgugccug MIMAT0018006 hsa-miR-3622b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaaugaaaugagcccagccca MIMAT0018065 hsa-miR-3646 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agccgcggggaucgccgaggg MIMAT0018068 hsa-miR-3648 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agggaccugagugucuaag MIMAT0018069 hsa-miR-3649 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggugugucuguagagucc MIMAT0018070 hsa-miR-3650 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cauagcccggucgcugguacauga MIMAT0018071 hsa-miR-3651 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cggcuggaggugugagga MIMAT0018072 hsa-miR-3652 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuaagaaguugacugaag MIMAT0018073 hsa-miR-3653-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gacuggacaagcugaggaa MIMAT0018074 hsa-miR-3654 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcuugucgcugcgguguugcu MIMAT0018075 hsa-miR-3655 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggcgggugcgggggugg MIMAT0018076 hsa-miR-3656 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugugucccauuauuggugauu MIMAT0018077 hsa-miR-3657 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuuaagaaaacaccauggagau MIMAT0018078 hsa-miR-3658 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uugcuugaacccaggaagugga MIMAT0018079 hsa-miR-1273e A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugaguguugucuacgagggca MIMAT0018080 hsa-miR-3659 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acugacaggagagcauuuuga MIMAT0018081 hsa-miR-3660 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugaccugggacucggacagcug MIMAT0018082 hsa-miR-3661 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaaaaugaugaguagugacugaug MIMAT0018083 hsa-miR-3662 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcuggucugcguggugcucgg MIMAT0018084 hsa-miR-3663-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugagcaccacacaggccgggcgc MIMAT0018085 hsa-miR-3663-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aacucugucuucacucaugagu MIMAT0018086 hsa-miR-3664-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agcaggugcggggcggcg MIMAT0018087 hsa-miR-3665 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cagugcaaguguagaugccga MIMAT0018088 hsa-miR-3666 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaagacccauugaggagaaggu MIMAT0018089 hsa-miR-3667-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence accuuccucuccaugggucuuu MIMAT0018090 hsa-miR-3667-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aauguagagauugaucaaaau MIMAT0018091 hsa-miR-3668 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agagcucacagcuguccuucucua MIMAT0018093 hsa-miR-3670 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aucaaauaaggacuagucugca MIMAT0018094 hsa-miR-3671 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence augagacucauguaaaacaucuu MIMAT0018095 hsa-miR-3672 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auuguagaaccuaagauuggcc MIMAT0018097 hsa-miR-3674 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uauggggcuucuguagagauuuc MIMAT0018098 hsa-miR-3675-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caucucuaaggaacucccccaa MIMAT0018099 hsa-miR-3675-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cucgugggcucuggccacggcc MIMAT0018101 hsa-miR-3677-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uccguacaaacucugcugug MIMAT0018102 hsa-miR-3678-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cugcagaguuuguacggaccgg MIMAT0018103 hsa-miR-3678-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugaggauauggcagggaagggga MIMAT0018104 hsa-miR-3679-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuuccccccaguaaucuucauc MIMAT0018105 hsa-miR-3679-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gacucacucacaggauugugca MIMAT0018106 hsa-miR-3680-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuuugcaugacccugggaguagg MIMAT0018107 hsa-miR-3680-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaguggaugaugcacucugugc MIMAT0018108 hsa-miR-3681-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acacagugcuucauccacuacu MIMAT0018109 hsa-miR-3681-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugaugauacagguggagguag MIMAT0018110 hsa-miR-3682-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugcgacauuggaaguaguauca MIMAT0018111 hsa-miR-3683 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuagaccuaguacacguccuu MIMAT0018112 hsa-miR-3684 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuuccuacccuaccugaagacu MIMAT0018113 hsa-miR-3685 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aucuguaagagaaaguaaauga MIMAT0018114 hsa-miR-3686 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cccggacaggcguucgugcgacgu MIMAT0018115 hsa-miR-3687 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uauggaaagacuuugccacucu MIMAT0018116 hsa-miR-3688-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugugauaucaugguuccuggga MIMAT0018117 hsa-miR-3689a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cugggaggugugauaucguggu MIMAT0018118 hsa-miR-3689a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence accuggacccagcguagacaaag MIMAT0018119 hsa-miR-3690 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aguggaugauggagacucgguac MIMAT0018120 hsa-miR-3691-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccugcuggucaggaguggauacug MIMAT0018121 hsa-miR-3692-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence guuccacacugacacugcagaagu MIMAT0018122 hsa-miR-3692-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gguauccguuuggggauggu MIMAT0018164 hsa-miR-3713 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaaggcagcagugcuccccugu MIMAT0018165 hsa-miR-3714 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggggcggagcuuccggag MIMAT0018178 hsa-miR-3180 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggugcuccaggcuggcucaca MIMAT0018179 hsa-miR-3907 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugugauaucaugguuccuggga MIMAT0018180 hsa-miR-3689b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cugggaggugugauauuguggu MIMAT0018181 hsa-miR-3689b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gagcaauguagguagacuguuu MIMAT0018182 hsa-miR-3908 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uguccucuagggccugcagucu MIMAT0018183 hsa-miR-3909 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaggcauaaaaccaagaca MIMAT0018184 hsa-miR-3910 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uguguggauccuggaggaggca MIMAT0018185 hsa-miR-3911 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaacgcauaauauggacaugu MIMAT0018186 hsa-miR-3912-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuugggacugaucuugaugucu MIMAT0018187 hsa-miR-3913-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaggaaccagaaaaugagaagu MIMAT0018188 hsa-miR-3914 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uugaggaaaagauggucuuauu MIMAT0018189 hsa-miR-3915 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aagaggaagaaauggcugguucucag MIMAT0018190 hsa-miR-3916 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcucggacugagcagguggg MIMAT0018191 hsa-miR-3917 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acagggccgcagauggagacu MIMAT0018192 hsa-miR-3918 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcagagaacaaaggacucagu MIMAT0018193 hsa-miR-3919 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugaggagaucgucgagguugg MIMAT0018194 hsa-miR-3150b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acugauuaucuuaacucucuga MIMAT0018195 hsa-miR-3920 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucucugaguaccauaugccuugu MIMAT0018196 hsa-miR-3921 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucuggccuugacuugacucuuu MIMAT0018197 hsa-miR-3922-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aacuaguaauguuggauuaggg MIMAT0018198 hsa-miR-3923 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auauguauaugugacugcuacu MIMAT0018199 hsa-miR-3924 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aagagaacugaaaguggagccu MIMAT0018200 hsa-miR-3925-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggccaaaaagcaggcagaga MIMAT0018201 hsa-miR-3926 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cagguagauauuugauaggcau MIMAT0018202 hsa-miR-3927-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucuucaaccucaggacuugca MIMAT0018203 hsa-miR-676-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuguccuaagguuguugaguu MIMAT0018204 hsa-miR-676-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggaggaaccuuggagcuucggc MIMAT0018205 hsa-miR-3928-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaggcugaugugaguagaccacu MIMAT0018206 hsa-miR-3929 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucagguguggaaacugaggcag MIMAT0018349 hsa-miR-3934-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uguagauacgagcaccagccac MIMAT0018350 hsa-miR-3935 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaagggguguauggcagaugca MIMAT0018351 hsa-miR-3936 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acaggcggcuguagcaauggggg MIMAT0018352 hsa-miR-3937 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aauucccuuguagauaacccgg MIMAT0018353 hsa-miR-3938 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaaguaaucacuguuuuugcc MIMAT0018354 hsa-miR-548y A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uacgcgcagaccacaggauguc MIMAT0018355 hsa-miR-3939 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cagcccggaucccagcccacuu MIMAT0018356 hsa-miR-3940-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuacacacaacugaggaucaua MIMAT0018357 hsa-miR-3941 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aagcaauacuguuaccugaaau MIMAT0018358 hsa-miR-3942-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uagcccccaggcuucacuuggcg MIMAT0018359 hsa-miR-3943 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uucgggcuggccugcugcuccgg MIMAT0018360 hsa-miR-3944-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agggcauaggagaggguugauau MIMAT0018361 hsa-miR-3945 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auaauacaaccugcuaagugcu MIMAT0018443 hsa-miR-374c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agacacauuuggagagggaccc MIMAT0018444 hsa-miR-642b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucuuacucccucaggcacug MIMAT0018445 hsa-miR-550b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caaaaaccgcaauuacuuuugca MIMAT0018446 hsa-miR-548z A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaaaccacaauuacuuuugcacca MIMAT0018447 hsa-miR-548aa A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cgggcgugguggugggggug MIMAT0018925 hsa-miR-1268b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acuggacuuggagucagaaa MIMAT0018926 hsa-miR-378d A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acuggacuuggagucagga MIMAT0018927 hsa-miR-378e A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaaguaauuguggauuuugcu MIMAT0018928 hsa-miR-548ab A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggugggcuucccggaggg MIMAT0018929 hsa-miR-4417 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cacugcaggacucagcag MIMAT0018930 hsa-miR-4418 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugagggaggagacugca MIMAT0018931 hsa-miR-4419a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acuggacuuggagccagaag MIMAT0018932 hsa-miR-378f A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gucacugaugucuguagcugag MIMAT0018933 hsa-miR-4420 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence accugucuguggaaaggagcua MIMAT0018934 hsa-miR-4421 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaagcaucaggaaguaccca MIMAT0018935 hsa-miR-4422 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auaggcaccaaaaagcaacaa MIMAT0018936 hsa-miR-4423-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acugggcuuggagucagaag MIMAT0018937 hsa-miR-378g A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caaaaaccggcaauuacuuuug MIMAT0018938 hsa-miR-548ac A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agaguuaacucaaaauggacua MIMAT0018939 hsa-miR-4424 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uguugggauucagcaggaccau MIMAT0018940 hsa-miR-4425 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaagauggacguacuuu MIMAT0018941 hsa-miR-4426 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucugaauagagucugaagagu MIMAT0018942 hsa-miR-4427 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caaggagacgggaacauggagc MIMAT0018943 hsa-miR-4428 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaagcugggcugagaggcg MIMAT0018944 hsa-miR-4429 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggcuggagugagcggag MIMAT0018945 hsa-miR-4430 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaaaacgacaaugacuuuugca MIMAT0018946 hsa-miR-548ad-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcgacucugaaaacuagaaggu MIMAT0018947 hsa-miR-4431 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaagacucugcaagaugccu MIMAT0018948 hsa-miR-4432 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acaggagugggggugggacau MIMAT0018949 hsa-miR-4433a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggagaaguaaaguagaa MIMAT0018950 hsa-miR-4434 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auggccagagcucacacagagg MIMAT0018951 hsa-miR-4435 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcaggacaggcagaaguggau MIMAT0018952 hsa-miR-4436a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugggcucaggguacaaagguu MIMAT0018953 hsa-miR-4437 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caaaaacugcaauuacuuuca MIMAT0018954 hsa-miR-548ae-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cacaggcuuagaaaagacagu MIMAT0018956 hsa-miR-4438 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gugacugauaccuuggaggcau MIMAT0018957 hsa-miR-4439 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugucguggggcuugcuggcuug MIMAT0018958 hsa-miR-4440 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acagggaggagauugua MIMAT0018959 hsa-miR-4441 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gccggacaagagggagg MIMAT0018960 hsa-miR-4442 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuggaggcguggguuuu MIMAT0018961 hsa-miR-4443 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cucgaguuggaagaggcg MIMAT0018962 hsa-miR-4444 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agauuguuucuuuugccgugca MIMAT0018963 hsa-miR-4445-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cacggcaaaagaaacaaucca MIMAT0018964 hsa-miR-4445-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cagggcuggcagugacaugggu MIMAT0018965 hsa-miR-4446-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggugggggcuguuguuu MIMAT0018966 hsa-miR-4447 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggcuccuuggucuaggggua MIMAT0018967 hsa-miR-4448 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cgucccggggcugcgcgaggca MIMAT0018968 hsa-miR-4449 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaagguaauugugguuucugc MIMAT0018969 hsa-miR-548ag A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggggauuuggagaagugguga MIMAT0018971 hsa-miR-4450 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaagugauugcaguguuug MIMAT0018972 hsa-miR-548ah-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugguagagcugaggaca MIMAT0018973 hsa-miR-4451 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uugaauucuuggccuuaagugau MIMAT0018974 hsa-miR-4452 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gagcuuggucuguagcgguu MIMAT0018975 hsa-miR-4453 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggauccgagucacggcacca MIMAT0018976 hsa-miR-4454 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggguguguguguuuuu MIMAT0018977 hsa-miR-4455 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccugguggcuuccuuuu MIMAT0018978 hsa-miR-4456 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucacaagguauugacuggcgua MIMAT0018979 hsa-miR-4457 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agagguagguguggaagaa MIMAT0018980 hsa-miR-4458 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccaggaggcggaggagguggag MIMAT0018981 hsa-miR-4459 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auagugguugugaauuuaccuu MIMAT0018982 hsa-miR-4460 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gauugagacuaguagggcuaggc MIMAT0018983 hsa-miR-4461 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acuggacuuggugucagaugg MIMAT0018984 hsa-miR-378h A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggcuggagcgagugcaguggug MIMAT0018985 hsa-miR-3135b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugacacggaggguggcuugggaa MIMAT0018986 hsa-miR-4462 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gagacugggguggggcc MIMAT0018987 hsa-miR-4463 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aagguuuggauagaugcaaua MIMAT0018988 hsa-miR-4464 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaagguaauugcaguuuuuccc MIMAT0018989 hsa-miR-548ai A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaaaaacugcaauuacuuuua MIMAT0018990 hsa-miR-548aj-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cucaaguagucugaccagggga MIMAT0018992 hsa-miR-4465 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gggugcgggccggcgggg MIMAT0018993 hsa-miR-4466 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggcggcgguaguuaugggcuu MIMAT0018994 hsa-miR-4467 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agagcagaaggaugagau MIMAT0018995 hsa-miR-4468 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcucccucuagggucgcucgga MIMAT0018996 hsa-miR-4469 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggcaaacguggaagccgaga MIMAT0018997 hsa-miR-4470 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugggaacuuaguagagguuuaa MIMAT0018998 hsa-miR-4471 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggugggggguguuguuuu MIMAT0018999 hsa-miR-4472 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuagugcucuccguuacaagua MIMAT0019000 hsa-miR-4473 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuguggcuggucaugaggcuaa MIMAT0019001 hsa-miR-4474-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caagggaccaagcauucauuau MIMAT0019002 hsa-miR-4475 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caggaaggauuuagggacaggc MIMAT0019003 hsa-miR-4476 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuauuaaggacauuugugauuc MIMAT0019004 hsa-miR-4477a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auuaaggacauuugugauugau MIMAT0019005 hsa-miR-4477b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaggcugagcugaggag MIMAT0019006 hsa-miR-4478 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cugggaggugugauauuguggu MIMAT0019007 hsa-miR-3689c A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gggaggugugaucucacacucg MIMAT0019008 hsa-miR-3689d A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugugauaucaugguuccuggga MIMAT0019009 hsa-miR-3689e A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugugauaucgugcuuccuggga MIMAT0019010 hsa-miR-3689f A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cgcgcggccgugcucggagcag MIMAT0019011 hsa-miR-4479 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccaggcucugcaguggga MIMAT0019012 hsa-miR-3155b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaaguaacugcgguuuuuga MIMAT0019013 hsa-miR-548ak A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agccaaguggaaguuacuuua MIMAT0019014 hsa-miR-4480 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggagugggcuggugguu MIMAT0019015 hsa-miR-4481 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aacccagugggcuauggaaaug MIMAT0019016 hsa-miR-4482-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gggguggucuguuguug MIMAT0019017 hsa-miR-4483 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaaggcgggagaagcccca MIMAT0019018 hsa-miR-4484 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaacggccgcgguacccuaa MIMAT0019019 hsa-miR-4485-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcugggcgaggcuggca MIMAT0019020 hsa-miR-4486 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agagcuggcugaagggcag MIMAT0019021 hsa-miR-4487 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agggggcgggcuccggcg MIMAT0019022 hsa-miR-4488 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggggcuagugaugcaggacg MIMAT0019023 hsa-miR-4489 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aacggcaaugacuuuuguacca MIMAT0019024 hsa-miR-548al A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucugguaagagauuugggcaua MIMAT0019025 hsa-miR-4490 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aauguggacuggugugaccaaa MIMAT0019026 hsa-miR-4491 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggggcugggcgcgcgcc MIMAT0019027 hsa-miR-4492 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agaaggccuuuccaucucugu MIMAT0019028 hsa-miR-4493 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccagacuguggcugaccagagg MIMAT0019029 hsa-miR-4494 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aauguaaacaggcuuuuugcu MIMAT0019030 hsa-miR-4495 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaggaaacugaagcugagaggg MIMAT0019031 hsa-miR-4496 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuccgggacggcugggc MIMAT0019032 hsa-miR-4497 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugggcuggcagggcaagugcug MIMAT0019033 hsa-miR-4498 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaggcugaaggaagaugg MIMAT0019034 hsa-miR-4419b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aagacugagaggaggga MIMAT0019035 hsa-miR-4499 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugagguaguaguuucuu MIMAT0019036 hsa-miR-4500 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaugugaccucggaugaauca MIMAT0019037 hsa-miR-4501 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcugaugaugauggugcugaag MIMAT0019038 hsa-miR-4502 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuuaagcaggaaauagaauuua MIMAT0019039 hsa-miR-4503 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugugacaauagagaugaacaug MIMAT0019040 hsa-miR-4504 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggcugggcugggacgga MIMAT0019041 hsa-miR-4505 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaauggguggucugaggcaa MIMAT0019042 hsa-miR-4506 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaggaugggggugagaggug MIMAT0019043 hsa-miR-2392 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuggguugggcugggcuggg MIMAT0019044 hsa-miR-4507 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcggggcugggcgcgcg MIMAT0019045 hsa-miR-4508 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acuaaaggauauagaagguuuu MIMAT0019046 hsa-miR-4509 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugagggaguaggauguaugguu MIMAT0019047 hsa-miR-4510 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaagaacuguugcauuugcccu MIMAT0019048 hsa-miR-4511 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cagggccucacuguaucgccca MIMAT0019049 hsa-miR-4512 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agacugacggcuggaggcccau MIMAT0019050 hsa-miR-4513 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acaggcaggauuggggaa MIMAT0019051 hsa-miR-4514 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggacuggacucccggcagccc MIMAT0019052 hsa-miR-4515 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gggagaagggucggggc MIMAT0019053 hsa-miR-4516 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaauaugaugaaacucacagcugag MIMAT0019054 hsa-miR-4517 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcucagggaugauaacugugcugaga MIMAT0019055 hsa-miR-4518 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cagcagugcgcagggcug MIMAT0019056 hsa-miR-4519 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuggacagaaaacacgcaggaa MIMAT0019057 hsa-miR-4520-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcuaaggaaguccugugcucag MIMAT0019058 hsa-miR-4521 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuggacugagccaugcuacugg MIMAT0019059 hsa-miR-1269b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugacucugccuguaggccggu MIMAT0019060 hsa-miR-4522 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaccgagagggccucggcugu MIMAT0019061 hsa-miR-4523 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auagcagcaugaaccugucuca MIMAT0019062 hsa-miR-4524a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugagacaggcuuaugcugcuau MIMAT0019063 hsa-miR-4524a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggggggaugugcaugcugguu MIMAT0019064 hsa-miR-4525 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcugacagcagggcuggccgcu MIMAT0019065 hsa-miR-4526 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggucugcaaagagaugacugu MIMAT0019066 hsa-miR-4527 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucauuauauguaugaucuggac MIMAT0019067 hsa-miR-4528 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auuggacugcugauggcccgu MIMAT0019068 hsa-miR-4529-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cccagcaggacgggagcg MIMAT0019069 hsa-miR-4530 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auggagaaggcuucuga MIMAT0019070 hsa-miR-4531 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccccggggagcccggcg MIMAT0019071 hsa-miR-4532 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggaaggagguugccggacgcu MIMAT0019072 hsa-miR-4533 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggauggaggaggggucu MIMAT0019073 hsa-miR-4534 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acuggacuaggagucagaagg MIMAT0019074 hsa-miR-378i A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence guggaccuggcugggac MIMAT0019075 hsa-miR-4535 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caaaaacugcaguuacuuuugu MIMAT0019076 hsa-miR-548am-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uugggcugggcuggguuggg MIMAT0019077 hsa-miR-1587 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugugguagauauaugcacgau MIMAT0019078 hsa-miR-4536-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaaggcauugugguuuuug MIMAT0019079 hsa-miR-548an A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugagccgagcugagcuuagcug MIMAT0019080 hsa-miR-4537 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gagcuuggaugagcugggcuga MIMAT0019081 hsa-miR-4538 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcugaacugggcugagcugggc MIMAT0019082 hsa-miR-4539 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuaguccugccuguagguuua MIMAT0019083 hsa-miR-4540 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence caccaccuccccugcaaacgucc MIMAT0019136 mmu-miR-1306-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agacacuauacgagucauau MIMAT0019197 hsa-miR-3117-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccugucugugccugcuguaca MIMAT0019198 hsa-miR-3120-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uccuuugccuauucuauuuaag MIMAT0019199 hsa-miR-3121-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acuuuccucacucccgugaagu MIMAT0019200 hsa-miR-3124-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uccccuucugcaggccugcugg MIMAT0019201 hsa-miR-3127-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaacuaaucucuacacugcugc MIMAT0019202 hsa-miR-3129-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggcccaaccuauucaguuagu MIMAT0019203 hsa-miR-3136-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence accugaauuaccaaaagcuuu MIMAT0019204 hsa-miR-3140-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aacuccaaacacucaaaacuca MIMAT0019205 hsa-miR-3145-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caaccucgacgaucuccucagc MIMAT0019206 hsa-miR-3150a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auugccucuguucuaacacaag MIMAT0019207 hsa-miR-3152-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence guuccugcugaacugagccag MIMAT0019208 hsa-miR-3074-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cucccacuuccagaucuuucu MIMAT0019209 hsa-miR-3156-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cugcccuagucuagcugaagcu MIMAT0019210 hsa-miR-3157-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccugcagagaggaagcccuuc MIMAT0019211 hsa-miR-3158-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggcuuucuagucucagcucucc MIMAT0019212 hsa-miR-3160-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucccuaccccuccacucccca MIMAT0019213 hsa-miR-3162-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugcccugccuguuuucuccuuu MIMAT0019214 hsa-miR-3173-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uguguacacacgugccaggcgcu MIMAT0019215 hsa-miR-3177-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccugggcagcguguggcugaagg MIMAT0019216 hsa-miR-3187-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugccccaucugugcccuggguagga MIMAT0019217 hsa-miR-3189-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agcucugcugcucacuggcagu MIMAT0019218 hsa-miR-3194-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gggaccauccugccugcugugg MIMAT0019219 hsa-miR-3619-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucucaggaguaaagacagaguu MIMAT0019220 hsa-miR-3664-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caguggccagagcccugcagug MIMAT0019221 hsa-miR-3677-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuacuucuaccuguguuaucau MIMAT0019222 hsa-miR-3682-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aguggcaaagucuuuccauau MIMAT0019223 hsa-miR-3688-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence accaagucugcgucauccucuc MIMAT0019224 hsa-miR-3691-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agacaucaagaucagucccaaa MIMAT0019225 hsa-miR-3913-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caaccucgaggaucuccccagc MIMAT0019226 hsa-miR-3150b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucaaggccagaggucccacagca MIMAT0019227 hsa-miR-3922-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acuccaguuuuaguucucuug MIMAT0019228 hsa-miR-3925-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence guggguuggggcgggcucug MIMAT0019229 hsa-miR-3940-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuucagauaacaguauuacau MIMAT0019230 hsa-miR-3942-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugugcagcaggccaaccgaga MIMAT0019231 hsa-miR-3944-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aguugccuuuuuguucccaugc MIMAT0019232 hsa-miR-4423-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auuucccugccauucccuuggc MIMAT0019233 hsa-miR-4446-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuagucucaugaucagacaca MIMAT0019234 hsa-miR-4474-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccugcguguuuucuguccaa MIMAT0019235 hsa-miR-4520-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggccaucagcaguccaaugaa MIMAT0019236 hsa-miR-4529-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ggcggcggcggaggcggggg MIMAT0019336 mmu-miR-3960 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggcggcggcggaggcggggg MIMAT0019337 hsa-miR-3960 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence aggagcucacagucuauuga MIMAT0019339 mmu-miR-28c A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cuggacuuggagucagaaga MIMAT0019348 mmu-miR-378b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cugccagccccguuccagggca MIMAT0019357 hsa-miR-3972 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acaaaguacagcauuagccuuag MIMAT0019358 hsa-miR-3973 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaggucauuguaagguuaaugc MIMAT0019359 hsa-miR-3974 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugaggcuaaugcacuacuucac MIMAT0019360 hsa-miR-3975 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uauagagagcaggaagauuaaugu MIMAT0019361 hsa-miR-3976 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gugcuucaucguaauuaaccuua MIMAT0019362 hsa-miR-3977 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence guggaaagcaugcauccagggugu MIMAT0019363 hsa-miR-3978 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugccgcccucucgcugcucuag MIMAT0019688 hsa-miR-4632-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auaugccuggcuagcuccuc MIMAT0019689 hsa-miR-4633-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggagcuagccaggcauaugca MIMAT0019690 hsa-miR-4633-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cggcgcgaccggcccgggg MIMAT0019691 hsa-miR-4634 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucuugaagucagaacccgcaa MIMAT0019692 hsa-miR-4635 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aacucguguucaaagccuuuag MIMAT0019693 hsa-miR-4636 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uacuaacugcagauucaaguga MIMAT0019694 hsa-miR-4637 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acucggcugcgguggacaagu MIMAT0019695 hsa-miR-4638-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccuggacaccgcucagccggccg MIMAT0019696 hsa-miR-4638-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uugcuaaguaggcugagauuga MIMAT0019697 hsa-miR-4639-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucacucucaccuugcuuugc MIMAT0019698 hsa-miR-4639-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugggccagggagcagcugguggg MIMAT0019699 hsa-miR-4640-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cacccccuguuuccuggcccac MIMAT0019700 hsa-miR-4640-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugcccaugccauacuuuugccuca MIMAT0019701 hsa-miR-4641 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auggcaucguccccugguggcu MIMAT0019702 hsa-miR-4642 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gacacaugaccauaaaugcuaa MIMAT0019703 hsa-miR-4643 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggagagagaaaagagacagaag MIMAT0019704 hsa-miR-4644 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence accaggcaagaaauauugu MIMAT0019705 hsa-miR-4645-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agacaguaguucuugccugguu MIMAT0019706 hsa-miR-4645-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acugggaagaggagcugaggga MIMAT0019707 hsa-miR-4646-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auugucccucucccuucccag MIMAT0019708 hsa-miR-4646-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaagauggugcugugcugaggaa MIMAT0019709 hsa-miR-4647 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugugggacugcaaaugggag MIMAT0019710 hsa-miR-4648 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugggcgaggggugggcucucagag MIMAT0019711 hsa-miR-4649-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucugaggccugccucucccca MIMAT0019712 hsa-miR-4649-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucaggccucuuucuaccuu MIMAT0019713 hsa-miR-4650-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agguagaaugaggccugacau MIMAT0019714 hsa-miR-4650-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cggggugggugaggucgggc MIMAT0019715 hsa-miR-4651 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggggacugguuaauagaacua MIMAT0019716 hsa-miR-4652-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence guucuguuaacccauccccuca MIMAT0019717 hsa-miR-4652-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucucugagcaaggcuuaacacc MIMAT0019718 hsa-miR-4653-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggaguuaaggguugcuuggaga MIMAT0019719 hsa-miR-4653-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugugggaucuggaggcaucugg MIMAT0019720 hsa-miR-4654 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caccggggauggcagagggucg MIMAT0019721 hsa-miR-4655-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acccucgucagguccccgggg MIMAT0019722 hsa-miR-4655-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugggcugagggcaggaggccugu MIMAT0019723 hsa-miR-4656 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aauguggaaguggucugaggcau MIMAT0019724 hsa-miR-4657 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gugaguguggauccuggaggaau MIMAT0019725 hsa-miR-4658 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cugccaugucuaagaagaaaac MIMAT0019726 hsa-miR-4659a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuucuucuuagacauggcaacg MIMAT0019727 hsa-miR-4659a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugcagcucugguggaaaauggag MIMAT0019728 hsa-miR-4660 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aacuagcucuguggauccugac MIMAT0019729 hsa-miR-4661-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caggauccacagagcuagucca MIMAT0019730 hsa-miR-4661-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuagccaauuguccaucuuuag MIMAT0019731 hsa-miR-4662a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaagauagacaauuggcuaaau MIMAT0019732 hsa-miR-4662a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uugccaugucuaagaagaa MIMAT0019733 hsa-miR-4659b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuucuucuuagacauggcagcu MIMAT0019734 hsa-miR-4659b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agcugagcuccauggacgugcagu MIMAT0019735 hsa-miR-4663 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaagauggacaauuggcuaaau MIMAT0019736 hsa-miR-4662b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggggugcccacuccgcaaguu MIMAT0019737 hsa-miR-4664-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuuccggucugugagccccguc MIMAT0019738 hsa-miR-4664-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cugggggacgcgugagcgcgagc MIMAT0019739 hsa-miR-4665-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cucggccgcggcgcguagcccccgcc MIMAT0019740 hsa-miR-4665-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auacaugucagauuguaugcc MIMAT0019741 hsa-miR-4666a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cauacaaucugacauguauuu MIMAT0019742 hsa-miR-4666a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acuggggagcagaaggagaacc MIMAT0019743 hsa-miR-4667-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucccuccuucuguccccacag MIMAT0019744 hsa-miR-4667-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agggaaaaaaaaaaggauuuguc MIMAT0019745 hsa-miR-4668-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaaaauccuuuuuguuuuuccag MIMAT0019746 hsa-miR-4668-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agauguccagccacaauucucg MIMAT0019747 hsa-miR-219b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agaauugcguuuggacaaucagu MIMAT0019748 hsa-miR-219b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uguguccgggaaguggaggagg MIMAT0019749 hsa-miR-4669 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aagcgaccaugauguaacuuca MIMAT0019750 hsa-miR-4670-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugaaguuacaucauggucgcuu MIMAT0019751 hsa-miR-4670-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence accgaagacugugcgcuaaucu MIMAT0019752 hsa-miR-4671-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuagugcauagucuuuggucu MIMAT0019753 hsa-miR-4671-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuacacagcuggacagaggca MIMAT0019754 hsa-miR-4672 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uccaggcaggagccggacugga MIMAT0019755 hsa-miR-4673 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cugggcucgggacgcgcggcu MIMAT0019756 hsa-miR-4674 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggggcugugauugaccagcagg MIMAT0019757 hsa-miR-4675 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gagccaguggugagacaguga MIMAT0019758 hsa-miR-4676-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cacuguuucaccacuggcucuu MIMAT0019759 hsa-miR-4676-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuguucuuuggucuuucagcca MIMAT0019760 hsa-miR-4677-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucugugagaccaaagaacuacu MIMAT0019761 hsa-miR-4677-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aagguauuguucagacuuauga MIMAT0019762 hsa-miR-4678 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucugugauagagauucuuugcu MIMAT0019763 hsa-miR-4679 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agaacucuugcagucuuagaugu MIMAT0019764 hsa-miR-4680-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucugaauuguaagaguuguua MIMAT0019765 hsa-miR-4680-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aacgggaaugcaggcuguaucu MIMAT0019766 hsa-miR-4681 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucugaguuccuggagccuggucu MIMAT0019767 hsa-miR-4682 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggagauccagugcucgcccgau MIMAT0019768 hsa-miR-4683 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cucucuacugacuugcaacaua MIMAT0019769 hsa-miR-4684-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uguugcaagucgguggagacgu MIMAT0019770 hsa-miR-4684-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cccagggcuuggaguggggcaagguu MIMAT0019771 hsa-miR-4685-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucucccuuccugcccuggcuag MIMAT0019772 hsa-miR-4685-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaucugcugggcuuucugguguu MIMAT0019773 hsa-miR-4686 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cagcccuccucccgcacccaaa MIMAT0019774 hsa-miR-4687-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggcuguuggagggggcaggc MIMAT0019775 hsa-miR-4687-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuccuggggcccgcacucucgc MIMAT0019776 hsa-miR-1343-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaggggcagcagaggaccuggg MIMAT0019777 hsa-miR-4688 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uugaggagacauggugggggcc MIMAT0019778 hsa-miR-4689 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gagcaggcgaggcugggcugaa MIMAT0019779 hsa-miR-4690-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcagcccagcugaggccucug MIMAT0019780 hsa-miR-4690-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence guccuccaggccaugagcugcgg MIMAT0019781 hsa-miR-4691-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccagccacggacugagagugcau MIMAT0019782 hsa-miR-4691-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucaggcaguguggguaucagau MIMAT0019783 hsa-miR-4692 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auacugugaauuucacugucaca MIMAT0019784 hsa-miR-4693-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugagaguggaauucacaguauuu MIMAT0019785 hsa-miR-4693-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agguguuauccuauccauuugc MIMAT0019786 hsa-miR-4694-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caaauggacaggauaacaccu MIMAT0019787 hsa-miR-4694-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caggaggcagugggcgagcagg MIMAT0019788 hsa-miR-4695-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugaucucaccgcugccuccuuc MIMAT0019789 hsa-miR-4695-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugcaagacggauacugucaucu MIMAT0019790 hsa-miR-4696 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agggggcgcagucacugacgug MIMAT0019791 hsa-miR-4697-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugucagugacuccugccccuuggu MIMAT0019792 hsa-miR-4697-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucaaaauguagaggaagacccca MIMAT0019793 hsa-miR-4698 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agaagauugcagaguaaguucc MIMAT0019794 hsa-miR-4699-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aauuuacucugcaaucuucucc MIMAT0019795 hsa-miR-4699-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucuggggaugaggacagugugu MIMAT0019796 hsa-miR-4700-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cacaggacugacuccucaccccagug MIMAT0019797 hsa-miR-4700-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuggccaccacaccuaccccuu MIMAT0019798 hsa-miR-4701-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence augggugauggguguggugu MIMAT0019799 hsa-miR-4701-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uagcaauacaguacaaauauagu MIMAT0019801 hsa-miR-4703-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uguaguuguauuguauugccac MIMAT0019802 hsa-miR-4703-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gacacuaggcaugugagugauu MIMAT0019803 hsa-miR-4704-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucagucacauaucuagugucua MIMAT0019804 hsa-miR-4704-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucaaucacuugguaauugcugu MIMAT0019805 hsa-miR-4705 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agcggggaggaagugggcgcugcuu MIMAT0019806 hsa-miR-4706 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gccccggcgcgggcggguucugg MIMAT0019807 hsa-miR-4707-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agcccgccccagccgagguucu MIMAT0019808 hsa-miR-4707-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agagaugccgccuugcuccuu MIMAT0019809 hsa-miR-4708-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agcaaggcggcaucucucugau MIMAT0019810 hsa-miR-4708-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acaacagugacuugcucuccaa MIMAT0019811 hsa-miR-4709-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uugaagaggaggugcucuguagc MIMAT0019812 hsa-miR-4709-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uagugguccuaaacauuucaca MIMAT0019813 hsa-miR-203b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uugaacuguuaagaaccacugga MIMAT0019814 hsa-miR-203b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gggugagggcaggugguu MIMAT0019815 hsa-miR-4710 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugcaucaggccagaagacaugag MIMAT0019816 hsa-miR-4711-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cgugucuucuggcuugau MIMAT0019817 hsa-miR-4711-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uccaguacaggucucucauuuc MIMAT0019818 hsa-miR-4712-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaugagagaccuguacuguau MIMAT0019819 hsa-miR-4712-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uucucccacuaccaggcuccca MIMAT0019820 hsa-miR-4713-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugggauccagacagugggagaa MIMAT0019821 hsa-miR-4713-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aacucugaccccuuagguugau MIMAT0019822 hsa-miR-4714-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccaaccuagguggucagaguug MIMAT0019823 hsa-miR-4714-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaguuggcugcaguuaaggugg MIMAT0019824 hsa-miR-4715-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gugccaccuuaacugcagccaau MIMAT0019825 hsa-miR-4715-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uccauguuuccuucccccuucu MIMAT0019826 hsa-miR-4716-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aagggggaaggaaacauggaga MIMAT0019827 hsa-miR-4716-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agguagacugggauuuguuguu MIMAT0019828 hsa-miR-3529-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaggccacagccacccaugugu MIMAT0019829 hsa-miR-4717-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acacauggguggcuguggccu MIMAT0019830 hsa-miR-4717-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agcuguaccugaaaccaagca MIMAT0019831 hsa-miR-4718 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucacaaaucuauaauaugcagg MIMAT0019832 hsa-miR-4719 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccuggcauauuugguauaacuu MIMAT0019833 hsa-miR-4720-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugcuuaaguuguaccaaguau MIMAT0019834 hsa-miR-4720-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugagggcuccaggugacggugg MIMAT0019835 hsa-miR-4721 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggcaggagggcugugccagguug MIMAT0019836 hsa-miR-4722-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence accugccagcaccucccugcag MIMAT0019837 hsa-miR-4722-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugggggagccaugagauaagagca MIMAT0019838 hsa-miR-4723-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cccucucuggcuccuccccaaa MIMAT0019839 hsa-miR-4723-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uagcaagagaaccauuaccauu MIMAT0019840 hsa-miR-451b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aacugaaccaggagugagcuucg MIMAT0019841 hsa-miR-4724-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence guaccuucugguucagcuagu MIMAT0019842 hsa-miR-4724-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agacccugcagccuucccacc MIMAT0019843 hsa-miR-4725-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggggaaggcgucagugucggg MIMAT0019844 hsa-miR-4725-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agggccagaggagccuggagugg MIMAT0019845 hsa-miR-4726-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acccagguucccucuggccgca MIMAT0019846 hsa-miR-4726-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aucugccagcuuccacagugg MIMAT0019847 hsa-miR-4727-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auagugggaagcuggcagauuc MIMAT0019848 hsa-miR-4727-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugggaggggagaggcagcaagca MIMAT0019849 hsa-miR-4728-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caugcugaccucccuccugccccag MIMAT0019850 hsa-miR-4728-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucauuuaucuguugggaagcua MIMAT0019851 hsa-miR-4729 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuggcggagcccauuccaugcca MIMAT0019852 hsa-miR-4730 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugcugggggccacaugagugug MIMAT0019853 hsa-miR-4731-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cacacaaguggcccccaacacu MIMAT0019854 hsa-miR-4731-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uguagagcagggagcaggaagcu MIMAT0019855 hsa-miR-4732-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcccugaccuguccuguucug MIMAT0019856 hsa-miR-4732-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaucccaaugcuagacccggug MIMAT0019857 hsa-miR-4733-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccaccaggucuagcauugggau MIMAT0019858 hsa-miR-4733-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcugcgggcugcggucagggcg MIMAT0019859 hsa-miR-4734 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccuaauuugaacaccuucggua MIMAT0019860 hsa-miR-4735-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaggugcucaaauuagacau MIMAT0019861 hsa-miR-4735-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggcagguuaucugggcug MIMAT0019862 hsa-miR-4736 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence augcgaggaugcugacagug MIMAT0019863 hsa-miR-4737 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucuggcuguuguggugugcaa MIMAT0019864 hsa-miR-3064-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uugccacacugcaacaccuuaca MIMAT0019865 hsa-miR-3064-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence accagcgcguuuucaguuucau MIMAT0019866 hsa-miR-4738-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugaaacuggagcgccuggagga MIMAT0019867 hsa-miR-4738-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aagggaggaggagcggaggggcccu MIMAT0019868 hsa-miR-4739 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggacugauccucucgggcagg MIMAT0019869 hsa-miR-4740-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcccgagaggauccgucccugc MIMAT0019870 hsa-miR-4740-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cgggcuguccggaggggucggcu MIMAT0019871 hsa-miR-4741 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucaggcaaagggauauuuacaga MIMAT0019872 hsa-miR-4742-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucuguauucuccuuugccugcag MIMAT0019873 hsa-miR-4742-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggccggaugggacaggaggcau MIMAT0019874 hsa-miR-4743-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucuaaagacuagacuucgcuaug MIMAT0019875 hsa-miR-4744 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuuagugugauaauggcguuuga MIMAT0019876 hsa-miR-3591-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaacaccauugucacacuccac MIMAT0019877 hsa-miR-3591-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugaguggggcucccgggacggcg MIMAT0019878 hsa-miR-4745-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggcccggcgacgucucacgguc MIMAT0019879 hsa-miR-4745-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccggucccaggagaaccugcaga MIMAT0019880 hsa-miR-4746-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agcggugcuccugcgggccga MIMAT0019881 hsa-miR-4746-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agggaaggaggcuuggucuuag MIMAT0019882 hsa-miR-4747-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaggcccgggcuuuccucccag MIMAT0019883 hsa-miR-4747-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gagguuuggggaggauuugcu MIMAT0019884 hsa-miR-4748 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugcggggacaggccagggcauc MIMAT0019885 hsa-miR-4749-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cgccccuccugcccccacag MIMAT0019886 hsa-miR-4749-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cucgggcggaggugguugagug MIMAT0019887 hsa-miR-4750-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agaggacccguagcugcuagaagg MIMAT0019888 hsa-miR-4751 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuguggaucucaaggaugugcu MIMAT0019889 hsa-miR-4752 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caaggccaaaggaagagaacag MIMAT0019890 hsa-miR-4753-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uucucuuucuuuagccuugugu MIMAT0019891 hsa-miR-4753-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acucaaaagauggcggcacuuu MIMAT0019892 hsa-miR-371b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aagugcccccacaguuugagugc MIMAT0019893 hsa-miR-371b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence augcggaccuggguuagcggagu MIMAT0019894 hsa-miR-4754 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuucccuucagagccuggcuuu MIMAT0019895 hsa-miR-4755-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agccaggcucugaagggaaagu MIMAT0019896 hsa-miR-4755-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acagacuugcugugauguuca MIMAT0019897 hsa-miR-499b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aacaucacugcaagucuuaaca MIMAT0019898 hsa-miR-499b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cagggaggcgcucacucucugcu MIMAT0019899 hsa-miR-4756-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccagagaugguugccuuccuau MIMAT0019900 hsa-miR-4756-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggccucugugacgucacggugu MIMAT0019901 hsa-miR-4757-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caugacgucacagaggcuucgc MIMAT0019902 hsa-miR-4757-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gugagugggagccgguggggcug MIMAT0019903 hsa-miR-4758-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugccccaccugcugaccacccuc MIMAT0019904 hsa-miR-4758-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaggacuagauguuggaauua MIMAT0019905 hsa-miR-4759 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuuagauugaacaugaaguuag MIMAT0019906 hsa-miR-4760-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaauucauguucaaucuaaacc MIMAT0019907 hsa-miR-4760-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acaaggugugcaugccugacc MIMAT0019908 hsa-miR-4761-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gagggcaugcgcacuuugucc MIMAT0019909 hsa-miR-4761-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccaaaucuugaucagaagccu MIMAT0019910 hsa-miR-4762-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuucugaucaagauuuguggug MIMAT0019911 hsa-miR-4762-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cgccugcccagcccuccugcu MIMAT0019912 hsa-miR-4763-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggcaggggcuggugcugggcggg MIMAT0019913 hsa-miR-4763-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggauguggaaggaguuaucu MIMAT0019914 hsa-miR-4764-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuaacuccuuucacacccaugg MIMAT0019915 hsa-miR-4764-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugagugauugauagcuauguuc MIMAT0019916 hsa-miR-4765 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucugaaagagcaguugguguu MIMAT0019917 hsa-miR-4766-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auagcaauugcucuuuuggaa MIMAT0019918 hsa-miR-4766-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cgcgggcgcuccuggccgccgcc MIMAT0019919 hsa-miR-4767 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auucucucuggaucccauggau MIMAT0019920 hsa-miR-4768-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccaggagauccagagagaau MIMAT0019921 hsa-miR-4768-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggugggauggagagaagguaugag MIMAT0019922 hsa-miR-4769-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucugccauccucccuccccuac MIMAT0019923 hsa-miR-4769-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugagaugacacuguagcu MIMAT0019924 hsa-miR-4770 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agcagacuugaccuacaauua MIMAT0019925 hsa-miR-4771 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugaucaggcaaaauugcagacu MIMAT0019926 hsa-miR-4772-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccugcaacuuugccugaucaga MIMAT0019927 hsa-miR-4772-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cagaacaggagcauagaaaggc MIMAT0019928 hsa-miR-4773 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucugguauguaguagguaauaa MIMAT0019929 hsa-miR-4774-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auugccuaacaugugccagaa MIMAT0019930 hsa-miR-4774-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuaauuuuuuguuucggucacu MIMAT0019931 hsa-miR-4775 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence guggaccaggauggcaagggcu MIMAT0019932 hsa-miR-4776-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuugccauccugguccacugcau MIMAT0019933 hsa-miR-4776-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uucuagaugagagauauauaua MIMAT0019934 hsa-miR-4777-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auaccucaucuagaaugcugua MIMAT0019935 hsa-miR-4777-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aauucuguaaaggaagaagagg MIMAT0019936 hsa-miR-4778-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucuucuuccuuugcagaguuga MIMAT0019937 hsa-miR-4778-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaggagggaauaguaaaagcag MIMAT0019938 hsa-miR-4779 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acccuugagccugaucccuagc MIMAT0019939 hsa-miR-4780 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence guccacuucugccugcccugcc MIMAT0019940 hsa-miR-4436b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cagggcaggaagaaguggacaa MIMAT0019941 hsa-miR-4436b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uagcggggauuccaauauugg MIMAT0019942 hsa-miR-4781-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aauguuggaauccucgcuagag MIMAT0019943 hsa-miR-4781-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uucuggauaugaagacaaucaa MIMAT0019944 hsa-miR-4782-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugauugucuucauaucuagaac MIMAT0019945 hsa-miR-4782-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggcgcgcccagcucccgggcu MIMAT0019946 hsa-miR-4783-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccccgguguuggggcgcgucugc MIMAT0019947 hsa-miR-4783-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugaggagaugcugggacuga MIMAT0019948 hsa-miR-4784 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agagucggcgacgccgccagc MIMAT0019949 hsa-miR-4785 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaggccuuuagaucacuuaaa MIMAT0019950 hsa-miR-1245b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucagaugaucuaaaggccuaua MIMAT0019951 hsa-miR-1245b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugaggcucuguuagccuuggcuc MIMAT0019952 hsa-miR-2467-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agcagaggcagagaggcucagg MIMAT0019953 hsa-miR-2467-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugagaccaggacuggaugcacc MIMAT0019954 hsa-miR-4786-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugaagccagcucuggucugggc MIMAT0019955 hsa-miR-4786-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcggggguggcggcggcauccc MIMAT0019956 hsa-miR-4787-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaugcgccgcccacugccccgcgc MIMAT0019957 hsa-miR-4787-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuacggaccagcuaagggaggc MIMAT0019958 hsa-miR-4788 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence guauacaccugauauguguaug MIMAT0019959 hsa-miR-4789-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cacacauagcagguguauaua MIMAT0019960 hsa-miR-4789-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aucgcuuuaccauucauguu MIMAT0019961 hsa-miR-4790-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugaaugguaaagcgaugucaca MIMAT0019962 hsa-miR-4790-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggauaugaugacugaaa MIMAT0019963 hsa-miR-4791 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cggugagcgcucgcuggc MIMAT0019964 hsa-miR-4792 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acauccugcuccacagggcagagg MIMAT0019965 hsa-miR-4793-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucugcacugugaguuggcuggcu MIMAT0019966 hsa-miR-4793-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucuggcuaucucacgagacugu MIMAT0019967 hsa-miR-4794 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agaaguggcuaauaauauuga MIMAT0019968 hsa-miR-4795-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auauuauuagccacuucuggau MIMAT0019969 hsa-miR-4795-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugucuauacucugucacuuuac MIMAT0019970 hsa-miR-4796-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaaaguggcagaguauagacac MIMAT0019971 hsa-miR-4796-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gacagagugccacuuacugaa MIMAT0019972 hsa-miR-4797-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucucaguaaguggcacucugu MIMAT0019973 hsa-miR-4797-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uucgguauacuuugugaauugg MIMAT0019974 hsa-miR-4798-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aacucacgaaguauaccgaagu MIMAT0019975 hsa-miR-4798-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aucuaaaugcagcaugccaguc MIMAT0019976 hsa-miR-4799-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acuggcaugcugcauuuauaua MIMAT0019977 hsa-miR-4799-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aguggaccgaggaaggaagga MIMAT0019978 hsa-miR-4800-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cauccguccgucuguccac MIMAT0019979 hsa-miR-4800-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uacacaagaaaaccaaggcuca MIMAT0019980 hsa-miR-4801 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uauggagguucuagaccauguu MIMAT0019981 hsa-miR-4802-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uacauggauggaaaccuucaagc MIMAT0019982 hsa-miR-4802-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaacauaauaguguggauuga MIMAT0019983 hsa-miR-4803 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuggacgguaagguuaagcaa MIMAT0019984 hsa-miR-4804-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugcuuaaccuugcccucgaaa MIMAT0019985 hsa-miR-4804-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuuggacagaaaacacgcaggu MIMAT0020300 hsa-miR-4520-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_6239), with sequence cauacuuccuuacaugcccaua MIMAT0020301 cel-miR-1-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_6239), with sequence cuuuggugauucagcuucaauga MIMAT0020322 cel-miR-79-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uugcagcugcgguuguaaggu MIMAT0020541 hsa-miR-5047 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuacaggcgugaaccaccgcg MIMAT0020600 hsa-miR-5095 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggagauggagguugcagug MIMAT0020601 hsa-miR-1273f A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggugguugaggcugcaguaagu MIMAT0020602 hsa-miR-1273g-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence guuucaccauguuggucaggc MIMAT0020603 hsa-miR-5096 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gugcacacacacacauacgu MIMAT0020631 mmu-miR-466q A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agacacauuuggagagggaacc MIMAT0020924 hsa-miR-642a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agugccugagggaguaagag MIMAT0020925 hsa-miR-550a-3-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cgucccaccccccacuccugu MIMAT0020956 hsa-miR-4433a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caaaaacugcaguuacuuuugc MIMAT0020957 hsa-miR-548ah-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuucuauuucucaguggggcuc MIMAT0020958 hsa-miR-4482-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucgugcauauaucuaccacau MIMAT0020959 hsa-miR-4536-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugcuguauugucagguaguga MIMAT0021017 hsa-miR-4999-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucacuaccugacaauacagu MIMAT0021018 hsa-miR-4999-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caguucagaaguguuccugagu MIMAT0021019 hsa-miR-5000-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucaggacacuucugaacuugga MIMAT0021020 hsa-miR-5000-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agggcuggacucagcggcggagcu MIMAT0021021 hsa-miR-5001-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uucugccucuguccagguccuu MIMAT0021022 hsa-miR-5001-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aauuugguuucugaggcacuuagu MIMAT0021023 hsa-miR-5002-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugacugccucacugaccacuu MIMAT0021024 hsa-miR-5002-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucacaacaaccuugcaggguaga MIMAT0021025 hsa-miR-5003-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uacuuuucuagguuguugggg MIMAT0021026 hsa-miR-5003-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugaggacagggcaaauucacga MIMAT0021027 hsa-miR-5004-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuuggauuuuccugggccucag MIMAT0021028 hsa-miR-5004-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agaaguaacuacgguuuuugca MIMAT0021029 hsa-miR-548ao-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaagaccgugacuacuuuugca MIMAT0021030 hsa-miR-548ao-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uugccagggcaggagguggaa MIMAT0021033 hsa-miR-5006-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuucccuuuccauccuggcag MIMAT0021034 hsa-miR-5006-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uagagucuggcugauaugguuu MIMAT0021035 hsa-miR-5007-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aucauaugaaccaaacucuaau MIMAT0021036 hsa-miR-5007-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaaguaauugcggucuuu MIMAT0021037 hsa-miR-548ap-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaaaccacaauuacuuuu MIMAT0021038 hsa-miR-548ap-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugaggcccuuggggcacagugg MIMAT0021039 hsa-miR-5008-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccugugcucccagggccucgc MIMAT0021040 hsa-miR-5008-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuggacuuuuucagauuuggggau MIMAT0021041 hsa-miR-5009-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uccuaaaucugaaaguccaaaa MIMAT0021042 hsa-miR-5009-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agggggauggcagagcaaaauu MIMAT0021043 hsa-miR-5010-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuuugugucucccauuccccag MIMAT0021044 hsa-miR-5010-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uauauauacagccaugcacuc MIMAT0021045 hsa-miR-5011-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gugcauggcuguauauauaaca MIMAT0021046 hsa-miR-5011-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggguuuguagcuuugcuggcaug MIMAT0021079 hsa-miR-5087 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cagggcucagggauuggauggagg MIMAT0021080 hsa-miR-5088-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gugggauuucugaguagcauc MIMAT0021081 hsa-miR-5089-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccggggcagauugguguagggug MIMAT0021082 hsa-miR-5090 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acggagacgacaagacugugcug MIMAT0021083 hsa-miR-5091 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aauccacgcugagcuuggcauc MIMAT0021084 hsa-miR-5092 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggaaaugaggcuggcuaggagc MIMAT0021085 hsa-miR-5093 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaucagugaaugccuugaaccu MIMAT0021086 hsa-miR-5094 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agagauugguagaaaucaggu MIMAT0021116 hsa-miR-5186 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugggaugagggauugaagugga MIMAT0021117 hsa-miR-5187-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acugaauccucuuuuccucag MIMAT0021118 hsa-miR-5187-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaucggacccauuuaaaccggag MIMAT0021119 hsa-miR-5188 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucugggcacaggcggauggacagg MIMAT0021120 hsa-miR-5189-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccagugacugagcuggagcca MIMAT0021121 hsa-miR-5190 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggauaggaagaaugaagugcu MIMAT0021122 hsa-miR-5191 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggagaguggauuccagguggu MIMAT0021123 hsa-miR-5192 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uccuccucuaccucaucccagu MIMAT0021124 hsa-miR-5193 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugagggguuuggaaugggaugg MIMAT0021125 hsa-miR-5194 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaccccuaaggcaacuggaugg MIMAT0021126 hsa-miR-5195-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auccaguucucugagggggcu MIMAT0021127 hsa-miR-5195-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agggaaggggacgaggguuggg MIMAT0021128 hsa-miR-5196-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucauccucgucucccucccag MIMAT0021129 hsa-miR-5196-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caauggcacaaacucauucuuga MIMAT0021130 hsa-miR-5197-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aagaagagacugagucaucgaau MIMAT0021131 hsa-miR-5197-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auagcagcauaagccugucuc MIMAT0022255 hsa-miR-4524b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gagacagguucaugcugcua MIMAT0022256 hsa-miR-4524b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caauucucaaaggagccuccc MIMAT0022257 hsa-miR-5571-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence guccuaggaggcuccucug MIMAT0022258 hsa-miR-5571-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uucagaucccagcggugccucu MIMAT0022259 hsa-miR-5100 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence guuggggugcaggggucugcu MIMAT0022260 hsa-miR-5572 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaaaguaauugcuguuuuugcc MIMAT0022263 hsa-miR-548aq-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caaaaacugcaauuacuuuugc MIMAT0022264 hsa-miR-548aq-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaaguaauugcaguuuuugc MIMAT0022265 hsa-miR-548ar-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaaaacugcaguuauuuuugc MIMAT0022266 hsa-miR-548ar-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaaguaauugcggguuuugcc MIMAT0022267 hsa-miR-548as-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaaaacccacaauuauguuugu MIMAT0022268 hsa-miR-548as-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaugguacuccuuaagcuaac MIMAT0022269 hsa-miR-5579-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuagcuuaaggaguaccagauc MIMAT0022270 hsa-miR-5579-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugggcuaagggagaugauugggua MIMAT0022271 hsa-miR-664b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uucauuugccucccagccuaca MIMAT0022272 hsa-miR-664b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugcuggcucauuucauaugugu MIMAT0022273 hsa-miR-5580-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cacauaugaagugagccagcac MIMAT0022274 hsa-miR-5580-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agccuuccaggagaaauggaga MIMAT0022275 hsa-miR-5581-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuccaugccuccuagaaguucc MIMAT0022276 hsa-miR-5581-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaaguuauugcgguuuuggcu MIMAT0022277 hsa-miR-548at-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caaaaccgcaguaacuuuugu MIMAT0022278 hsa-miR-548at-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaggcacacuuaaaguuauagc MIMAT0022279 hsa-miR-5582-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaaaacuuuaagugugccuagg MIMAT0022280 hsa-miR-5582-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaacuaauauacccauauucug MIMAT0022281 hsa-miR-5583-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaauauggguauauuaguuugg MIMAT0022282 hsa-miR-5583-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cagggaaaugggaagaacuaga MIMAT0022283 hsa-miR-5584-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaguucuucccuuugcccaauu MIMAT0022284 hsa-miR-5584-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugaaguaccagcuacucgagag MIMAT0022285 hsa-miR-5585-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cugaauagcugggacuacaggu MIMAT0022286 hsa-miR-5585-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uauccagcuuguuacuauaugc MIMAT0022287 hsa-miR-5586-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cagagugacaagcugguuaaag MIMAT0022288 hsa-miR-5586-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auggucaccuccgggacu MIMAT0022289 hsa-miR-5587-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gccccgggcagugugaucauc MIMAT0022290 hsa-miR-5587-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaaguaauugcgguuuuugc MIMAT0022291 hsa-miR-548au-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggcaguuacuuuugcaccag MIMAT0022292 hsa-miR-548au-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cacccagaucugcggccuaau MIMAT0022293 hsa-miR-1295b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aauaggccacggaucugggcaa MIMAT0022294 hsa-miR-1295b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acuggcauuagugggacuuuu MIMAT0022295 hsa-miR-5588-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aagucccacuaaugccagc MIMAT0022296 hsa-miR-5588-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggcugggugcucuugugcagu MIMAT0022297 hsa-miR-5589-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugcacauggcaaccuagcuccca MIMAT0022298 hsa-miR-5589-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uugccauacauagacuuuauu MIMAT0022299 hsa-miR-5590-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aauaaaguucauguauggcaa MIMAT0022300 hsa-miR-5590-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugggagcuaagcuauggguau MIMAT0022301 hsa-miR-5591-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auacccauagcuuagcuccca MIMAT0022302 hsa-miR-5591-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaaguacuugcggauuu MIMAT0022303 hsa-miR-548av-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaacugcaguuacuuuugc MIMAT0022304 hsa-miR-548av-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ucugggcagagcugcaggagaga MIMAT0022357 mmu-miR-1231-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugcccugucuguucugcccacag MIMAT0022358 mmu-miR-1231-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gagaaaugcuggacuaaucugc MIMAT0022468 hsa-miR-5680 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agaaaggguggcaauaccucuu MIMAT0022469 hsa-miR-5681a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence guagcaccuugcaggauaaggu MIMAT0022470 hsa-miR-5682 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gugcaaaagucaucacgguu MIMAT0022471 hsa-miR-548aw A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uacagaugcagauucucugacuuc MIMAT0022472 hsa-miR-5683 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aacucuagccugagcaacag MIMAT0022473 hsa-miR-5684 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agaaguaauugcgguuuugcca MIMAT0022474 hsa-miR-548ax A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acagcccagcaguuaucacggg MIMAT0022475 hsa-miR-5685 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aauaauaucacaguagguguac MIMAT0022476 hsa-miR-5692c A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuagaacguuuuagggucaaau MIMAT0022478 hsa-miR-5687 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaacaaacaccuguaaaacagc MIMAT0022479 hsa-miR-5688 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agguauugccacccuuucuagu MIMAT0022480 hsa-miR-5681b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agcauacaccuguaguccuaga MIMAT0022481 hsa-miR-5689 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucagcuacuaccucuauuagg MIMAT0022482 hsa-miR-5690 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uugcucugagcuccgagaaagc MIMAT0022483 hsa-miR-5691 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caaauaauaccacagugggugu MIMAT0022484 hsa-miR-5692a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uugcaugucagauuguaauuccc MIMAT0022485 hsa-miR-4666b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcaguggcucugaaaugaacuc MIMAT0022486 hsa-miR-5693 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cagaucaugggacugucucag MIMAT0022487 hsa-miR-5694 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acuccaagaagaaucuagacag MIMAT0022488 hsa-miR-5695 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cucauuuaaguagucugaugcc MIMAT0022489 hsa-miR-5696 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucaaguaguuucaugauaaagg MIMAT0022490 hsa-miR-5697 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugggggagugcagugauugugg MIMAT0022491 hsa-miR-5698 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uccugucuuuccuuguuggagc MIMAT0022492 hsa-miR-5699-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaaugcauuaaauuauugaagg MIMAT0022493 hsa-miR-5700 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuauugucacguucugauu MIMAT0022494 hsa-miR-5701 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugagucagcaacauaucccaug MIMAT0022495 hsa-miR-5702 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggagaagucgggaaggu MIMAT0022496 hsa-miR-5703 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aauaauaucacaguaggugu MIMAT0022497 hsa-miR-5692b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuaggccaucaucccauuaugc MIMAT0022498 hsa-miR-5704 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uguuucggggcucauggccugug MIMAT0022499 hsa-miR-5705 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uucuggauaacaugcugaagcu MIMAT0022500 hsa-miR-5706 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acguuugaaugcuguacaaggc MIMAT0022501 hsa-miR-5707 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence augagcgacugugccugacc MIMAT0022502 hsa-miR-5708 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ccuuaucacuuuuccagccagc MIMAT0022690 mmu-miR-184-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cggguagagagggcagugggagg MIMAT0022691 hsa-miR-197-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cucacugaacaaugaaugcaa MIMAT0022692 hsa-miR-181b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcugggaaggcaaagggacgu MIMAT0022693 hsa-miR-204-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcagggacagcaaaggggugc MIMAT0022694 hsa-miR-211-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence accuuggcucuagacugcuuacu MIMAT0022695 hsa-miR-212-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcucugacuuuauugcacuacu MIMAT0022696 hsa-miR-301a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaucauucacggacaacacuu MIMAT0022697 hsa-miR-382-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcccugaacgaggggucuggag MIMAT0022698 hsa-miR-345-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auugggaacauuuugcauguau MIMAT0022700 hsa-miR-450a-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uauucaggaagguguuacuuaa MIMAT0022701 hsa-miR-506-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uacucuggagagugacaaucaug MIMAT0022702 hsa-miR-514a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugucauaugugugaugacacuuucu MIMAT0022704 mmu-miR-489-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aucauacaaggacaauuucuuu MIMAT0022705 hsa-miR-539-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aucaaggaucuuaaacuuugcc MIMAT0022706 hsa-miR-561-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaagguaauugcaguuuuuccc MIMAT0022707 hsa-miR-570-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucaguuccaggccaaccaggcu MIMAT0022708 hsa-miR-584-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caacccuaggagagggugccauuca MIMAT0022709 hsa-miR-652-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggaccuucccugaaccaagga MIMAT0022710 hsa-miR-659-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence accuccugugugcauggauua MIMAT0022711 hsa-miR-660-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agugccugcuaugugccaggca MIMAT0022712 hsa-miR-1271-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auauacagggggagacucucau MIMAT0022713 hsa-miR-1185-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggaggaauuggugcuggucuu MIMAT0022714 hsa-miR-766-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence caguugcuagcugcacuacccu MIMAT0022715 mmu-miR-449c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggagacugaugaguucccggga MIMAT0022717 hsa-miR-873-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaucucacuuuguugcccagg MIMAT0022719 hsa-miR-1285-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucucacuguagccucgaacccc MIMAT0022720 hsa-miR-1304-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccccgggaacgucgagacuggagc MIMAT0022721 hsa-miR-1247-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugcaaaaguaauugcaguuuuug MIMAT0022722 hsa-miR-548g-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caaaaaccgcaauuacuuuugca MIMAT0022723 hsa-miR-548h-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaauauauauauauauguacguau MIMAT0022724 hsa-miR-1277-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaccacuuucuuugcucaucca MIMAT0022725 hsa-miR-1255b-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccaccuccccugcaaacgucca MIMAT0022726 hsa-miR-1306-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucgaccggaccucgaccggcu MIMAT0022727 hsa-miR-1307-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaaauuucaccuuucugagaaga MIMAT0022728 hsa-miR-513c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaaaccacaauuacuuuugcacca MIMAT0022730 hsa-miR-548t-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaagucucgcucucugccccuca MIMAT0022731 hsa-miR-3184-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cucucuggccgucuaccuucca MIMAT0022732 hsa-miR-3191-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugcaaaaguaauugcaguuuuug MIMAT0022733 hsa-miR-548x-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cacuuagcagguuguauuauau MIMAT0022735 hsa-miR-374c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gguucccucuccaaaugugucu MIMAT0022736 hsa-miR-642b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence augugccugagggaguaagaca MIMAT0022737 hsa-miR-550b-2-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaaguaauugcgguuuuugcc MIMAT0022738 hsa-miR-548o-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugcaaaaguaauugcaguuuuug MIMAT0022739 hsa-miR-548aj-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaaguaauugcgguuuuugcc MIMAT0022740 hsa-miR-548am-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aacaacaaaaucacuagucuucca MIMAT0022741 hsa-miR-3529-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence accacugcacuccagccugag MIMAT0022742 hsa-miR-1273g-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agggacuuucaggggcagcugu MIMAT0022833 hsa-miR-365b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaaugccccuaaaaauccuuau MIMAT0022834 hsa-miR-365b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gguuuaccgucccacauacau MIMAT0022836 mmu-miR-299b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uaugugggacgguaaacc MIMAT0022837 mmu-miR-299b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auauacagggggagacucuuau MIMAT0022838 hsa-miR-1185-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uguggaagguagacggccagaga MIMAT0022839 hsa-miR-3190-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence agaauuguggcuggacaucugu MIMAT0022841 mmu-miR-219a-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuauacaacuuacuacuuuccc MIMAT0022842 hsa-miR-98-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucacaguggucucugggauuau MIMAT0022844 hsa-miR-216a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gguggauauuccuucuauguu MIMAT0022861 hsa-miR-376c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agcgagguugcccuuuguauau MIMAT0022862 hsa-miR-381-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cguggauauuccuucuauguuu MIMAT0022923 hsa-miR-376b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaaguugcccauguuauuuucg MIMAT0022924 hsa-miR-495-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gggguauuguuuccgcugccagg MIMAT0022925 hsa-miR-503-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gguagauuuuccuucuauggu MIMAT0022928 hsa-miR-376a-2-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaugguugaccagagagcacac MIMAT0022929 hsa-miR-758-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gugagucaggguggggcugg MIMAT0022938 hsa-miR-937-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cccugggccucugcuccccag MIMAT0022939 hsa-miR-939-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cagggucagcugagcaug MIMAT0022940 hsa-miR-1178-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence guggggccaggcggugg MIMAT0022941 hsa-miR-1227-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence guggguaggguuugggggagagcg MIMAT0022942 hsa-miR-1229-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agugggaggccagggcacggca MIMAT0022943 hsa-miR-1233-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugagugacaggggaaaugggga MIMAT0022945 hsa-miR-1236-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cgggggcggggccgaagcgcg MIMAT0022946 hsa-miR-1237-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gugagugggagccccagugugug MIMAT0022947 hsa-miR-1238-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucgcgccccggcucccguuc MIMAT0022948 hsa-miR-1292-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaauuucuuucacuacuuag MIMAT0022965 hsa-miR-3606-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caucagcacccuauguccuuucu MIMAT0022966 hsa-miR-3617-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gugggcugggcugggcugggcc MIMAT0022967 hsa-miR-3620-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gccuaucacauaucugccugu MIMAT0022970 hsa-miR-3927-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugcucagguugcacagcuggga MIMAT0022975 hsa-miR-3934-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gagggcagcguggguguggcgga MIMAT0022977 hsa-miR-4632-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuucugucuuuucugguccag MIMAT0022978 hsa-miR-4743-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccugacccacccccucccgcag MIMAT0022979 hsa-miR-4750-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence augcuacucggaaaucccacuga MIMAT0022984 hsa-miR-5089-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcggagagagaauggggagc MIMAT0023116 hsa-miR-5739 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gggcuggggcgcggggaggu MIMAT0023252 hsa-miR-5787 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccugcgagucuccggcggugg MIMAT0023693 hsa-miR-6068 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gggcuagggccugcugccccc MIMAT0023694 hsa-miR-6069 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccgguuccagucccuggag MIMAT0023695 hsa-miR-6070 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uucugcugccggccaaggc MIMAT0023696 hsa-miR-6071 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uccucaucacacugcaccuuag MIMAT0023697 hsa-miR-6072 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gguagugaguuaucagcuac MIMAT0023698 hsa-miR-6073 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gauauucagaggcuaggugg MIMAT0023699 hsa-miR-6074 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acggcccaggcggcauuggug MIMAT0023700 hsa-miR-6075 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agcaugacagaggagaggugg MIMAT0023701 hsa-miR-6076 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gggaagagcuguacggccuuc MIMAT0023702 hsa-miR-6077 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccgccugagcuagcugugg MIMAT0023703 hsa-miR-6078 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuggaagcuuggaccaacuagcug MIMAT0023704 hsa-miR-6079 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucuagugcgggcguucccg MIMAT0023705 hsa-miR-6080 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggagcagugccggccaaggcgcc MIMAT0023706 hsa-miR-6081 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaauacgucugguugaucc MIMAT0023707 hsa-miR-6082 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuuauaucagaggcuguggg MIMAT0023708 hsa-miR-6083 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuccgccagucgguggccgg MIMAT0023709 hsa-miR-6084 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaggggcugggggagcaca MIMAT0023710 hsa-miR-6085 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggagguugggaagggcagag MIMAT0023711 hsa-miR-6086 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugaggcgggggggcgagc MIMAT0023712 hsa-miR-6087 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agagaugaagcgggggggcg MIMAT0023713 hsa-miR-6088 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggaggccgggguggggcggggcgg MIMAT0023714 hsa-miR-6089 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggggagcgaggggcggggc MIMAT0023715 hsa-miR-6090 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gggaaaaggaagggggagga MIMAT0024597 hsa-miR-6124 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcggaaggcggagcggcgga MIMAT0024598 hsa-miR-6125 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gugaaggcccggcggaga MIMAT0024599 hsa-miR-6126 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugagggagugggugggagg MIMAT0024610 hsa-miR-6127 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acuggaauuggagucaaaa MIMAT0024611 hsa-miR-6128 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acuggauuuggagccagaa MIMAT0024612 hsa-miR-378j A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugagggaguuggguguaua MIMAT0024613 hsa-miR-6129 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugagggaguggauuguaug MIMAT0024614 hsa-miR-6130 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggcuggucagaugggagug MIMAT0024615 hsa-miR-6131 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agcagggcuggggauugca MIMAT0024616 hsa-miR-6132 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugagggaggagguugggua MIMAT0024617 hsa-miR-6133 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugaggugguaggauguaga MIMAT0024618 hsa-miR-6134 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cagcaggaggugaggggag MIMAT0024782 hsa-miR-6165 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uacuccagaauauggcaaucaug MIMAT0024849 rno-miR-509-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ugauugacaugucugcagugga MIMAT0024850 rno-miR-509-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ccaccuccccugcaaacgucca MIMAT0024851 rno-miR-1306-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence gacguuggcucugguggugaug MIMAT0024852 rno-miR-1306-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uucauucggcuguccagaugua MIMAT0025060 rno-miR-1298 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence acaaguuccugcaaaugcacac MIMAT0025177 mmu-miR-873b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugggagcagcaagagaaccgu MIMAT0025178 mmu-miR-451b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucgggcgcaagagcacugcagu MIMAT0025450 hsa-miR-6499-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agcaguguuuguuuugcccaca MIMAT0025451 hsa-miR-6499-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaaguaauugugguuuuugc MIMAT0025452 hsa-miR-548ay-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caaaaccgcgauuacucuugca MIMAT0025453 hsa-miR-548ay-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggagcuauccacuccaggugucc MIMAT0025454 hsa-miR-6500-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acacuuguugggaugaccugc MIMAT0025455 hsa-miR-6500-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caaaagugauugugguuuuugc MIMAT0025456 hsa-miR-548az-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaaacugcaaucacuuuugc MIMAT0025457 hsa-miR-548az-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aguugccagggcugccuuuggu MIMAT0025458 hsa-miR-6501-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccagagcagccugcgguaacagu MIMAT0025459 hsa-miR-6501-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agcucuagaaagauuguugacc MIMAT0025460 hsa-miR-6502-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uagaccaucuuucuagaguau MIMAT0025461 hsa-miR-6502-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggucugcauucaaauccccaga MIMAT0025462 hsa-miR-6503-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gggacuaggaugcagaccucc MIMAT0025463 hsa-miR-6503-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucuggcugugcuguaaugcag MIMAT0025464 hsa-miR-6504-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cauuacagcacagccauucu MIMAT0025465 hsa-miR-6504-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuggaauaggggauaucucagc MIMAT0025466 hsa-miR-6505-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugacuucuaccucuuccaaag MIMAT0025467 hsa-miR-6505-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acugggaugucacugaauauggu MIMAT0025468 hsa-miR-6506-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucguaucagagauuccagacac MIMAT0025469 hsa-miR-6506-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaagaauaggagggacuuugu MIMAT0025470 hsa-miR-6507-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caaaguccuuccuauuuuuccc MIMAT0025471 hsa-miR-6507-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucuagaaaugcaugacccacc MIMAT0025472 hsa-miR-6508-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugggccaugcauuucuagaacu MIMAT0025473 hsa-miR-6508-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auuagguaguggcaguggaac MIMAT0025474 hsa-miR-6509-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuccacugccacuaccuaauuu MIMAT0025475 hsa-miR-6509-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cagcaggggagagagaggaguc MIMAT0025476 hsa-miR-6510-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caccgacucugucuccugcag MIMAT0025477 hsa-miR-6510-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caggcagaaguggggcugacagg MIMAT0025478 hsa-miR-6511a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccucaccaucccuucugccugc MIMAT0025479 hsa-miR-6511a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaccauuagaagagcuggaaga MIMAT0025480 hsa-miR-6512-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuccagcccuucuaaugguagg MIMAT0025481 hsa-miR-6512-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuugggauugacgccacaugucu MIMAT0025482 hsa-miR-6513-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucaagugucaucugucccuag MIMAT0025483 hsa-miR-6513-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uauggaguggacuuucagcuggc MIMAT0025484 hsa-miR-6514-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cugccuguucuuccacuccag MIMAT0025485 hsa-miR-6514-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuggaggguguggaagacauc MIMAT0025486 hsa-miR-6515-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucucuucaucuaccccccag MIMAT0025487 hsa-miR-6515-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence cauucaccgcgugccuuaauu MIMAT0025599 gga-miR-124c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ucaagguccgcugugaacacgg MIMAT0025600 gga-miR-124c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uacauaugaugagcuuugcagu MIMAT0025607 gga-miR-3607-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence cuguaaacgcuuucugaugugcc MIMAT0025608 gga-miR-3607-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ugcucaguagucaguguaggaucugu MIMAT0025617 gga-miR-222b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence agcuacaucugauuacugggucac MIMAT0025618 gga-miR-222b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uggcuguuguggugugcaaaa MIMAT0025631 gga-miR-3064-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uugccacacugcaacacuuuaca MIMAT0025632 gga-miR-3064-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence augcaguaacaggugugagcau MIMAT0025806 gga-miR-6516-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence cauguaugauacugcacacaacg MIMAT0025807 gga-miR-6516-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccaaaccagucgugccugugg MIMAT0025841 hsa-miR-6715a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acaggcacgacugguuuggca MIMAT0025842 hsa-miR-6715b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cucaaaccggcugugccugugg MIMAT0025843 hsa-miR-6715b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugggaauggggguaagggcc MIMAT0025844 hsa-miR-6716-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uccgaacucuccauuccucugc MIMAT0025845 hsa-miR-6716-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggcgauguggggauguagaga MIMAT0025846 hsa-miR-6717-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cugcaggcagaaguggggcugaca MIMAT0025847 hsa-miR-6511b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccucaccaccccuucugccugca MIMAT0025848 hsa-miR-6511b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaguggucagagggcuuauga MIMAT0025849 hsa-miR-6718-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucugacaucagugauucuccug MIMAT0025850 hsa-miR-6719-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cgcgccugcaggaacugguaga MIMAT0025851 hsa-miR-6720-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugggcaggggcuuauuguaggag MIMAT0025852 hsa-miR-6721-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggcgcacccgaccacaugc MIMAT0025853 hsa-miR-6722-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugcaggggucgggugggccagg MIMAT0025854 hsa-miR-6722-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auaguccgaguaacgucggggc MIMAT0025855 hsa-miR-6723-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cugggcccgcggcgggcgugggg MIMAT0025856 hsa-miR-6724-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uauucagaaaggugccaguca MIMAT0025857 hsa-miR-892c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cacuguuuccuuucugagugga MIMAT0025858 hsa-miR-892c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence acaagucaggcucuugggaccu MIMAT0026467 rno-miR-125b-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuguacaaccuucuagcuuucc MIMAT0026472 hsa-let-7c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucaauaaaugucuguugaauu MIMAT0026473 hsa-miR-95-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gagcuuuuggcccggguuauac MIMAT0026474 hsa-miR-208a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agccccugcccaccgcacacug MIMAT0026475 hsa-miR-210-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucugucauuucuuuaggccaaua MIMAT0026476 hsa-miR-215-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cggggccguagcacugucugaga MIMAT0026477 hsa-miR-128-1-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agcugguaaaauggaaccaaau MIMAT0026478 hsa-miR-133a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agguucugugauacacuccgacu MIMAT0026479 hsa-miR-152-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucauuuuugugauguugcagcu MIMAT0026480 hsa-miR-153-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccugugggccaccuagucaccaa MIMAT0026481 hsa-miR-134-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuauauaucaaacauauuccu MIMAT0026482 hsa-miR-190a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caggucacgucucugcaguuac MIMAT0026483 hsa-miR-370-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccucaaauguggagcacuauucu MIMAT0026484 hsa-miR-372-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acagcacugccuggucaga MIMAT0026485 hsa-miR-383-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gggggggcaggaggggcucaggg MIMAT0026486 hsa-miR-328-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence cugauuucuuuugguguucaga MIMAT0026487 gga-miR-29a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence agcugguuucauauggugguuuaga MIMAT0026488 gga-miR-29b-1-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence auguagggauggaagccaugaa MIMAT0026489 gga-miR-135a-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence aauguuccugcagugcagua MIMAT0026490 gga-miR-33-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence cuauacaaucuacugucuuucc MIMAT0026491 gga-let-7a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence cuguacaaccuucuagcuuucc MIMAT0026492 gga-let-7c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence acaagucaggcucuugggaccu MIMAT0026493 gga-miR-125b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence aaccuggcauacaauguagauuucugu MIMAT0026494 gga-miR-221-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence agguugggaucaguugcaaugcu MIMAT0026495 gga-miR-92-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence aguuuugcagguuugcauccagc MIMAT0026496 gga-miR-19b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence aaucuacugcauuauaagcacuuaaagu MIMAT0026497 gga-miR-20a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence aguuuugcauaguugcacuac MIMAT0026498 gga-miR-19a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence acugcccuaagugcuccuucug MIMAT0026499 gga-miR-18a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ccaguauuaacugugcugcugaa MIMAT0026500 gga-miR-16-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ccuauucuugguuacuugcacug MIMAT0026501 gga-miR-26a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ucauuuuugugauguugcagcu MIMAT0026502 gga-miR-153-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence aaaguucugugacacucagacu MIMAT0026503 gga-miR-148a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence cuacagcacgaaacugccuuaa MIMAT0026504 gga-miR-196-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uacuucacaacaccagggug MIMAT0026505 gga-miR-138-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence gggggccguuacacuguaagaga MIMAT0026506 gga-miR-128-2-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ggcuacaacacaggacauggga MIMAT0026507 gga-miR-187-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence aauuuagugugugcgauacu MIMAT0026508 gga-miR-32-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence agcugguaaaauggaaccaaauc MIMAT0026509 gga-miR-133a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence acauacuucuuuauguacccaua MIMAT0026510 gga-miR-1a-2-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence guucacagcggaccuugau MIMAT0026511 gga-miR-124a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence cugggggguggauguuuacuuc MIMAT0026512 gga-miR-30b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ccaucaguuccuaaugcauugcc MIMAT0026513 gga-miR-217-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ccugucauuucuauaggccaaua MIMAT0026514 gga-miR-215-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ugggagaaggcuguuuacucu MIMAT0026515 gga-miR-30c-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uacugcccuaaaugcuccuucuggc MIMAT0026516 gga-miR-18b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence acugcaguauaagcacuucugg MIMAT0026517 gga-miR-106-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence caugguucugucaagcaccaug MIMAT0026518 gga-miR-218-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence agcuucuuuacagugcugccuug MIMAT0026519 gga-miR-103-2-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence agcuucuuuacaguguugccuug MIMAT0026520 gga-miR-107-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence agauucgauucuaggggaaua MIMAT0026521 gga-miR-10b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ucacugaacaaugaaugcaac MIMAT0026522 gga-miR-181b-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence acggguauucuuggguggauaaua MIMAT0026523 gga-miR-137-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence gaaucauuauuugcugcuuua MIMAT0026524 gga-miR-15b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence cuauauaucaaacauauuccu MIMAT0026525 gga-miR-190a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ccuuaucacuuuuccagcccagc MIMAT0026526 gga-miR-184-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence cuguacaggccacugccuugcc MIMAT0026527 gga-let-7g-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence cuauacaaucuauugccuuccc MIMAT0026528 gga-let-7f-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence acccauggggcucaguucuucag MIMAT0026529 gga-miR-146a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ccucuuucccuguugcacuacu MIMAT0026530 gga-miR-130b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ucugacaauguugcacuacu MIMAT0026531 gga-miR-301a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence gcccuuuuucuguuguacuacu MIMAT0026532 gga-miR-130a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence caucuuacuagacagugcugga MIMAT0026533 gga-miR-200a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ucuuacugggcagcauugga MIMAT0026534 gga-miR-200b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence caaucagcaaguauacugcccua MIMAT0026535 gga-miR-34a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence acauacuucuucauaugcccaua MIMAT0026536 gga-miR-1b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence gcugguaaaaaggaaccagauc MIMAT0026537 gga-miR-133c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uuucagucggauguuuacagc MIMAT0026538 gga-miR-30e-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence aagcuuguaucuauagguaug MIMAT0026539 gga-miR-100-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence aaucacuaaauucacugccauc MIMAT0026540 gga-miR-34b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence aaucacuaaccacacagccagg MIMAT0026541 gga-miR-34c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence cuauacagucuauugccuuccu MIMAT0026542 gga-let-7j-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence cuauacaaucuacugucuuucc MIMAT0026543 gga-let-7k-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ccgauuucucuugguguucag MIMAT0026544 gga-miR-29c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ucgguuaucaugguaccggugcu MIMAT0026545 gga-miR-101-1-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ggguuccuggcaugaugauuu MIMAT0026546 gga-miR-23b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence agagcuuagcugauuggugaaca MIMAT0026547 gga-miR-27b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence gugccuacugagcugauaucagu MIMAT0026548 gga-miR-24-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ugcuaugccaacauauugucauc MIMAT0026549 gga-miR-31-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence aacgccauuaucacacuaaaua MIMAT0026550 gga-miR-122-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence acuguaaugugggcacuuacag MIMAT0026551 gga-miR-20b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uacggugagccugucauuauuc MIMAT0026554 hsa-miR-433-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gagguuuucuggguuucuguuuc MIMAT0026555 hsa-miR-329-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggucgaccaguuggaaaguaau MIMAT0026557 hsa-miR-412-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agguugucugugaugaguucg MIMAT0026558 hsa-miR-410-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gugguuaucccugcuguguucg MIMAT0026559 hsa-miR-487a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggucguaugugugacgccauuu MIMAT0026605 hsa-miR-489-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aauguguagcaaaagacaga MIMAT0026606 hsa-miR-511-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agguuguccguguugucuucucu MIMAT0026607 hsa-miR-494-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccaccgggggaugaaugucac MIMAT0026608 hsa-miR-181d-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccucuaaagggaagcgcuuucu MIMAT0026609 hsa-miR-520f-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccuccaaagggaagcgcuuucuguu MIMAT0026610 hsa-miR-519d-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucuagaggaagcacuuucuguuu MIMAT0026611 hsa-miR-520g-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gggagugcagggcaggguuuc MIMAT0026612 hsa-miR-504-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auugaaaccucuaagagugga MIMAT0026613 hsa-miR-510-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gugguuaucccuguccuguucg MIMAT0026614 hsa-miR-487b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence guuuaaccuuuugccuguugg MIMAT0026615 hsa-miR-552-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucgcgguuugugccagaugacg MIMAT0026616 hsa-miR-579-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaaugauucaucagacucagau MIMAT0026617 hsa-miR-580-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuagcacacagauacgcccaga MIMAT0026618 hsa-miR-585-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugguucucuuguggcucaagcgu MIMAT0026619 hsa-miR-597-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcggugaucccgauggugugagc MIMAT0026620 hsa-miR-598-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agaaggcacuaugagauuuaga MIMAT0026621 hsa-miR-605-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcugggauuacaggcaugagcc MIMAT0026622 hsa-miR-619-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucuuuucuuugagacucacu MIMAT0026623 hsa-miR-627-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaggaaaguguauccuaaaag MIMAT0026624 hsa-miR-651-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uucacuggaguuuguuucaaua MIMAT0026625 hsa-miR-653-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agagguuauccguguuauguuc MIMAT0026626 hsa-miR-655-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agguugccugugagguguuca MIMAT0026627 hsa-miR-656-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence cgggguuuugggggcgagauga MIMAT0026629 gga-miR-193b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence gagggacuuuugggggcagaugu MIMAT0026630 gga-miR-365-1-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ccacagcacugccuggucaga MIMAT0026631 gga-miR-383-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uggucguauguaugacgucauu MIMAT0026632 gga-miR-489-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ccauggaucuccaggugggu MIMAT0026633 gga-miR-490-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence aacaucacuuuaagucugugcu MIMAT0026634 gga-miR-499-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ugucuuaccaggcaaaguuaga MIMAT0026635 gga-miR-429-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugcgccucgggugagcaug MIMAT0026636 hsa-miR-668-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaguggggcuucgacccuaacc MIMAT0026637 hsa-miR-1296-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agcaaaauaagcaaauggaaaa MIMAT0026638 hsa-miR-1468-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cgcucuaggcaccgcagca MIMAT0026639 hsa-miR-1301-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuuccucauauucauucagga MIMAT0026640 hsa-miR-670-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caucugggcaacugacugaac MIMAT0026641 hsa-miR-1298-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence caacaacagucgguaggcuguc MIMAT0026643 gga-miR-21-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ggauaucaucauauacuguaag MIMAT0026644 gga-miR-144-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aguggcacauguuuguugugag MIMAT0026717 hsa-miR-891a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cggccccacgcaccaggguaaga MIMAT0026718 hsa-miR-874-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aauggcuguccguaguaugguc MIMAT0026719 hsa-miR-889-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuugggagcccuguuagacuc MIMAT0026720 hsa-miR-887-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acacacuuacccguagagauucua MIMAT0026721 hsa-miR-216b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aagcuuuuugcucgaauuaugu MIMAT0026722 hsa-miR-208b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cacauggccgaaacagagaagu MIMAT0026734 hsa-miR-942-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggacccacccggccgggaaua MIMAT0026735 hsa-miR-1180-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caaaagcaaucgcgguuuuugc MIMAT0026736 hsa-miR-548e-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caaaaacugcauuacuuuugc MIMAT0026737 hsa-miR-548j-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cucuagccacagaugcagugau MIMAT0026738 hsa-miR-1287-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugcaaaaguaaucacaguuuuu MIMAT0026739 hsa-miR-548f-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acauuuuccagcccauuca MIMAT0026740 hsa-miR-1250-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cgcuuugcucagccaguguag MIMAT0026741 hsa-miR-1251-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cccuguucuaugcccugaggga MIMAT0026742 hsa-miR-1266-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcagaucaggacuguaacucacc MIMAT0026743 hsa-miR-1288-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caaaugagcuuaauuuccuuuu MIMAT0026744 hsa-miR-1252-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaugucaccuuuuugagagga MIMAT0026749 hsa-miR-513b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence accaccuccccugcaaacguccagu MIMAT0026763 gga-miR-1306-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agcuguaauuagucaguuuucu MIMAT0026765 hsa-miR-1537-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ccaguauugcauugcugcuuua MIMAT0026786 gga-miR-16c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ugggucuuugcgggcgagauga MIMAT0026787 gga-miR-193a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccggccgccggcuccgccccg MIMAT0026916 hsa-miR-1908-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaggcagaagcaggaugaca MIMAT0026917 hsa-miR-1910-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcccucugucaccuugcagacg MIMAT0026921 hsa-miR-2276-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccugaucccacagcccaccu MIMAT0027026 hsa-miR-3151-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cucugaucgcccucucagcuc MIMAT0027027 hsa-miR-3192-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcacccaggcaaggauucug MIMAT0027032 hsa-miR-500b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auguccauauuauggguuagu MIMAT0027036 hsa-miR-3912-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugaagcucuaagguuccgccugc MIMAT0027037 hsa-miR-3928-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggggagcggcccccggguggg MIMAT0027038 hsa-miR-1343-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucccuucuuccugggcccuca MIMAT0027041 hsa-miR-5088-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugccaaccgucagagcccaga MIMAT0027088 hsa-miR-5189-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugccccaacaaggaaggacaag MIMAT0027103 hsa-miR-5699-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uuugcaguaacagguguggaca MIMAT0027343 mmu-miR-6516-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ucauguaugauacugcaaacag MIMAT0027344 mmu-miR-6516-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuccagcccugguaggcgccgcg MIMAT0027345 hsa-miR-6720-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cgggagcuggggucugcaggu MIMAT0027353 hsa-miR-6726-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cucgcccugucucccgcuag MIMAT0027354 hsa-miR-6726-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cucggggcaggcggcugggagcg MIMAT0027355 hsa-miR-6727-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uccugccaccuccuccgcag MIMAT0027356 hsa-miR-6727-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uugggaugguaggaccagagggg MIMAT0027357 hsa-miR-6728-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucucugcucugcucuccccag MIMAT0027358 hsa-miR-6728-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugggcgagggcggcugagcggc MIMAT0027359 hsa-miR-6729-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucaucccccucgcccucucag MIMAT0027360 hsa-miR-6729-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agaaagguggagggguugucaga MIMAT0027361 hsa-miR-6730-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccugacaccccaucugcccuca MIMAT0027362 hsa-miR-6730-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugggagagcaggguauugugga MIMAT0027363 hsa-miR-6731-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucuauuccccacucuccccag MIMAT0027364 hsa-miR-6731-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaggggguggcaggcuggcc MIMAT0027365 hsa-miR-6732-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaacccuguccucucccucccag MIMAT0027366 hsa-miR-6732-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugggaaagacaaacucagaguu MIMAT0027367 hsa-miR-6733-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucagugucuggauuuccuag MIMAT0027368 hsa-miR-6733-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uugaggggagaaugagguggaga MIMAT0027369 hsa-miR-6734-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cccuucccucacucuucucucag MIMAT0027370 hsa-miR-6734-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cagggcagagggcacaggaaucuga MIMAT0027371 hsa-miR-6735-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggccuguggcuccucccucag MIMAT0027372 hsa-miR-6735-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cugggugagggcaucuguggu MIMAT0027373 hsa-miR-6736-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucagcuccucucuacccacag MIMAT0027374 hsa-miR-6736-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uugggguggucggcccuggag MIMAT0027375 hsa-miR-6737-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucugugcuucaccccuacccag MIMAT0027376 hsa-miR-6737-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cgagggguagaagagcacagggg MIMAT0027377 hsa-miR-6738-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuucugccugcauucuacucccag MIMAT0027378 hsa-miR-6738-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugggaaagagaaagaacaagua MIMAT0027379 hsa-miR-6739-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auuguucugucuuucucccag MIMAT0027380 hsa-miR-6739-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aguuugggauggagagaggaga MIMAT0027381 hsa-miR-6740-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugucuucucuccucccaaacag MIMAT0027382 hsa-miR-6740-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gugggugcuggugggagccgug MIMAT0027383 hsa-miR-6741-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucggcucucucccucacccuag MIMAT0027384 hsa-miR-6741-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aguggggugggacccagcuguu MIMAT0027385 hsa-miR-6742-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence accuggguuguccccucuag MIMAT0027386 hsa-miR-6742-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaggggcagggacggguggccc MIMAT0027387 hsa-miR-6743-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agccgcucuucucccugcccaca MIMAT0027388 hsa-miR-6743-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggaugacaguggaggccu MIMAT0027389 hsa-miR-6744-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gggccucucuugucauccugcag MIMAT0027390 hsa-miR-6744-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggguggaagaaggucugguu MIMAT0027391 hsa-miR-6745 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccgggagaaggagguggccugg MIMAT0027392 hsa-miR-6746-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cagccgccgccugucuccacag MIMAT0027393 hsa-miR-6746-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agggguguggaaagaggcagaaca MIMAT0027394 hsa-miR-6747-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uccugccuuccucugcaccag MIMAT0027395 hsa-miR-6747-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugugggugggaaggacuggauu MIMAT0027396 hsa-miR-6748-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uccugucccugucuccuacag MIMAT0027397 hsa-miR-6748-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucgggccugggguugggggagc MIMAT0027398 hsa-miR-6749-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuccuccccugccuggcccag MIMAT0027399 hsa-miR-6749-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cagggaacagcugggugagcugcu MIMAT0027400 hsa-miR-6750-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaacucacccucugcucccag MIMAT0027401 hsa-miR-6750-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uugggggugagguuggugucugg MIMAT0027402 hsa-miR-6751-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acugagccucucucucuccag MIMAT0027403 hsa-miR-6751-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gggggguguggagccagggggc MIMAT0027404 hsa-miR-6752-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucccugcccccauacucccag MIMAT0027405 hsa-miR-6752-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caccagggcagagcagggcuga MIMAT0027406 hsa-miR-6753-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggucugucucugcccuggcac MIMAT0027407 hsa-miR-6753-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccagggaggcugguuuggagga MIMAT0027408 hsa-miR-6754-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucuucaccugccucugccugca MIMAT0027409 hsa-miR-6754-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaggguagacacugacaacguu MIMAT0027410 hsa-miR-6755-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uguugucauguuuuuucccuag MIMAT0027411 hsa-miR-6755-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggguggggcuggagguggggcu MIMAT0027412 hsa-miR-6756-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uccccuuccucccugcccag MIMAT0027413 hsa-miR-6756-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uagggaugggaggccaggauga MIMAT0027414 hsa-miR-6757-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aacacuggccuugcuaucccca MIMAT0027415 hsa-miR-6757-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uagagaggggaaggaugugaugu MIMAT0027416 hsa-miR-6758-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acucauucuccucuguccag MIMAT0027417 hsa-miR-6758-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uugugggugggcagaagucugu MIMAT0027418 hsa-miR-6759-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugaccuuugccucuccccucag MIMAT0027419 hsa-miR-6759-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cagggagaagguggaagugcaga MIMAT0027420 hsa-miR-6760-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acacuguccccuucuccccag MIMAT0027421 hsa-miR-6760-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucugagagagcucgauggcag MIMAT0027422 hsa-miR-6761-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uccuacgcugcucucucacucc MIMAT0027423 hsa-miR-6761-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cggggccauggagcagccugugu MIMAT0027424 hsa-miR-6762-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggcugcuucccuuggucuccag MIMAT0027425 hsa-miR-6762-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuggggaguggcuggggag MIMAT0027426 hsa-miR-6763-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuccccggccucugcccccag MIMAT0027427 hsa-miR-6763-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucccagggucuggucagaguug MIMAT0027428 hsa-miR-6764-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucucuggucuuuccuugacag MIMAT0027429 hsa-miR-6764-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gugaggcggggccaggagggugugu MIMAT0027430 hsa-miR-6765-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucaccuggcuggcccgcccag MIMAT0027431 hsa-miR-6765-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cgggugggagcagaucuuauugag MIMAT0027432 hsa-miR-6766-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugauugucuucccccacccuca MIMAT0027433 hsa-miR-6766-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucgcagacagggacacauggaga MIMAT0027434 hsa-miR-6767-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccacgugcuucucuuuccgcag MIMAT0027435 hsa-miR-6767-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cacacaggaaaagcggggcccug MIMAT0027436 hsa-miR-6768-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caaaggccacauucuccugugcac MIMAT0027437 hsa-miR-6768-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agguggguauggaggagcccu MIMAT0027438 hsa-miR-6769a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gagccccucucugcucuccag MIMAT0027439 hsa-miR-6769a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugagaaggcacagcuugcacguga MIMAT0027440 hsa-miR-6770-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuggcggcugugucuucacag MIMAT0027441 hsa-miR-6770-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cucgggagggcaugggccaggc MIMAT0027442 hsa-miR-6771-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caaaccccugucuacccgcag MIMAT0027443 hsa-miR-6771-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggguguaggcuggagcugagg MIMAT0027444 hsa-miR-6772-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uugcuccugacucugugcccaca MIMAT0027445 hsa-miR-6772-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uugggcccaggaguaaacaggau MIMAT0027446 hsa-miR-6773-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acugucacuucucugcccauag MIMAT0027447 hsa-miR-6773-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acuugggcaggagggacccuguaug MIMAT0027448 hsa-miR-6774-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucgugucccucuuguccacag MIMAT0027449 hsa-miR-6774-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucggggcaugggggagggaggcugg MIMAT0027450 hsa-miR-6775-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggcccuguccucugccccag MIMAT0027451 hsa-miR-6775-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucugggugcaguggggguu MIMAT0027452 hsa-miR-6776-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caaccaccacugucucuccccag MIMAT0027453 hsa-miR-6776-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acggggagucaggcaguggugga MIMAT0027454 hsa-miR-6777-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uccacucuccuggcccccag MIMAT0027455 hsa-miR-6777-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agugggaggacaggaggcaggu MIMAT0027456 hsa-miR-6778-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugccucccugacauuccacag MIMAT0027457 hsa-miR-6778-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cugggaggggcuggguuuggc MIMAT0027458 hsa-miR-6779-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aagcccugucuccucccaucu MIMAT0027459 hsa-miR-6779-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uugggagggaagacagcuggaga MIMAT0027460 hsa-miR-6780a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuccucuguuuucuuuccuag MIMAT0027461 hsa-miR-6780a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cgggccggaggucaagggcgu MIMAT0027462 hsa-miR-6781-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugccucuuuuccacggccucag MIMAT0027463 hsa-miR-6781-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaggggugggggaauucaggggugu MIMAT0027464 hsa-miR-6782-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caccuuuguguccccauccugca MIMAT0027465 hsa-miR-6782-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaggggaaaaguccugauccgg MIMAT0027466 hsa-miR-6783-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuccugggcuucuccucuguag MIMAT0027467 hsa-miR-6783-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gccggggcuuugggugaggg MIMAT0027468 hsa-miR-6784-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucucaccccaacucugccccag MIMAT0027469 hsa-miR-6784-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugggagggcguggaugauggug MIMAT0027470 hsa-miR-6785-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acaucgccccaccuuccccag MIMAT0027471 hsa-miR-6785-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcgguggggccggaggggcgu MIMAT0027472 hsa-miR-6786-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugacgccccuucugauucugccu MIMAT0027473 hsa-miR-6786-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggcggggguagagcuggcugc MIMAT0027474 hsa-miR-6787-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucucagcugcugcccucuccag MIMAT0027475 hsa-miR-6787-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cugggagaagaguggugaaga MIMAT0027476 hsa-miR-6788-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uucgccacuucccucccugcag MIMAT0027477 hsa-miR-6788-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence guaggggcgucccgggcgcgcggg MIMAT0027478 hsa-miR-6789-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cggcgcccgugucuccuccag MIMAT0027479 hsa-miR-6789-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gugaguguggauuuggcgggguu MIMAT0027480 hsa-miR-6790-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cgaccucggcgaccccucacu MIMAT0027481 hsa-miR-6790-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccccuggggcugggcaggcgga MIMAT0027482 hsa-miR-6791-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugccuccuuggucuccggcag MIMAT0027483 hsa-miR-6791-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence guaagcaggggcucuggguga MIMAT0027484 hsa-miR-6792-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuccuccacagccccugcucau MIMAT0027485 hsa-miR-6792-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uguggguucuggguugggguga MIMAT0027486 hsa-miR-6793-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uccccaaccccugcccgcag MIMAT0027487 hsa-miR-6793-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cagggggacugggggugagc MIMAT0027488 hsa-miR-6794-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cucacucucagucccucccu MIMAT0027489 hsa-miR-6794-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggggggacaggaugagaggcugu MIMAT0027490 hsa-miR-6795-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence accccucguuucuucccccag MIMAT0027491 hsa-miR-6795-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uugugggguuggagagcuggcug MIMAT0027492 hsa-miR-6796-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaagcucuccccuccccgcag MIMAT0027493 hsa-miR-6796-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggagggaaggggcugagaacagga MIMAT0027494 hsa-miR-6797-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugcaugacccuucccuccccac MIMAT0027495 hsa-miR-6797-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccagggggaugggcgagcuuggg MIMAT0027496 hsa-miR-6798-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuaccccccaucccccuguag MIMAT0027497 hsa-miR-6798-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggggaggugugcagggcugg MIMAT0027498 hsa-miR-6799-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugcccugcaugguguccccacag MIMAT0027499 hsa-miR-6799-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence guaggugacagucaggggcgg MIMAT0027500 hsa-miR-6800-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caccucuccuggcaucgcccc MIMAT0027501 hsa-miR-6800-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggucagaggcagcaggaaauga MIMAT0027502 hsa-miR-6801-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence accccugccacucacuggcc MIMAT0027503 hsa-miR-6801-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuagguggggggcuugaagc MIMAT0027504 hsa-miR-6802-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uucaccccucucaccuaagcag MIMAT0027505 hsa-miR-6802-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuggggguggggggcugggcgu MIMAT0027506 hsa-miR-6803-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucccucgccuucucacccucag MIMAT0027507 hsa-miR-6803-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugagggugucagcaggugacg MIMAT0027508 hsa-miR-6804-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cgcaccugccucucacccacag MIMAT0027509 hsa-miR-6804-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uagggggcggcuuguggagugu MIMAT0027510 hsa-miR-6805-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uugcucugcucccccgcccccag MIMAT0027511 hsa-miR-6805-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uguaggcaugaggcagggcccagg MIMAT0027512 hsa-miR-6806-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugaagcucugacauuccugcag MIMAT0027513 hsa-miR-6806-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gugagccaguggaauggagagg MIMAT0027514 hsa-miR-6807-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cacugcauuccugcuuggcccag MIMAT0027515 hsa-miR-6807-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caggcagggaggugggaccaug MIMAT0027516 hsa-miR-6808-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gugugaccaccguuccugcag MIMAT0027517 hsa-miR-6808-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggcaaggaaagaagaggauca MIMAT0027518 hsa-miR-6809-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuucucuucucuccuucccag MIMAT0027519 hsa-miR-6809-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auggggacagggaucagcauggc MIMAT0027520 hsa-miR-6810-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uccccugcucccuuguuccccag MIMAT0027521 hsa-miR-6810-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence augcaggccuguguacagcacu MIMAT0027522 hsa-miR-6811-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agccugugcuugucccugcag MIMAT0027523 hsa-miR-6811-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auggggugagauggggaggagcagc MIMAT0027524 hsa-miR-6812-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccgcucuuccccugaccccag MIMAT0027525 hsa-miR-6812-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caggggcugggguuucagguucu MIMAT0027526 hsa-miR-6813-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaccuuggccccucuccccag MIMAT0027527 hsa-miR-6813-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucccaagggugagaugcugcca MIMAT0027528 hsa-miR-6814-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acucgcauccuucccuuggcag MIMAT0027529 hsa-miR-6814-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uagguggcgccggaggagucauu MIMAT0027530 hsa-miR-6815-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggcuucucuugcacacccag MIMAT0027531 hsa-miR-6815-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggggcggggcaggucccugc MIMAT0027532 hsa-miR-6816-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaaggaccugcaccuucg MIMAT0027533 hsa-miR-6816-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucugccauaggaagcuuggagugg MIMAT0027534 hsa-miR-6817-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucucucugacuccauggca MIMAT0027535 hsa-miR-6817-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uugugugaguacagagagcauc MIMAT0027536 hsa-miR-6818-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uugucucuuguuccucacacag MIMAT0027537 hsa-miR-6818-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uugggguggagggccaaggagc MIMAT0027538 hsa-miR-6819-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aagccucuguccccaccccag MIMAT0027539 hsa-miR-6819-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugcggcagagcugggguca MIMAT0027540 hsa-miR-6820-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugugacuucuccccugccacag MIMAT0027541 hsa-miR-6820-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gugcgugguggcucgaggcgggg MIMAT0027542 hsa-miR-6821-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugaccucuccgcuccgcacag MIMAT0027543 hsa-miR-6821-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cagggaaccaguuggggcuu MIMAT0027544 hsa-miR-6822-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggcucuaacuggcuuucccugca MIMAT0027545 hsa-miR-6822-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucaggguugguagggguugcu MIMAT0027546 hsa-miR-6823-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugagccucuccuucccuccag MIMAT0027547 hsa-miR-6823-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence guaggggagguugggccaggga MIMAT0027548 hsa-miR-6824-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucucuggucuugccaccccag MIMAT0027549 hsa-miR-6824-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggggagguguggagucagcau MIMAT0027550 hsa-miR-6825-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcgcugacccgccuucuccgca MIMAT0027551 hsa-miR-6825-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucaauaggaaagaggugggaccu MIMAT0027552 hsa-miR-6826-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuccccucucuuuccuguucag MIMAT0027553 hsa-miR-6826-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugggagccaugagggucugugc MIMAT0027554 hsa-miR-6827-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence accgucucuucuguuccccag MIMAT0027555 hsa-miR-6827-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggaagcaagagaacccugugg MIMAT0027556 hsa-miR-6828-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aucugcucucuuguucccag MIMAT0027557 hsa-miR-6828-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugggcugcugagaaggggca MIMAT0027558 hsa-miR-6829-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugccuccuccguggccucag MIMAT0027559 hsa-miR-6829-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccaaggaaggaggcuggacauc MIMAT0027560 hsa-miR-6830-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugucuuucuucucucccuugcag MIMAT0027561 hsa-miR-6830-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uagguagagugugaggaggagguc MIMAT0027562 hsa-miR-6831-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugacuaacucccacucuacag MIMAT0027563 hsa-miR-6831-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aguagagaggaaaaguuaggguc MIMAT0027564 hsa-miR-6832-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acccuuuuucucuuucccag MIMAT0027565 hsa-miR-6832-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence guguggaagaugggaggagaaa MIMAT0027566 hsa-miR-6833-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuucucucuccacuuccucag MIMAT0027567 hsa-miR-6833-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gugagggacugggauuugugg MIMAT0027568 hsa-miR-6834-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaugucccaucccuccauca MIMAT0027569 hsa-miR-6834-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggggguagaaaguggcugaag MIMAT0027570 hsa-miR-6835-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaagcacuuuucugucucccag MIMAT0027571 hsa-miR-6835-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggggaaggcuuggcagggaaga MIMAT0027572 hsa-miR-6780b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucccuugucuccuuucccuag MIMAT0027573 hsa-miR-6780b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cgcagggcccuggcgcaggcau MIMAT0027574 hsa-miR-6836-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence augccucccccggccccgcag MIMAT0027575 hsa-miR-6836-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence accagggccagcagggaaugu MIMAT0027576 hsa-miR-6837-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccuucacugugacucugcugcag MIMAT0027577 hsa-miR-6837-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aagcagcaguggcaagacuccu MIMAT0027578 hsa-miR-6838-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaguccugcuucuguugcag MIMAT0027579 hsa-miR-6838-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucuggauugaagagacgaccca MIMAT0027580 hsa-miR-6839-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuggguuuucucuucaauccag MIMAT0027581 hsa-miR-6839-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acccccgggcaaagaccugcagau MIMAT0027582 hsa-miR-6840-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcccaggacuuugugcggggug MIMAT0027583 hsa-miR-6840-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaggguacucagagcaaguugu MIMAT0027584 hsa-miR-6841-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence accuugcaucugcauccccag MIMAT0027585 hsa-miR-6841-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggggguggucucuagccaagg MIMAT0027586 hsa-miR-6842-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuggcuggucucugcuccgcag MIMAT0027587 hsa-miR-6842-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auggucuccuguucucugcag MIMAT0027588 hsa-miR-6843-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uucuuuguuuuuaauucacag MIMAT0027589 hsa-miR-6844 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cggggccagagcagagagc MIMAT0027590 hsa-miR-6845-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccucuccucccugugccccag MIMAT0027591 hsa-miR-6845-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugggggcuggaugggguagagu MIMAT0027592 hsa-miR-6846-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugaccccuucugucucccuag MIMAT0027593 hsa-miR-6846-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acagaggacaguggagugugagc MIMAT0027594 hsa-miR-6847-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggcucaugugucuguccucuuc MIMAT0027595 hsa-miR-6847-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugggggcugggaugggccauggu MIMAT0027596 hsa-miR-6848-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence guggucucuuggcccccag MIMAT0027597 hsa-miR-6848-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaguggauaggggagugugugga MIMAT0027598 hsa-miR-6849-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence accagccuguguccaccuccag MIMAT0027599 hsa-miR-6849-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gugcggaacgcuggccggggcg MIMAT0027600 hsa-miR-6850-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cccggccggaacgccgcacu MIMAT0027601 hsa-miR-6850-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggaggugguacuaggggccagc MIMAT0027602 hsa-miR-6851-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggcccuuuguaccccuccag MIMAT0027603 hsa-miR-6851-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cccugggguucugaggacaug MIMAT0027604 hsa-miR-6852-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uguccucuguuccucag MIMAT0027605 hsa-miR-6852-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agcgugggauguccaugaagucag MIMAT0027606 hsa-miR-6853-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uguucauuggaacccugcgcag MIMAT0027607 hsa-miR-6853-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aagcucagguuugagaacugcuga MIMAT0027608 hsa-miR-6854-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugcguuucuccucuugagcag MIMAT0027609 hsa-miR-6854-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uugggguuuggggugcagacauugc MIMAT0027610 hsa-miR-6855-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agacugaccuucaaccccacag MIMAT0027611 hsa-miR-6855-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aagagaggagcaguggugcugugg MIMAT0027612 hsa-miR-6856-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uacagcccugugaucuuuccag MIMAT0027613 hsa-miR-6856-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuggggauugggucaggccagu MIMAT0027614 hsa-miR-6857-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugacugagcuucuccccacag MIMAT0027615 hsa-miR-6857-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gugaggaggggcuggcagggac MIMAT0027616 hsa-miR-6858-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cagccagccccugcucaccccu MIMAT0027617 hsa-miR-6858-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gagaggaacaugggcucaggaca MIMAT0027618 hsa-miR-6859-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugacccccaugucgccucuguag MIMAT0027619 hsa-miR-6859-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugguggguggggaggagaagugc MIMAT0027620 hsa-miR-6769b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cccucucugucccacccauag MIMAT0027621 hsa-miR-6769b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acugggcagggcuguggugagu MIMAT0027622 hsa-miR-6860 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acuggguagguggggcuccagg MIMAT0027623 hsa-miR-6861-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggaccucuccuccccag MIMAT0027624 hsa-miR-6861-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cgggcaugcugggagagacuuu MIMAT0027625 hsa-miR-6862-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccucacccagcucucuggcccucu MIMAT0027626 hsa-miR-6862-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uagacguggugaaggauugagug MIMAT0027627 hsa-miR-6863 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uugaagggacaagucagauaugcc MIMAT0027628 hsa-miR-6864-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gugagacuucucucccuucag MIMAT0027629 hsa-miR-6864-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uagguggcagaggagggacuuca MIMAT0027630 hsa-miR-6865-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acacccucuuucccuaccgcc MIMAT0027631 hsa-miR-6865-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuagaggcuggaauagagauucu MIMAT0027632 hsa-miR-6866-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaucccuuuaucuguccucuag MIMAT0027633 hsa-miR-6866-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uguguguguagaggaagaaggga MIMAT0027634 hsa-miR-6867-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cucucccucuuuacccacuag MIMAT0027635 hsa-miR-6867-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acuggcagaacacugaagcagc MIMAT0027636 hsa-miR-6868-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuccuucuguugucugugcag MIMAT0027637 hsa-miR-6868-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gugaguaguggcgcgcggcggc MIMAT0027638 hsa-miR-6869-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cgccgcgcgcaucggcucagc MIMAT0027639 hsa-miR-6869-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugggggagauggggguuga MIMAT0027640 hsa-miR-6870-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcucauccccaucuccuuucag MIMAT0027641 hsa-miR-6870-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caugggaguucggggugguugc MIMAT0027642 hsa-miR-6871-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cagcacccuguggcucccacag MIMAT0027643 hsa-miR-6871-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucucgcaucaggaggcaagg MIMAT0027644 hsa-miR-6872-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cccaugccuccugccgcgguc MIMAT0027645 hsa-miR-6872-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cagagggaauacagagggcaau MIMAT0027646 hsa-miR-6873-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uucucucugucuuucucucucag MIMAT0027647 hsa-miR-6873-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auggagcuggaaccagaucaggc MIMAT0027648 hsa-miR-6874-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caguucugcuguucugacucuag MIMAT0027649 hsa-miR-6874-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugagggacccaggacaggaga MIMAT0027650 hsa-miR-6875-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auucuuccugcccuggcuccau MIMAT0027651 hsa-miR-6875-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caggaaggagacaggcaguuca MIMAT0027652 hsa-miR-6876-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agcugucuguguuuuccuucucag MIMAT0027653 hsa-miR-6876-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agggccgaaggguggaagcugc MIMAT0027654 hsa-miR-6877-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cagccucugcccuuggccucc MIMAT0027655 hsa-miR-6877-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agggagaaagcuagaagcugaag MIMAT0027656 hsa-miR-6878-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuggccucuucuuucuccuag MIMAT0027657 hsa-miR-6878-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cagggcagggaaggugggagag MIMAT0027658 hsa-miR-6879-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugucacccgcuccuugcccag MIMAT0027659 hsa-miR-6879-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugguggaggaagagggcagcuc MIMAT0027660 hsa-miR-6880-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccgccuucucuccucccccag MIMAT0027661 hsa-miR-6880-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugggguaaggauaggaggguca MIMAT0027662 hsa-miR-6881-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auccucuuucguccuucccacu MIMAT0027663 hsa-miR-6881-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uacaagucaggagcugaagcag MIMAT0027664 hsa-miR-6882-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugcugccucuccucuugccugcag MIMAT0027665 hsa-miR-6882-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agggagggugugguauggaugu MIMAT0027666 hsa-miR-6883-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uucccuaucucacucuccucag MIMAT0027667 hsa-miR-6883-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agaggcugagaaggugauguug MIMAT0027668 hsa-miR-6884-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cccaucaccuuuccgucuccccu MIMAT0027669 hsa-miR-6884-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggggggcacugcgcaagcaaagcc MIMAT0027670 hsa-miR-6885-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuuugcuuccugcuccccuag MIMAT0027671 hsa-miR-6885-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cccgcaggugagaugagggcu MIMAT0027672 hsa-miR-6886-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugcccuucucuccuccugccu MIMAT0027673 hsa-miR-6886-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggggggacagauggagaggaca MIMAT0027674 hsa-miR-6887-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uccccuccacuuuccuccuag MIMAT0027675 hsa-miR-6887-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaggagaugcucaggcagau MIMAT0027676 hsa-miR-6888-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aucugucucgauuguuuccag MIMAT0027677 hsa-miR-6888-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucggggagucugggguccggaau MIMAT0027678 hsa-miR-6889-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucugugccccuacuucccag MIMAT0027679 hsa-miR-6889-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caugggguagggcagaguagg MIMAT0027680 hsa-miR-6890-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccacugccuaugccccacag MIMAT0027681 hsa-miR-6890-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaaggagggggaugagggg MIMAT0027682 hsa-miR-6891-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cccucaucuuccccuccuuuc MIMAT0027683 hsa-miR-6891-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence guaagggaccggagaguagga MIMAT0027684 hsa-miR-6892-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucccucucccaccccuugcag MIMAT0027685 hsa-miR-6892-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caggcagguguaggguggagc MIMAT0027686 hsa-miR-6893-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cccugcugccuucaccugccag MIMAT0027687 hsa-miR-6893-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggaggauggagagcugggccaga MIMAT0027688 hsa-miR-6894-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uugccugcccucuuccuccag MIMAT0027689 hsa-miR-6894-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cagggccaggcacagaguaag MIMAT0027690 hsa-miR-6895-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugucucucgcccuuggccuuag MIMAT0027691 hsa-miR-6895-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugggaggaggggaucuuggg MIMAT0028109 hsa-miR-7106-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agcucccugaaucccugucccag MIMAT0028110 hsa-miR-7106-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucggccuggggaggaggaaggg MIMAT0028111 hsa-miR-7107-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggucuguucauucucucuuuuuggcc MIMAT0028112 hsa-miR-7107-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence guguggccggcaggcgggugg MIMAT0028113 hsa-miR-7108-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acccgcccgucuccccacag MIMAT0028114 hsa-miR-7108-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuggggggaggagacccugcu MIMAT0028115 hsa-miR-7109-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caagccucuccugcccuuccag MIMAT0028116 hsa-miR-7109-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggggguguggggagagagag MIMAT0028117 hsa-miR-7110-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucucucucccacuucccugcag MIMAT0028118 hsa-miR-7110-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugggggaggaaggacaggccau MIMAT0028119 hsa-miR-7111-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auccucucuucccuccucccag MIMAT0028120 hsa-miR-7111-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acgggcagggcagugcacccug MIMAT0028121 hsa-miR-7112-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugcaucacagccuuuggcccuag MIMAT0028122 hsa-miR-7112-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uccagggagacagugugugag MIMAT0028123 hsa-miR-7113-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccucccugcccgccucucugcag MIMAT0028124 hsa-miR-7113-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucuguggaguggggugccugu MIMAT0028125 hsa-miR-7114-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugacccaccccucuccaccag MIMAT0028126 hsa-miR-7114-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence ccaccuccccugcaaacgucca MIMAT0028210 dre-miR-1306 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuggcagggggagaggua MIMAT0028211 hsa-miR-7150 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gauccaucucugccuguauuggc MIMAT0028212 hsa-miR-7151-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuacaggcuggaaugggcuca MIMAT0028213 hsa-miR-7151-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuuccuguccuccaaccagacc MIMAT0028214 hsa-miR-7152-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucugguccuggacaggaggc MIMAT0028215 hsa-miR-7152-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugagaacugacaaaugugguagg MIMAT0028216 hsa-miR-7153-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caccauggacgguuuacc MIMAT0028217 hsa-miR-7153-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uucaugaacugggucuagcuugg MIMAT0028218 hsa-miR-7154-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggaggacaaguugugggau MIMAT0028219 hsa-miR-7154-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucuggggucuugggccauc MIMAT0028220 hsa-miR-7155-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggcccaagaccucagacc MIMAT0028221 hsa-miR-7155-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuguucucaaacuggcugucaga MIMAT0028222 hsa-miR-7156-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cugcagccacuuggggaacuggu MIMAT0028223 hsa-miR-7156-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucagcauucauuggcaccagaga MIMAT0028224 hsa-miR-7157-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucugugcuacuggaugaagagu MIMAT0028225 hsa-miR-7157-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggcucaaucucugguccugcagcc MIMAT0028226 hsa-miR-7158-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cugaacuagagauugggccca MIMAT0028227 hsa-miR-7158-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uucaacaaggguguaggaugg MIMAT0028228 hsa-miR-7159-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuucuauguuaguuggaag MIMAT0028229 hsa-miR-7159-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugcugagguccgggcugugcc MIMAT0028230 hsa-miR-7160-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cagggcccuggcuuuagcaga MIMAT0028231 hsa-miR-7160-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaaagacuguagaggcaacuggu MIMAT0028232 hsa-miR-7161-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uagaucuuugacucuggcagucuccagg MIMAT0028233 hsa-miR-7161-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugcuuccuuucucagcug MIMAT0028234 hsa-miR-7162-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucugagguggaacagcagc MIMAT0028235 hsa-miR-7162-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agaagggaagauggugac MIMAT0029310 hsa-miR-7515 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uugaucucggaagcuaagc MIMAT0029782 hsa-miR-7641 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence agauguccagccacaauucucg MIMAT0029806 mmu-miR-219b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence agaauugcguuuggacaaucagu MIMAT0029807 mmu-miR-219b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence gcuuuuugggguaagggcuucc MIMAT0029862 mmu-miR-129b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence caagcccagaccgcaaaaagauu MIMAT0029863 mmu-miR-129b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence acaggcaccacagguuugagcau MIMAT0029876 mmu-miR-6715-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ccaaaccaggcgugccugugg MIMAT0029877 mmu-miR-6715-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence auuauuacucacgguacgaguu MIMAT0029894 mmu-miR-126b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cgcguaccaaaaguaauaaugug MIMAT0029895 mmu-miR-126b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuuagacugccagacucccuga MIMAT0030017 hsa-miR-7702 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uugcacucuggccuucucccagg MIMAT0030018 hsa-miR-7703 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cggggucggcggcgacgug MIMAT0030019 hsa-miR-7704 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aauagcucagaaugucaguucug MIMAT0030020 hsa-miR-7705 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugaagcgccugugcucugccgaga MIMAT0030021 hsa-miR-7706 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uuaaugcuaauugugauaggggu MIMAT0030409 rno-miR-155-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cuccuaccuguuagcauuaac MIMAT0030410 rno-miR-155-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gagggcagagccagcuuccuga MIMAT0030411 hsa-miR-7843-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence augaagccuucucugccuuacg MIMAT0030412 hsa-miR-7843-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence augucccacccccacuccugu MIMAT0030413 hsa-miR-4433b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caggaguggggggugggacgu MIMAT0030414 hsa-miR-4433b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cugggaggucaaggcugcagu MIMAT0030415 hsa-miR-1273h-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cugcagacucgaccucccaggc MIMAT0030416 hsa-miR-1273h-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuugcaguaacaggugugagca MIMAT0030417 hsa-miR-6516-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aucauguaugauacugcaaaca MIMAT0030418 hsa-miR-6516-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaacuaggacuguguggugua MIMAT0030419 hsa-miR-7844-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aagggacagggagggucgugg MIMAT0030420 hsa-miR-7845-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cagcggagccuggagagaagg MIMAT0030421 hsa-miR-7846-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cguggaggacgaggaggaggc MIMAT0030422 hsa-miR-7847-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuacccucggucugcuuaccaca MIMAT0030423 hsa-miR-7848-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gacaauuguugaucuugggccu MIMAT0030424 hsa-miR-7849-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence guuuggacauaguguggcugg MIMAT0030425 hsa-miR-7850-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uaccugggagacugagguugga MIMAT0030426 hsa-miR-7851-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uauguaguagucaaaggcauuu MIMAT0030427 hsa-miR-7852-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucaaaugcagauccugacuuc MIMAT0030428 hsa-miR-7853-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugaggugaccgcagaugggaa MIMAT0030429 hsa-miR-7854-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuggugaggaccccaagcucgg MIMAT0030430 hsa-miR-7855-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uuuuaaggacacugagggauc MIMAT0030431 hsa-miR-7856-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cgggacuguagagggcaugagc MIMAT0030979 hsa-miR-8052 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uggcgauuuuggaacucaauggca MIMAT0030980 hsa-miR-8053 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaaaguacagaucggaugggu MIMAT0030981 hsa-miR-8054 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuuugagcacaugagcagacgga MIMAT0030982 hsa-miR-8055 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cguggauugucuggaugcau MIMAT0030983 hsa-miR-8056 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence guggcucuguaguaagaugga MIMAT0030984 hsa-miR-8057 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuggacuuugaucuugccauaa MIMAT0030985 hsa-miR-8058 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggggaacuguagaugaaaaggc MIMAT0030986 hsa-miR-8059 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccaugaagcaguggguaggaggac MIMAT0030987 hsa-miR-8060 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuuagauuagaggauauuguu MIMAT0030988 hsa-miR-8061 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cagugauuugaggauuauugc MIMAT0030989 hsa-miR-8062 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucaaaaucaggagucggggcuu MIMAT0030990 hsa-miR-8063 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agcacacugagcgagcggac MIMAT0030991 hsa-miR-8064 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uguaggaacaguugaauuuuggcu MIMAT0030992 hsa-miR-8065 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caaugugaucuuuuggaugua MIMAT0030993 hsa-miR-8066 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccuagaaacuguaaacuuaguc MIMAT0030994 hsa-miR-8067 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uguuuguuguaaggaucguugu MIMAT0030995 hsa-miR-8068 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggaugguugggggcggucggcgu MIMAT0030996 hsa-miR-8069 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence augugauugacggcugacucca MIMAT0030997 hsa-miR-8070 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cgguggacuggagugggugg MIMAT0030998 hsa-miR-8071 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggcggcggggagguaggcag MIMAT0030999 hsa-miR-8072 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence accuggcagcagggagcgucgu MIMAT0031000 hsa-miR-8073 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuauggcgagacuggcauguacuc MIMAT0031001 hsa-miR-8074 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugcugauggcagaugucgggucug MIMAT0031002 hsa-miR-8075 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uauauggacuuuucugauacaaug MIMAT0031003 hsa-miR-8076 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggcugagugggguucugacucc MIMAT0031004 hsa-miR-8077 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ggucuaggcccggugagagacuc MIMAT0031005 hsa-miR-8078 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cagugaucgucucugcuggc MIMAT0031006 hsa-miR-8079 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaaggacacuggugucaacggcu MIMAT0031007 hsa-miR-8080 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cuugagucgugccuuucugaaug MIMAT0031008 hsa-miR-8081 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugauggagcugggaauacucug MIMAT0031009 hsa-miR-8082 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caggacuugacggcugcaacu MIMAT0031010 hsa-miR-8083 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaauacuaaguaaaaaaucagua MIMAT0031011 hsa-miR-8084 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugggagagaggacugugaggc MIMAT0031012 hsa-miR-8085 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugcuagucuggacugauauggu MIMAT0031013 hsa-miR-8086 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gaagacuucuuggauuacagggg MIMAT0031014 hsa-miR-8087 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccucgguacuggaaaggggua MIMAT0031015 hsa-miR-8088 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccuggggacaggggauuggggcag MIMAT0031016 hsa-miR-8089 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence caagaacaucaaacuaccugau MIMAT0031017 gga-miR-196-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence auauagggauugaagccgugca MIMAT0031036 gga-miR-135a-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence cuguacaaccuccuagcuuucc MIMAT0031037 gga-let-7a-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence auguagggcgaaaagccauggg MIMAT0031038 gga-miR-135a-3-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ccaauauuauugugcugcuuaa MIMAT0031058 gga-miR-16-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ucacugaucaaugaaugcaaa MIMAT0031059 gga-miR-181b-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence uauuucacuacaccaggguu MIMAT0031069 gga-miR-138-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ucggcuucuuuacagugcugccuug MIMAT0031070 gga-miR-103-1-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence acauacuucuuuauaugcccaua MIMAT0031071 gga-miR-1a-1-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence agcugguuucacaugguggcuuaga MIMAT0031072 gga-miR-29b-2-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auuggggacauuuugcauucau MIMAT0031074 hsa-miR-450a-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence gagggacuuucaggggcagcugu MIMAT0031075 gga-miR-365-2-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ucaguuaucacagugcugaugcu MIMAT0031077 gga-miR-101-2-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gggggccgauacacuguacgaga MIMAT0031095 hsa-miR-128-2-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence cggggccguaacacugucugaga MIMAT0031096 gga-miR-128-1-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9031), with sequence ugggagaggauuguuuacgcc MIMAT0031105 gga-miR-30c-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccugagcccgggccgcgcag MIMAT0031119 hsa-miR-1199-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugcggccggugcucaaccugc MIMAT0031120 hsa-miR-1199-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ccugagcccaggccgcgcag MIMAT0031123 cfa-miR-1199-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ugcggccggugcucagccugc MIMAT0031124 cfa-miR-1199-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ucugaguccgggucgcgcgg MIMAT0031125 rno-miR-1199-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ugcggccggugcucagccggc MIMAT0031126 rno-miR-1199-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaagguaacugugauuuuugcu MIMAT0031175 hsa-miR-548ba A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugugacccuagaauaauuac MIMAT0031176 hsa-miR-7973 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggcugugaugcucuccugagccc MIMAT0031177 hsa-miR-7974 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence auccuagucacggcacca MIMAT0031178 hsa-miR-7975 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ugcccugagacuuuugcuc MIMAT0031179 hsa-miR-7976 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence uucccagccaacgcacca MIMAT0031180 hsa-miR-7977 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ucugguguauagcguugcuca MIMAT0031181 hsa-miR-7978 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence auggcucuuacugaagacuagcaguu MIMAT0031397 mmu-miR-1291 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence uccauaaaguaggaaacacu MIMAT0031402 mmu-miR-142b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence caccacagugugguuuggacgugg MIMAT0031404 mmu-miR-497b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence agugguucuuaacaguucaacaguu MIMAT0031890 hsa-miR-203a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence acauacuucuuuauaugcccau MIMAT0031892 hsa-miR-1-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cucacugaucaaugaaugca MIMAT0031893 hsa-miR-181b-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence acagauucgauucuaggggagu MIMAT0031919 dre-miR-10b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence cucacugaucaaugaaugcaaa MIMAT0031920 dre-miR-181b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence ugaauuaccaaagggccauaa MIMAT0031921 dre-miR-183-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence acaguaguccgcacauugguu MIMAT0031922 dre-miR-199-3-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence agugguucuuaacaguucaacagu MIMAT0031923 dre-miR-203a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence ggcugggaagucaaagggacgc MIMAT0031924 dre-miR-204-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence gauuucaguggugugaagugua MIMAT0031925 dre-miR-205-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence accuggcauacaauguagauuucugu MIMAT0031926 dre-miR-221-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence ugcucaguagucaguguagaucc MIMAT0031927 dre-miR-222a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence cuguacaaccuucuagcuuucc MIMAT0031930 dre-let-7c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence cuguacaaccuucuagcuuucc MIMAT0031931 dre-let-7d-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uaaagcuagagaaccgaaugua MIMAT0031932 dre-miR-9-4-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uaaagcuagagaaccgaaagua MIMAT0031933 dre-miR-9-7-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence caaauacgucucuacaggaau MIMAT0031934 dre-miR-10b-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence aaauucguaucuaggggagua MIMAT0031935 dre-miR-10c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence cgaaucaugaugugcugucacu MIMAT0031936 dre-miR-15b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uccaauauugcucgugcugcuga MIMAT0031937 dre-miR-16c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence acugcaguggaggcacuucaagc MIMAT0031938 dre-miR-17a-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence acugcaaugucugcacuucaagu MIMAT0031939 dre-miR-20b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence aguuuugcaggauugcauccgg MIMAT0031940 dre-miR-19c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence agcuuugcggggugggcagucagc MIMAT0031941 dre-miR-19d-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence aguucuucacuggcaagcuuua MIMAT0031942 dre-miR-22a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence cguucuucacuggcuagcuuua MIMAT0031943 dre-miR-22b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence gaauuccuggcagagugauuu MIMAT0031944 dre-miR-23a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence ggauuccuggcagagugauuu MIMAT0031945 dre-miR-23a-3-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence aggcggagacuugggcagcugcc MIMAT0031946 dre-miR-25-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence ccuauucgggaugacuugguuc MIMAT0031947 dre-miR-26a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence ccuauucaugauuacuugcacu MIMAT0031948 dre-miR-26a-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence aggacuuagcucacucugugaaca MIMAT0031949 dre-miR-27a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence agagcuuagcugauuggugaaca MIMAT0031950 dre-miR-27b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence cuuucagucugauguuugcugc MIMAT0031951 dre-miR-30a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence ccgggagugggauguuugcgcu MIMAT0031952 dre-miR-30c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence agguugggauugguagcaaugcu MIMAT0031953 dre-miR-92a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence agguugggaucggccgcaaugcu MIMAT0031954 dre-miR-92a-2-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence aggugugggauguugugcaguguu MIMAT0031955 dre-miR-92b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence caauuauguguagugccaauau MIMAT0031956 dre-miR-96-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence caagcuuguaucuauagguauc MIMAT0031957 dre-miR-100-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence caagcucgugucuauagguaug MIMAT0031958 dre-miR-100-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence agcuucuuuacaguguugucuug MIMAT0031959 dre-miR-107a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence cguguucacagcggaccuugau MIMAT0031960 dre-miR-124-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uguguucacaguggaccuugau MIMAT0031961 dre-miR-124-4-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence cguguucacggcggaccuugau MIMAT0031962 dre-miR-124-6-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence acggguuagguucuugggagcu MIMAT0031963 dre-miR-125b-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence cggguuggguucucgggagcu MIMAT0031964 dre-miR-125b-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence acagguuaagcucuugggaccu MIMAT0031965 dre-miR-125b-3-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence acgggucaggagcuugggagac MIMAT0031966 dre-miR-125c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence cggggccguggcacuguaugaga MIMAT0031967 dre-miR-128-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence gaagcccuuaccccaaaaagu MIMAT0031968 dre-miR-129-1-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence gcccuuuuucuguuguacuacu MIMAT0031969 dre-miR-130c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence agcugguaaaauggaaccaaa MIMAT0031970 dre-miR-133a-2-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence gcugguaaaacggaaccaaguc MIMAT0031971 dre-miR-133c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence acggguauucuuggguggauaaua MIMAT0031972 dre-miR-137-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence gcuauuucacaacaccagggu MIMAT0031973 dre-miR-138-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence caucuuaccugacagugcuugg MIMAT0031974 dre-miR-141-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence ggauaucaucguauacuguaagu MIMAT0031975 dre-miR-144-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence ggauuccuggaaauacuguucu MIMAT0031976 dre-miR-145-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence gucauuuuugugguuugcagcu MIMAT0031977 dre-miR-153b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence gucauuuuugugauguugcagcu MIMAT0031978 dre-miR-153a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence gucauuuuugugauuugcagcu MIMAT0031979 dre-miR-153c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence cucgccggacaaugaaugagaa MIMAT0031980 dre-miR-181c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence ugggucuuugcgggcaagguga MIMAT0031981 dre-miR-193a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence cgggacuuugggggcgagaug MIMAT0031982 dre-miR-193b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence cugcaacgugaaacugucuuaa MIMAT0031983 dre-miR-196a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence caucuuaccggacagugcugga MIMAT0031984 dre-miR-200a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence caucuuacgaggcagcauugga MIMAT0031985 dre-miR-200b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence caucuuacaaggcaguuuugga MIMAT0031986 dre-miR-200c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence gcugggacagcaaagggaggu MIMAT0031987 dre-miR-204-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence acaugcuuccuuauaugcccaua MIMAT0031988 dre-miR-206-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence ggaguuguggauggacaucacgc MIMAT0031989 dre-miR-219-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence gcuuugacgauguugcacuac MIMAT0031990 dre-miR-301b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence gcucugacgauguugcacuac MIMAT0031991 dre-miR-301c-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence cggguggaugacucugcaauuuu MIMAT0031992 dre-miR-363-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence augcaguccaugggcauauacac MIMAT0031993 dre-miR-455-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uccaguauugcuguucugcugu MIMAT0032004 dre-miR-457b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence auauagggauggaagccaugca MIMAT0032006 dre-miR-135b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence accaucgaccguugacuguacc MIMAT0032007 dre-miR-181a-2-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence uggggaggcagcgcuguuggaau MIMAT0032008 dre-miR-139-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence aacaucacuuuaagucugugcu MIMAT0032009 dre-miR-499-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_7955), with sequence aaucacuaaccucacuaccagg MIMAT0032011 dre-miR-34c-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence gcucugacgagguugcacuacu MIMAT0032026 hsa-miR-301b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aggagggaggagaugggccaaguu MIMAT0032029 hsa-miR-1249-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ucggggcagcucaguacaggau MIMAT0032036 cfa-miR-486-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence ccuccugaugauucuucuuc MIMAT0032110 hsa-miR-3653-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaaguaauugugguuuuug MIMAT0032114 hsa-miR-548ad-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaaguaauugugguuuuug MIMAT0032115 hsa-miR-548ae-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence accgccugcccaguga MIMAT0032116 hsa-miR-4485-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence cacacacacacacacacguau MIMAT0033692 hsa-miR-8485 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence acgcccuucccccccuucuuca MIMAT0034321 cfa-miR-1249 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uugcagcugccugggagugacuuca MIMAT0034337 cfa-miR-1301 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence cuccuggggcccgcacucucgcu MIMAT0034357 cfa-miR-1343 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence auauacagggggagacucuuau MIMAT0034383 cfa-miR-1185 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uuaauaucggacaaccauuguu MIMAT0034387 cfa-miR-889 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence cagauauugcacgguugaucucu MIMAT0034388 cfa-miR-3958 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uuugcaguaacaggugugaacauuc MIMAT0034393 cfa-miR-6516 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence cuauacgaccugcugccuuucuuag MIMAT0034396 cfa-let-7d A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence cugggaucucuggggucuugguu MIMAT0034400 cfa-miR-769 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence cagccaccacuacccugccacu MIMAT0034406 cfa-miR-449b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uuagggcccuggcuccaucuccuuu MIMAT0034413 cfa-miR-1296 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence auuggcacuuuuuugagugug MIMAT0034416 cfa-miR-507b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uacuugagagggugacauucauaga MIMAT0034419 cfa-miR-508a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uacucagggaggcgucauucacaua MIMAT0034422 cfa-miR-506 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence cuccguuugccuguuuugcugau MIMAT0034423 cfa-miR-1468 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence ugacugucaccuuuuuugaguaca MIMAT0034425 cfa-miR-508b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uagucccuuccuugaaggaucggc MIMAT0034427 cfa-miR-2114 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uaugauuggcaccucuuugagugua MIMAT0034432 cfa-miR-507a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aagggaagauggugaccac MIMAT0035542 hsa-miR-9500 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence aaaaguaacuaugguuuuugcc MIMAT0035703 hsa-miR-548bb-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9606), with sequence caaaaaccauaguuacuuuugc MIMAT0035704 hsa-miR-548bb-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cagaaggggagucgggagcgga MIMAT0035714 mmu-miR-3154 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence ugugauuuccaauaauugaggc MIMAT0035716 mmu-miR-3618-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cuacauuaaugaaaagagcaau MIMAT0035717 mmu-miR-3618-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10090), with sequence cccaguuaccgcuuccgcuaccgc MIMAT0035718 mmu-miR-935 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ugagguaguaguuuguacaguu MIMAT0035719 rno-let-7g-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cuguacaggccacugccuugc MIMAT0035720 rno-let-7g-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence acccgucccguucguccccgga MIMAT0035721 rno-miR-1247-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence cgggaacgucgagacuggagc MIMAT0035722 rno-miR-1247-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence auucauguaauucaggug MIMAT0035723 rno-miR-1297 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aaaguucugagacacucugacuc MIMAT0035724 rno-miR-148a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ucagugcacuacagaacuuug MIMAT0035725 rno-miR-148a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ucuggcuccgugucuucacuccc MIMAT0035726 rno-miR-149-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence gggacgggggcggugcug MIMAT0035727 rno-miR-149-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uagcagcacauaaugguuu MIMAT0035728 rno-miR-15a-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aggccauauugugcugccuca MIMAT0035729 rno-miR-15a-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence gggguuuugagggcgaga MIMAT0035733 rno-miR-193b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aacuggcccacaaaguccc MIMAT0035734 rno-miR-193b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uggcuguuguggugugcaaa MIMAT0035737 rno-miR-3064-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uuugccacacugcaacaccuuaca MIMAT0035738 rno-miR-3064-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uuuugcgauguguuccuaaua MIMAT0035746 rno-miR-450b-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence auuggggacgcuucgcauuca MIMAT0035747 rno-miR-450b-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence aacuguuugcagaggaaacugag MIMAT0035748 rno-miR-452-5p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ucagucucaucugcaaagaag MIMAT0035749 rno-miR-452-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence gcggggcuagggccggga MIMAT0035752 rno-miR-762 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence auauacauacacacauacaca MIMAT0037262 rno-miR-466b-4-3p A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uggaauguaaagaaguauguau MIMAT0037263 rno-miR-1b A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence ccguccugagcuugucgagcua MIMAT0037264 rno-miR-676 A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_10116), with sequence uccuguacugagcugccccgag MIMAT0037265 rno-miR-486 MIPF0000001 An evolutionary conserved group of miRNA gene products including the human hsa-mir-20b, hsa-mir-18b, hsa-mir-106b, hsa-mir-106-X, hsa-mir-93-7.1, hsa-mir-20, hsa-mir-18, hsa-mir-17, their precursors and their orthologs and paralogs MIPF0000001 miRBase miRNA family (mir-17) MIPF0000002 An evolutionary conserved group of miRNA gene products including the human hsa-let-7i, hsa-let-7g, hsa-mir-98-X, hsa-let-7f-2L, hsa-let-7f-1L, hsa-let-7eL, hsa-let-7dL, hsa-let-7cL, hsa-let-7bL, hsa-let-7a-3L, hsa-let-7a-2L, hsa-let-7a-1L, their precursors and their orthologs and paralogs MIPF0000002 miRBase miRNA family (let-7) MIPF0000005 An evolutionary conserved group of miRNA gene products including the human hsa-mir-30e, hsa-mir-30c-1, hsa-mir-30b, hsa-mir-30d, hsa-mir-30c, hsa-mir-30, their precursors and their orthologs and paralogs MIPF0000005 miRBase miRNA family (mir-30) MIPF0000006 An evolutionary conserved group of miRNA gene products including the human hsa-mir-195, hsa-mir-15b, hsa-mir-16-3, hsa-mir-16-13, hsa-mir-15, their precursors and their orthologs and paralogs MIPF0000006 miRBase miRNA family (mir-15) MIPF0000007 An evolutionary conserved group of miRNA gene products including the human hsa-mir-181d, hsa-mir-181b-2, hsa-mir-213, hsa-mir-181c, hsa-mir-181b, hsa-mir-181a, their precursors and their orthologs and paralogs MIPF0000007 miRBase miRNA family (mir-181) MIPF0000009 An evolutionary conserved group of miRNA gene products including the human hsa-mir-29c, hsa-mir-102-1, hsa-mir-102-7.1, hsa-mir-29, their precursors and their orthologs and paralogs MIPF0000009 miRBase miRNA family (mir-29) MIPF0000011 An evolutionary conserved group of miRNA gene products including the human hsa-mir-19b-2, hsa-mir-19b-1, hsa-mir-19a, their precursors and their orthologs and paralogs MIPF0000011 miRBase miRNA family (mir-19) MIPF0000013 An evolutionary conserved group of miRNA gene products including the human hsa-mir-92b, hsa-mir-92-X, hsa-mir-92-13, hsa-mir-25, their precursors and their orthologs and paralogs MIPF0000013 miRBase miRNA family (mir-25) MIPF0000014 An evolutionary conserved group of miRNA gene products including the human hsa-mir-9-3, hsa-mir-9-2, hsa-mir-9-1, their precursors and their orthologs and paralogs MIPF0000014 miRBase miRNA family (mir-9) MIPF0000018 An evolutionary conserved group of miRNA gene products including the human hsa-mir-323b, hsa-mir-300, hsa-mir-1185-1, hsa-mir-1185-2, hsa-mir-656, hsa-mir-655, hsa-mir-487b, hsa-mir-539, hsa-mir-496, hsa-mir-494, hsa-mir-487, hsa-mir-410, hsa-mir-409, hsa-mir-323, hsa-mir-382, hsa-mir-381, hsa-mir-377, hsa-mir-369, hsa-mir-154, their precursors and their orthologs and paralogs MIPF0000018 miRBase miRNA family (mir-154) MIPF0000019 An evolutionary conserved group of miRNA gene products including the human hsa-mir-429, hsa-mir-200a, hsa-mir-200c, hsa-mir-141, hsa-mir-200b, their precursors and their orthologs and paralogs MIPF0000019 miRBase miRNA family (mir-8) MIPF0000020 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1283-2, hsa-mir-1283-1, hsa-mir-519a-2, hsa-mir-516-2, hsa-mir-516-1, hsa-mir-527, hsa-mir-519a-1, hsa-mir-522, hsa-mir-521-1, hsa-mir-520h, hsa-mir-517c, hsa-mir-518a-2, hsa-mir-516-4, hsa-mir-518d, hsa-mir-518a-1, hsa-mir-518e, hsa-mir-526a-2, hsa-mir-516-3, hsa-mir-520g, hsa-mir-517b, hsa-mir-520d, hsa-mir-521-2, hsa-mir-519d, hsa-mir-517a, hsa-mir-524, hsa-mir-518c, hsa-mir-520c, hsa-mir-526a-1, hsa-mir-518b, hsa-mir-520b, hsa-mir-518f, hsa-mir-523, hsa-mir-525, hsa-mir-519b, hsa-mir-526b, hsa-mir-520a, hsa-mir-519c, hsa-mir-515-2, hsa-mir-520f, hsa-mir-519e, hsa-mir-515-1, hsa-mir-520e, their precursors and their orthologs and paralogs MIPF0000020 miRBase miRNA family (mir-515) MIPF0000021 An evolutionary conserved group of miRNA gene products including the human hsa-mir-124a-3, hsa-mir-124a-2, hsa-mir-124a-1, their precursors and their orthologs and paralogs MIPF0000021 miRBase miRNA family (mir-124) MIPF0000022 An evolutionary conserved group of miRNA gene products including the human hsa-mir-7-3, hsa-mir-7-2, hsa-mir-7-1, their precursors and their orthologs and paralogs MIPF0000022 miRBase miRNA family (mir-7) MIPF0000024 An evolutionary conserved group of miRNA gene products including the human hsa-mir-103-2-as, hsa-mir-103-1-as, hsa-mir-107-10, hsa-mir-103-5, hsa-mir-103-20, their precursors and their orthologs and paralogs MIPF0000024 miRBase miRNA family (mir-103) MIPF0000026 An evolutionary conserved group of miRNA gene products including the human hsa-mir-218-2, hsa-mir-218-1, their precursors and their orthologs and paralogs MIPF0000026 miRBase miRNA family (mir-218) MIPF0000027 An evolutionary conserved group of miRNA gene products including the human hsa-mir-23b, hsa-mir-23, their precursors and their orthologs and paralogs MIPF0000027 miRBase miRNA family (mir-23) MIPF0000028 An evolutionary conserved group of miRNA gene products including the human hsa-mir-135b, hsa-mir-135-2, hsa-mir-135-1, their precursors and their orthologs and paralogs MIPF0000028 miRBase miRNA family (mir-135) MIPF0000029 An evolutionary conserved group of miRNA gene products including the human hsa-mir-133b, hsa-mir-133a-2, hsa-mir-133a-1, their precursors and their orthologs and paralogs MIPF0000029 miRBase miRNA family (mir-133) MIPF0000031 An evolutionary conserved group of miRNA gene products including the human hsa-mir-196b, hsa-mir-196-2, hsa-mir-196, their precursors and their orthologs and paralogs MIPF0000031 miRBase miRNA family (mir-196) MIPF0000033 An evolutionary conserved group of miRNA gene products including the human hsa-mir-99b, hsa-mir-125b-2, hsa-mir-125a, hsa-mir-125b-1, hsa-mir-10b, hsa-mir-10a, hsa-mir-100-11, hsa-mir-99-21, their precursors and their orthologs and paralogs MIPF0000033 miRBase miRNA family (mir-10) MIPF0000034 An evolutionary conserved group of miRNA gene products including the human hsa-mir-301b, hsa-mir-130b, hsa-mir-301, hsa-mir-130a, their precursors and their orthologs and paralogs MIPF0000034 miRBase miRNA family (mir-130) MIPF0000036 An evolutionary conserved group of miRNA gene products including the human hsa-mir-27b, hsa-mir-27, their precursors and their orthologs and paralogs MIPF0000036 miRBase miRNA family (mir-27) MIPF0000038 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1b, hsa-mir-206, hsa-mir-1d, their precursors and their orthologs and paralogs MIPF0000038 miRBase miRNA family (mir-1) MIPF0000039 An evolutionary conserved group of miRNA gene products including the human hsa-mir-34c, hsa-mir-34b, hsa-mir-34, their precursors and their orthologs and paralogs MIPF0000039 miRBase miRNA family (mir-34) MIPF0000040 An evolutionary conserved group of miRNA gene products including the human hsa-mir-199b, hsa-mir-199a-2, hsa-mir-199-s, their precursors and their orthologs and paralogs MIPF0000040 miRBase miRNA family (mir-199) MIPF0000041 An evolutionary conserved group of miRNA gene products including the human hsa-mir-24-2, hsa-mir-24-1, their precursors and their orthologs and paralogs MIPF0000041 miRBase miRNA family (mir-24) MIPF0000042 An evolutionary conserved group of miRNA gene products including the human hsa-mir-211, hsa-mir-204, their precursors and their orthologs and paralogs MIPF0000042 miRBase miRNA family (mir-204) MIPF0000043 An evolutionary conserved group of miRNA gene products including the human hsa-mir-26a-2, hsa-mir-26b, hsa-mir-26a, their precursors and their orthologs and paralogs MIPF0000043 miRBase miRNA family (mir-26) MIPF0000044 An evolutionary conserved group of miRNA gene products including the human hsa-mir-2964a, hsa-mir-219-2, hsa-mir-219, their precursors and their orthologs and paralogs MIPF0000044 miRBase miRNA family (mir-219) MIPF0000046 An evolutionary conserved group of miRNA gene products including the human hsa-mir-101-2, hsa-mir-101-1, their precursors and their orthologs and paralogs MIPF0000046 miRBase miRNA family (mir-101) MIPF0000048 An evolutionary conserved group of miRNA gene products including the human hsa-mir-128b, hsa-mir-128a, their precursors and their orthologs and paralogs MIPF0000048 miRBase miRNA family (mir-128) MIPF0000050 An evolutionary conserved group of miRNA gene products including the human hsa-mir-153-2, hsa-mir-153-1, their precursors and their orthologs and paralogs MIPF0000050 miRBase miRNA family (mir-153) MIPF0000051 An evolutionary conserved group of miRNA gene products including the human hsa-mir-222, hsa-mir-221, their precursors and their orthologs and paralogs MIPF0000051 miRBase miRNA family (mir-221) MIPF0000053 An evolutionary conserved group of miRNA gene products including the human hsa-mir-22, their precursors and their orthologs and paralogs MIPF0000053 miRBase miRNA family (mir-22) MIPF0000054 An evolutionary conserved group of miRNA gene products including the human hsa-mir-216b, hsa-mir-216, their precursors and their orthologs and paralogs MIPF0000054 miRBase miRNA family (mir-216) MIPF0000055 An evolutionary conserved group of miRNA gene products including the human hsa-mir-194-2, hsa-mir-194, their precursors and their orthologs and paralogs MIPF0000055 miRBase miRNA family (mir-194) MIPF0000056 An evolutionary conserved group of miRNA gene products including the human hsa-mir-148b, hsa-mir-152, hsa-mir-148, their precursors and their orthologs and paralogs MIPF0000056 miRBase miRNA family (mir-148) MIPF0000057 An evolutionary conserved group of miRNA gene products including the human hsa-mir-151b, hsa-mir-151, hsa-mir-28, their precursors and their orthologs and paralogs MIPF0000057 miRBase miRNA family (mir-28) MIPF0000058 An evolutionary conserved group of miRNA gene products including the human hsa-mir-205, their precursors and their orthologs and paralogs MIPF0000058 miRBase miRNA family (mir-205) MIPF0000059 An evolutionary conserved group of miRNA gene products including the human hsa-mir-184, their precursors and their orthologs and paralogs MIPF0000059 miRBase miRNA family (mir-184) MIPF0000060 An evolutionary conserved group of miRNA gene products including the human hsa-mir-21, their precursors and their orthologs and paralogs MIPF0000060 miRBase miRNA family (mir-21) MIPF0000061 An evolutionary conserved group of miRNA gene products including the human hsa-mir-365-2, hsa-mir-365-1, their precursors and their orthologs and paralogs MIPF0000061 miRBase miRNA family (mir-365) MIPF0000062 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3120, hsa-mir-214, their precursors and their orthologs and paralogs MIPF0000062 miRBase miRNA family (mir-214) MIPF0000063 An evolutionary conserved group of miRNA gene products including the human hsa-mir-215, hsa-mir-192, their precursors and their orthologs and paralogs MIPF0000063 miRBase miRNA family (mir-192) MIPF0000064 An evolutionary conserved group of miRNA gene products including the human hsa-mir-31, their precursors and their orthologs and paralogs MIPF0000064 miRBase miRNA family (mir-31) MIPF0000065 An evolutionary conserved group of miRNA gene products including the human hsa-mir-132, hsa-mir-212, their precursors and their orthologs and paralogs MIPF0000065 miRBase miRNA family (mir-132) MIPF0000066 An evolutionary conserved group of miRNA gene products including the human hsa-mir-183, their precursors and their orthologs and paralogs MIPF0000066 miRBase miRNA family (mir-183) MIPF0000067 An evolutionary conserved group of miRNA gene products including the human hsa-mir-223, their precursors and their orthologs and paralogs MIPF0000067 miRBase miRNA family (mir-223) MIPF0000068 An evolutionary conserved group of miRNA gene products including the human hsa-mir-371b, hsa-mir-372, hsa-mir-371, their precursors and their orthologs and paralogs MIPF0000068 miRBase miRNA family (mir-290) MIPF0000069 An evolutionary conserved group of miRNA gene products including the human hsa-mir-32, their precursors and their orthologs and paralogs MIPF0000069 miRBase miRNA family (mir-32) MIPF0000070 An evolutionary conserved group of miRNA gene products including the human hsa-mir-33b, hsa-mir-33, their precursors and their orthologs and paralogs MIPF0000070 miRBase miRNA family (mir-33) MIPF0000071 An evolutionary conserved group of miRNA gene products including the human hsa-mir-302f, hsa-mir-302d, hsa-mir-302c, hsa-mir-302b, hsa-mir-302, their precursors and their orthologs and paralogs MIPF0000071 miRBase miRNA family (mir-302) MIPF0000072 An evolutionary conserved group of miRNA gene products including the human hsa-mir-96-7, their precursors and their orthologs and paralogs MIPF0000072 miRBase miRNA family (mir-96) MIPF0000073 An evolutionary conserved group of miRNA gene products including the human hsa-mir-129b, hsa-mir-129, their precursors and their orthologs and paralogs MIPF0000073 miRBase miRNA family (mir-129) MIPF0000074 An evolutionary conserved group of miRNA gene products including the human hsa-mir-105-X.2, hsa-mir-105-X.1, their precursors and their orthologs and paralogs MIPF0000074 miRBase miRNA family (mir-105) MIPF0000075 An evolutionary conserved group of miRNA gene products including the human hsa-mir-138-1, hsa-mir-138-2, their precursors and their orthologs and paralogs MIPF0000075 miRBase miRNA family (mir-138) MIPF0000076 An evolutionary conserved group of miRNA gene products including the human hsa-mir-190b, hsa-mir-190, their precursors and their orthologs and paralogs MIPF0000076 miRBase miRNA family (mir-190) MIPF0000077 An evolutionary conserved group of miRNA gene products including the human hsa-mir-217, their precursors and their orthologs and paralogs MIPF0000077 miRBase miRNA family (mir-217) MIPF0000078 An evolutionary conserved group of miRNA gene products including the human hsa-mir-187, their precursors and their orthologs and paralogs MIPF0000078 miRBase miRNA family (mir-187) MIPF0000079 An evolutionary conserved group of miRNA gene products including the human hsa-mir-145, their precursors and their orthologs and paralogs MIPF0000079 miRBase miRNA family (mir-145) MIPF0000080 An evolutionary conserved group of miRNA gene products including the human hsa-mir-127, their precursors and their orthologs and paralogs MIPF0000080 miRBase miRNA family (mir-127) MIPF0000082 An evolutionary conserved group of miRNA gene products including the human hsa-mir-193b, hsa-mir-193, their precursors and their orthologs and paralogs MIPF0000082 miRBase miRNA family (mir-193) MIPF0000084 An evolutionary conserved group of miRNA gene products including the human hsa-mir-142, their precursors and their orthologs and paralogs MIPF0000084 miRBase miRNA family (mir-142) MIPF0000085 An evolutionary conserved group of miRNA gene products including the human hsa-mir-140, their precursors and their orthologs and paralogs MIPF0000085 miRBase miRNA family (mir-140) MIPF0000086 An evolutionary conserved group of miRNA gene products including the human hsa-mir-210, their precursors and their orthologs and paralogs MIPF0000086 miRBase miRNA family (mir-210) MIPF0000088 An evolutionary conserved group of miRNA gene products including the human hsa-mir-224, their precursors and their orthologs and paralogs MIPF0000088 miRBase miRNA family (mir-224) MIPF0000090 An evolutionary conserved group of miRNA gene products including the human hsa-mir-198, their precursors and their orthologs and paralogs MIPF0000090 miRBase miRNA family (mir-198) MIPF0000091 An evolutionary conserved group of miRNA gene products including the human hsa-mir-376a-2, hsa-mir-376b, hsa-mir-376a, hsa-mir-368, their precursors and their orthologs and paralogs MIPF0000091 miRBase miRNA family (mir-368) MIPF0000093 An evolutionary conserved group of miRNA gene products including the human hsa-mir-144, their precursors and their orthologs and paralogs MIPF0000093 miRBase miRNA family (mir-144) MIPF0000094 An evolutionary conserved group of miRNA gene products including the human hsa-mir-143, their precursors and their orthologs and paralogs MIPF0000094 miRBase miRNA family (mir-143) MIPF0000095 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3591, hsa-mir-122a, their precursors and their orthologs and paralogs MIPF0000095 miRBase miRNA family (mir-122) MIPF0000097 An evolutionary conserved group of miRNA gene products including the human hsa-mir-338, their precursors and their orthologs and paralogs MIPF0000097 miRBase miRNA family (mir-338) MIPF0000098 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1264, hsa-mir-421, hsa-mir-545, hsa-mir-95-4, their precursors and their orthologs and paralogs MIPF0000098 miRBase miRNA family (mir-95) MIPF0000099 An evolutionary conserved group of miRNA gene products including the human hsa-mir-136, their precursors and their orthologs and paralogs MIPF0000099 miRBase miRNA family (mir-136) MIPF0000103 An evolutionary conserved group of miRNA gene products including the human hsa-mir-146b, hsa-mir-146, their precursors and their orthologs and paralogs MIPF0000103 miRBase miRNA family (mir-146) MIPF0000105 An evolutionary conserved group of miRNA gene products including the human hsa-mir-147b, hsa-mir-147, their precursors and their orthologs and paralogs MIPF0000105 miRBase miRNA family (mir-147) MIPF0000106 An evolutionary conserved group of miRNA gene products including the human hsa-mir-137, their precursors and their orthologs and paralogs MIPF0000106 miRBase miRNA family (mir-137) MIPF0000108 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3545, hsa-mir-203, their precursors and their orthologs and paralogs MIPF0000108 miRBase miRNA family (mir-203) MIPF0000109 An evolutionary conserved group of miRNA gene products including the human hsa-mir-186, their precursors and their orthologs and paralogs MIPF0000109 miRBase miRNA family (mir-186) MIPF0000110 An evolutionary conserved group of miRNA gene products including the human hsa-mir-543, hsa-mir-495, hsa-mir-329-2, hsa-mir-329-1, their precursors and their orthologs and paralogs MIPF0000110 miRBase miRNA family (mir-329) MIPF0000111 An evolutionary conserved group of miRNA gene products including the human hsa-mir-489, their precursors and their orthologs and paralogs MIPF0000111 miRBase miRNA family (mir-489) MIPF0000112 An evolutionary conserved group of miRNA gene products including the human hsa-mir-134, their precursors and their orthologs and paralogs MIPF0000112 miRBase miRNA family (mir-134) MIPF0000113 An evolutionary conserved group of miRNA gene products including the human hsa-mir-660, hsa-mir-532, hsa-mir-188, their precursors and their orthologs and paralogs MIPF0000113 miRBase miRNA family (mir-188) MIPF0000114 An evolutionary conserved group of miRNA gene products including the human hsa-mir-375, their precursors and their orthologs and paralogs MIPF0000114 miRBase miRNA family (mir-375) MIPF0000115 An evolutionary conserved group of miRNA gene products including the human hsa-mir-126, their precursors and their orthologs and paralogs MIPF0000115 miRBase miRNA family (mir-126) MIPF0000116 An evolutionary conserved group of miRNA gene products including the human hsa-mir-182-as, their precursors and their orthologs and paralogs MIPF0000116 miRBase miRNA family (mir-182) MIPF0000117 An evolutionary conserved group of miRNA gene products including the human hsa-mir-139, their precursors and their orthologs and paralogs MIPF0000117 miRBase miRNA family (mir-139) MIPF0000121 An evolutionary conserved group of miRNA gene products including the human hsa-mir-202, their precursors and their orthologs and paralogs MIPF0000121 miRBase miRNA family (mir-202) MIPF0000123 An evolutionary conserved group of miRNA gene products including the human hsa-mir-197, their precursors and their orthologs and paralogs MIPF0000123 miRBase miRNA family (mir-197) MIPF0000126 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1197, hsa-mir-758, hsa-mir-411, hsa-mir-380, hsa-mir-379, their precursors and their orthologs and paralogs MIPF0000126 miRBase miRNA family (mir-379) MIPF0000128 An evolutionary conserved group of miRNA gene products including the human hsa-mir-450b, hsa-mir-450-2, hsa-mir-450, their precursors and their orthologs and paralogs MIPF0000128 miRBase miRNA family (mir-450) MIPF0000129 An evolutionary conserved group of miRNA gene products including the human hsa-mir-455, their precursors and their orthologs and paralogs MIPF0000129 miRBase miRNA family (mir-455) MIPF0000130 An evolutionary conserved group of miRNA gene products including the human hsa-mir-514b, hsa-mir-513c, hsa-mir-513b, hsa-mir-509-3, hsa-mir-509-2, hsa-mir-514-3, hsa-mir-514-2, hsa-mir-514-1, hsa-mir-510, hsa-mir-509, hsa-mir-508, hsa-mir-507, hsa-mir-506, hsa-mir-513-2, hsa-mir-513-1, hsa-mir-512-2, hsa-mir-512-1, hsa-mir-511-1, their precursors and their orthologs and paralogs MIPF0000130 miRBase miRNA family (mir-506) MIPF0000133 An evolutionary conserved group of miRNA gene products including the human hsa-mir-449c, hsa-mir-449b, hsa-mir-449, their precursors and their orthologs and paralogs MIPF0000133 miRBase miRNA family (mir-449) MIPF0000137 An evolutionary conserved group of miRNA gene products including the human hsa-mir-383, their precursors and their orthologs and paralogs MIPF0000137 miRBase miRNA family (mir-383) MIPF0000138 An evolutionary conserved group of miRNA gene products including the human hsa-mir-363, their precursors and their orthologs and paralogs MIPF0000138 miRBase miRNA family (mir-363) MIPF0000139 An evolutionary conserved group of miRNA gene products including the human hsa-mir-500b, hsa-mir-502, hsa-mir-501, hsa-mir-500, their precursors and their orthologs and paralogs MIPF0000139 miRBase miRNA family (mir-500) MIPF0000142 An evolutionary conserved group of miRNA gene products including the human hsa-mir-431, their precursors and their orthologs and paralogs MIPF0000142 miRBase miRNA family (mir-431) MIPF0000143 An evolutionary conserved group of miRNA gene products including the human hsa-mir-326, their precursors and their orthologs and paralogs MIPF0000143 miRBase miRNA family (mir-326) MIPF0000147 An evolutionary conserved group of miRNA gene products including the human hsa-mir-325, their precursors and their orthologs and paralogs MIPF0000147 miRBase miRNA family (mir-325) MIPF0000148 An evolutionary conserved group of miRNA gene products including the human hsa-mir-451b, hsa-mir-451, their precursors and their orthologs and paralogs MIPF0000148 miRBase miRNA family (mir-451) MIPF0000149 An evolutionary conserved group of miRNA gene products including the human hsa-mir-448, their precursors and their orthologs and paralogs MIPF0000149 miRBase miRNA family (mir-448) MIPF0000157 An evolutionary conserved group of miRNA gene products including the human hsa-mir-155, their precursors and their orthologs and paralogs MIPF0000157 miRBase miRNA family (mir-155) MIPF0000159 An evolutionary conserved group of miRNA gene products including the human hsa-mir-296, their precursors and their orthologs and paralogs MIPF0000159 miRBase miRNA family (mir-296) MIPF0000162 An evolutionary conserved group of miRNA gene products including the human hsa-mir-367, their precursors and their orthologs and paralogs MIPF0000162 miRBase miRNA family (mir-367) MIPF0000163 An evolutionary conserved group of miRNA gene products including the human hsa-mir-320e, hsa-mir-320d-2, hsa-mir-320c-2, hsa-mir-320d-1, hsa-mir-320b-2, hsa-mir-320c-1, hsa-mir-320b-1, hsa-mir-320, their precursors and their orthologs and paralogs MIPF0000163 miRBase miRNA family (mir-320) MIPF0000164 An evolutionary conserved group of miRNA gene products including the human hsa-mir-424, their precursors and their orthologs and paralogs MIPF0000164 miRBase miRNA family (mir-322) MIPF0000165 An evolutionary conserved group of miRNA gene products including the human hsa-mir-324, their precursors and their orthologs and paralogs MIPF0000165 miRBase miRNA family (mir-324) MIPF0000167 An evolutionary conserved group of miRNA gene products including the human hsa-mir-370, their precursors and their orthologs and paralogs MIPF0000167 miRBase miRNA family (mir-370) MIPF0000168 An evolutionary conserved group of miRNA gene products including the human hsa-mir-378e, hsa-mir-378d-1, hsa-mir-378b, hsa-mir-378d-2, hsa-mir-378, their precursors and their orthologs and paralogs MIPF0000168 miRBase miRNA family (mir-378) MIPF0000172 An evolutionary conserved group of miRNA gene products including the human hsa-mir-361, their precursors and their orthologs and paralogs MIPF0000172 miRBase miRNA family (mir-361) MIPF0000173 An evolutionary conserved group of miRNA gene products including the human hsa-mir-499, their precursors and their orthologs and paralogs MIPF0000173 miRBase miRNA family (mir-499) MIPF0000174 An evolutionary conserved group of miRNA gene products including the human hsa-mir-454, their precursors and their orthologs and paralogs MIPF0000174 miRBase miRNA family (mir-454) MIPF0000177 An evolutionary conserved group of miRNA gene products including the human hsa-mir-433, their precursors and their orthologs and paralogs MIPF0000177 miRBase miRNA family (mir-433) MIPF0000178 An evolutionary conserved group of miRNA gene products including the human hsa-mir-208b, hsa-mir-208, their precursors and their orthologs and paralogs MIPF0000178 miRBase miRNA family (mir-208) MIPF0000180 An evolutionary conserved group of miRNA gene products including the human hsa-mir-483, their precursors and their orthologs and paralogs MIPF0000180 miRBase miRNA family (mir-483) MIPF0000183 An evolutionary conserved group of miRNA gene products including the human hsa-mir-503, their precursors and their orthologs and paralogs MIPF0000183 miRBase miRNA family (mir-503) MIPF0000185 An evolutionary conserved group of miRNA gene products including the human hsa-mir-542, their precursors and their orthologs and paralogs MIPF0000185 miRBase miRNA family (mir-542) MIPF0000186 An evolutionary conserved group of miRNA gene products including the human hsa-mir-299, their precursors and their orthologs and paralogs MIPF0000186 miRBase miRNA family (mir-299) MIPF0000188 An evolutionary conserved group of miRNA gene products including the human hsa-mir-346, their precursors and their orthologs and paralogs MIPF0000188 miRBase miRNA family (mir-346) MIPF0000189 An evolutionary conserved group of miRNA gene products including the human hsa-mir-345, their precursors and their orthologs and paralogs MIPF0000189 miRBase miRNA family (mir-345) MIPF0000190 An evolutionary conserved group of miRNA gene products including the human hsa-mir-342, their precursors and their orthologs and paralogs MIPF0000190 miRBase miRNA family (mir-342) MIPF0000191 An evolutionary conserved group of miRNA gene products including the human hsa-mir-340, their precursors and their orthologs and paralogs MIPF0000191 miRBase miRNA family (mir-340) MIPF0000192 An evolutionary conserved group of miRNA gene products including the human hsa-mir-412, their precursors and their orthologs and paralogs MIPF0000192 miRBase miRNA family (mir-412) MIPF0000193 An evolutionary conserved group of miRNA gene products including the human hsa-mir-339, their precursors and their orthologs and paralogs MIPF0000193 miRBase miRNA family (mir-339) MIPF0000194 An evolutionary conserved group of miRNA gene products including the human hsa-mir-191, their precursors and their orthologs and paralogs MIPF0000194 miRBase miRNA family (mir-191) MIPF0000195 An evolutionary conserved group of miRNA gene products including the human hsa-mir-337, their precursors and their orthologs and paralogs MIPF0000195 miRBase miRNA family (mir-337) MIPF0000196 An evolutionary conserved group of miRNA gene products including the human hsa-mir-335, their precursors and their orthologs and paralogs MIPF0000196 miRBase miRNA family (mir-335) MIPF0000197 An evolutionary conserved group of miRNA gene products including the human hsa-mir-150, their precursors and their orthologs and paralogs MIPF0000197 miRBase miRNA family (mir-150) MIPF0000199 An evolutionary conserved group of miRNA gene products including the human hsa-mir-331, their precursors and their orthologs and paralogs MIPF0000199 miRBase miRNA family (mir-331) MIPF0000200 An evolutionary conserved group of miRNA gene products including the human hsa-mir-330, their precursors and their orthologs and paralogs MIPF0000200 miRBase miRNA family (mir-330) MIPF0000201 An evolutionary conserved group of miRNA gene products including the human hsa-mir-485, their precursors and their orthologs and paralogs MIPF0000201 miRBase miRNA family (mir-485) MIPF0000202 An evolutionary conserved group of miRNA gene products including the human hsa-mir-185, their precursors and their orthologs and paralogs MIPF0000202 miRBase miRNA family (mir-185) MIPF0000203 An evolutionary conserved group of miRNA gene products including the human hsa-mir-328, their precursors and their orthologs and paralogs MIPF0000203 miRBase miRNA family (mir-328) MIPF0000204 An evolutionary conserved group of miRNA gene products including the human hsa-mir-297, their precursors and their orthologs and paralogs MIPF0000204 miRBase miRNA family (mir-297) MIPF0000206 An evolutionary conserved group of miRNA gene products including the human hsa-mir-298, their precursors and their orthologs and paralogs MIPF0000206 miRBase miRNA family (mir-298) MIPF0000209 An evolutionary conserved group of miRNA gene products including the human hsa-mir-362, their precursors and their orthologs and paralogs MIPF0000209 miRBase miRNA family (mir-362) MIPF0000211 An evolutionary conserved group of miRNA gene products including the human hsa-mir-432, their precursors and their orthologs and paralogs MIPF0000211 miRBase miRNA family (mir-432) MIPF0000213 An evolutionary conserved group of miRNA gene products including the human hsa-mir-541, their precursors and their orthologs and paralogs MIPF0000213 miRBase miRNA family (mir-541) MIPF0000217 An evolutionary conserved group of miRNA gene products including the human hsa-mir-505, their precursors and their orthologs and paralogs MIPF0000217 miRBase miRNA family (mir-505) MIPF0000219 An evolutionary conserved group of miRNA gene products including the human hsa-mir-484, their precursors and their orthologs and paralogs MIPF0000219 miRBase miRNA family (mir-484) MIPF0000220 An evolutionary conserved group of miRNA gene products including the human hsa-mir-486-2, hsa-mir-486, their precursors and their orthologs and paralogs MIPF0000220 miRBase miRNA family (mir-486) MIPF0000229 An evolutionary conserved group of miRNA gene products including the human hsa-mir-490, their precursors and their orthologs and paralogs MIPF0000229 miRBase miRNA family (mir-490) MIPF0000230 An evolutionary conserved group of miRNA gene products including the human hsa-mir-493, their precursors and their orthologs and paralogs MIPF0000230 miRBase miRNA family (mir-493) MIPF0000231 An evolutionary conserved group of miRNA gene products including the human hsa-mir-497, their precursors and their orthologs and paralogs MIPF0000231 miRBase miRNA family (mir-497) MIPF0000242 An evolutionary conserved group of miRNA gene products including the human hsa-mir-425, their precursors and their orthologs and paralogs MIPF0000242 miRBase miRNA family (mir-425) MIPF0000274 An evolutionary conserved group of miRNA gene products including the human hsa-mir-149, their precursors and their orthologs and paralogs MIPF0000274 miRBase miRNA family (mir-149) MIPF0000287 An evolutionary conserved group of miRNA gene products including the human hsa-mir-452, their precursors and their orthologs and paralogs MIPF0000287 miRBase miRNA family (mir-452) MIPF0000288 An evolutionary conserved group of miRNA gene products including the human hsa-mir-374c, hsa-mir-374b, hsa-mir-374, their precursors and their orthologs and paralogs MIPF0000288 miRBase miRNA family (mir-374) MIPF0000289 An evolutionary conserved group of miRNA gene products including the human hsa-mir-384, their precursors and their orthologs and paralogs MIPF0000289 miRBase miRNA family (mir-384) MIPF0000300 An evolutionary conserved group of miRNA gene products including the human hsa-mir-644b, hsa-mir-664, their precursors and their orthologs and paralogs MIPF0000300 miRBase miRNA family (mir-664) MIPF0000316 An evolutionary conserved group of miRNA gene products including the human hsa-mir-466, their precursors and their orthologs and paralogs MIPF0000316 miRBase miRNA family (mir-467) MIPF0000317 An evolutionary conserved group of miRNA gene products including the human hsa-mir-548bb, hsa-mir-548ba, hsa-mir-548az, hsa-mir-548ay, hsa-mir-548ax, hsa-mir-548aw, hsa-mir-548av, hsa-mir-548au, hsa-mir-548at, hsa-mir-548as, hsa-mir-548ar, hsa-mir-548aq, hsa-mir-548ap, hsa-mir-548ao, hsa-mir-548an, hsa-mir-548am, hsa-mir-548al, hsa-mir-548ak, hsa-mir-548x-2, hsa-mir-548aj-2, hsa-mir-548aj-1, hsa-mir-548ai, hsa-mir-548ah, hsa-mir-548ag-2, hsa-mir-548ag-1, hsa-mir-548ae-2, hsa-mir-548ae-1, hsa-mir-548ad, hsa-mir-548ac, hsa-mir-548ab, hsa-mir-548h-5, hsa-mir-548o-2, hsa-mir-548aa-2, hsa-mir-548aa-1, hsa-mir-548z, hsa-mir-548y, hsa-mir-548x, hsa-mir-548w, hsa-mir-548v, hsa-mir-548u, hsa-mir-548t, hsa-mir-548s, hsa-mir-548q, hsa-mir-548i-4, hsa-mir-548i-3, hsa-mir-548i-2, hsa-mir-548i-1, hsa-mir-548p, hsa-mir-548h-4, hsa-mir-548h-3, hsa-mir-548h-2, hsa-mir-548h-1, hsa-mir-548m, hsa-mir-548n, hsa-mir-548g, hsa-mir-548f-5, hsa-mir-548f-4, hsa-mir-548f-3, hsa-mir-548f-2, hsa-mir-548f-1, hsa-mir-548l, hsa-mir-548k, hsa-mir-548j, hsa-mir-548e, hsa-mir-548d-2, hsa-mir-548d-1, hsa-mir-548c, hsa-mir-603, hsa-mir-548a-3, hsa-mir-548a-2, hsa-mir-548b, hsa-mir-548a-1, hsa-mir-579, hsa-mir-570, their precursors and their orthologs and paralogs MIPF0000317 miRBase miRNA family (mir-548) MIPF0000318 An evolutionary conserved group of miRNA gene products including the human hsa-mir-488, their precursors and their orthologs and paralogs MIPF0000318 miRBase miRNA family (mir-488) MIPF0000319 An evolutionary conserved group of miRNA gene products including the human hsa-mir-491, their precursors and their orthologs and paralogs MIPF0000319 miRBase miRNA family (mir-491) MIPF0000329 An evolutionary conserved group of miRNA gene products including the human hsa-mir-423, their precursors and their orthologs and paralogs MIPF0000329 miRBase miRNA family (mir-423) MIPF0000333 An evolutionary conserved group of miRNA gene products including the human hsa-mir-652, their precursors and their orthologs and paralogs MIPF0000333 miRBase miRNA family (mir-652) MIPF0000334 An evolutionary conserved group of miRNA gene products including the human hsa-mir-550b-2, hsa-mir-550b-1, hsa-mir-550a-3, hsa-mir-550-2, hsa-mir-550-1, their precursors and their orthologs and paralogs MIPF0000334 miRBase miRNA family (mir-550) MIPF0000340 An evolutionary conserved group of miRNA gene products including the human hsa-mir-592, their precursors and their orthologs and paralogs MIPF0000340 miRBase miRNA family (mir-592) MIPF0000342 An evolutionary conserved group of miRNA gene products including the human hsa-mir-615, their precursors and their orthologs and paralogs MIPF0000342 miRBase miRNA family (mir-615) MIPF0000353 An evolutionary conserved group of miRNA gene products including the human hsa-mir-802, their precursors and their orthologs and paralogs MIPF0000353 miRBase miRNA family (mir-802) MIPF0000355 An evolutionary conserved group of miRNA gene products including the human hsa-mir-770, their precursors and their orthologs and paralogs MIPF0000355 miRBase miRNA family (mir-770) MIPF0000357 An evolutionary conserved group of miRNA gene products including the human hsa-mir-668, their precursors and their orthologs and paralogs MIPF0000357 miRBase miRNA family (mir-668) MIPF0000358 An evolutionary conserved group of miRNA gene products including the human hsa-mir-671, their precursors and their orthologs and paralogs MIPF0000358 miRBase miRNA family (mir-671) MIPF0000360 An evolutionary conserved group of miRNA gene products including the human hsa-mir-551b, hsa-mir-551a, their precursors and their orthologs and paralogs MIPF0000360 miRBase miRNA family (mir-551) MIPF0000365 An evolutionary conserved group of miRNA gene products including the human hsa-mir-675, their precursors and their orthologs and paralogs MIPF0000365 miRBase miRNA family (mir-675) MIPF0000386 An evolutionary conserved group of miRNA gene products including the human hsa-mir-892c, hsa-mir-892b, hsa-mir-888, hsa-mir-890, hsa-mir-892a, their precursors and their orthologs and paralogs MIPF0000386 miRBase miRNA family (mir-743) MIPF0000387 An evolutionary conserved group of miRNA gene products including the human hsa-mir-941-5, hsa-mir-941-4, hsa-mir-941-3, hsa-mir-941-2, hsa-mir-941-1, their precursors and their orthologs and paralogs MIPF0000387 miRBase miRNA family (mir-941) MIPF0000390 An evolutionary conserved group of miRNA gene products including the human hsa-mir-873, their precursors and their orthologs and paralogs MIPF0000390 miRBase miRNA family (mir-873) MIPF0000392 An evolutionary conserved group of miRNA gene products including the human hsa-mir-877, their precursors and their orthologs and paralogs MIPF0000392 miRBase miRNA family (mir-877) MIPF0000393 An evolutionary conserved group of miRNA gene products including the human hsa-mir-598, their precursors and their orthologs and paralogs MIPF0000393 miRBase miRNA family (mir-598) MIPF0000395 An evolutionary conserved group of miRNA gene products including the human hsa-mir-760, their precursors and their orthologs and paralogs MIPF0000395 miRBase miRNA family (mir-760) MIPF0000397 An evolutionary conserved group of miRNA gene products including the human hsa-mir-708, their precursors and their orthologs and paralogs MIPF0000397 miRBase miRNA family (mir-708) MIPF0000401 An evolutionary conserved group of miRNA gene products including the human hsa-mir-874, their precursors and their orthologs and paralogs MIPF0000401 miRBase miRNA family (mir-874) MIPF0000404 An evolutionary conserved group of miRNA gene products including the human hsa-mir-665, their precursors and their orthologs and paralogs MIPF0000404 miRBase miRNA family (mir-665) MIPF0000408 An evolutionary conserved group of miRNA gene products including the human hsa-mir-568, their precursors and their orthologs and paralogs MIPF0000408 miRBase miRNA family (mir-568) MIPF0000409 An evolutionary conserved group of miRNA gene products including the human hsa-mir-654, their precursors and their orthologs and paralogs MIPF0000409 miRBase miRNA family (mir-654) MIPF0000417 An evolutionary conserved group of miRNA gene products including the human hsa-mir-582, their precursors and their orthologs and paralogs MIPF0000417 miRBase miRNA family (mir-582) MIPF0000418 An evolutionary conserved group of miRNA gene products including the human hsa-mir-590, their precursors and their orthologs and paralogs MIPF0000418 miRBase miRNA family (mir-590) MIPF0000419 An evolutionary conserved group of miRNA gene products including the human hsa-mir-574, their precursors and their orthologs and paralogs MIPF0000419 miRBase miRNA family (mir-574) MIPF0000420 An evolutionary conserved group of miRNA gene products including the human hsa-mir-891b, hsa-mir-891a, their precursors and their orthologs and paralogs MIPF0000420 miRBase miRNA family (mir-891) MIPF0000424 An evolutionary conserved group of miRNA gene products including the human hsa-mir-875, their precursors and their orthologs and paralogs MIPF0000424 miRBase miRNA family (mir-875) MIPF0000430 An evolutionary conserved group of miRNA gene products including the human hsa-mir-876, their precursors and their orthologs and paralogs MIPF0000430 miRBase miRNA family (mir-876) MIPF0000431 An evolutionary conserved group of miRNA gene products including the human hsa-mir-744, their precursors and their orthologs and paralogs MIPF0000431 miRBase miRNA family (mir-744) MIPF0000435 An evolutionary conserved group of miRNA gene products including the human hsa-mir-653, their precursors and their orthologs and paralogs MIPF0000435 miRBase miRNA family (mir-653) MIPF0000436 An evolutionary conserved group of miRNA gene products including the human hsa-mir-544b, hsa-mir-544, their precursors and their orthologs and paralogs MIPF0000436 miRBase miRNA family (mir-544) MIPF0000437 An evolutionary conserved group of miRNA gene products including the human hsa-mir-504, their precursors and their orthologs and paralogs MIPF0000437 miRBase miRNA family (mir-504) MIPF0000440 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1224, their precursors and their orthologs and paralogs MIPF0000440 miRBase miRNA family (mir-1224) MIPF0000444 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1226, their precursors and their orthologs and paralogs MIPF0000444 miRBase miRNA family (mir-1226) MIPF0000445 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1225, their precursors and their orthologs and paralogs MIPF0000445 miRBase miRNA family (mir-1225) MIPF0000454 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1227, their precursors and their orthologs and paralogs MIPF0000454 miRBase miRNA family (mir-1227) MIPF0000456 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1302-11, hsa-mir-1302-10, hsa-mir-1302-9, hsa-mir-1302-8, hsa-mir-1302-7, hsa-mir-1302-6, hsa-mir-1302-5, hsa-mir-1302-4, hsa-mir-1302-3, hsa-mir-1302-2, hsa-mir-1302-1, their precursors and their orthologs and paralogs MIPF0000456 miRBase miRNA family (mir-1302) MIPF0000457 An evolutionary conserved group of miRNA gene products including the human hsa-mir-650, their precursors and their orthologs and paralogs MIPF0000457 miRBase miRNA family (mir-650) MIPF0000462 An evolutionary conserved group of miRNA gene products including the human hsa-mir-663b, hsa-mir-663, their precursors and their orthologs and paralogs MIPF0000462 miRBase miRNA family (mir-663) MIPF0000463 An evolutionary conserved group of miRNA gene products including the human hsa-mir-498, their precursors and their orthologs and paralogs MIPF0000463 miRBase miRNA family (mir-498) MIPF0000464 An evolutionary conserved group of miRNA gene products including the human hsa-mir-612, their precursors and their orthologs and paralogs MIPF0000464 miRBase miRNA family (mir-612) MIPF0000465 An evolutionary conserved group of miRNA gene products including the human hsa-mir-661, their precursors and their orthologs and paralogs MIPF0000465 miRBase miRNA family (mir-661) MIPF0000466 An evolutionary conserved group of miRNA gene products including the human hsa-mir-581, their precursors and their orthologs and paralogs MIPF0000466 miRBase miRNA family (mir-581) MIPF0000467 An evolutionary conserved group of miRNA gene products including the human hsa-mir-586, their precursors and their orthologs and paralogs MIPF0000467 miRBase miRNA family (mir-586) MIPF0000468 An evolutionary conserved group of miRNA gene products including the human hsa-mir-642b, hsa-mir-642, their precursors and their orthologs and paralogs MIPF0000468 miRBase miRNA family (mir-642) MIPF0000469 An evolutionary conserved group of miRNA gene products including the human hsa-mir-938, their precursors and their orthologs and paralogs MIPF0000469 miRBase miRNA family (mir-938) MIPF0000470 An evolutionary conserved group of miRNA gene products including the human hsa-mir-549, their precursors and their orthologs and paralogs MIPF0000470 miRBase miRNA family (mir-549) MIPF0000471 An evolutionary conserved group of miRNA gene products including the human hsa-mir-676, their precursors and their orthologs and paralogs MIPF0000471 miRBase miRNA family (mir-676) MIPF0000474 An evolutionary conserved group of miRNA gene products including the human hsa-mir-626, their precursors and their orthologs and paralogs MIPF0000474 miRBase miRNA family (mir-626) MIPF0000475 An evolutionary conserved group of miRNA gene products including the human hsa-mir-556, their precursors and their orthologs and paralogs MIPF0000475 miRBase miRNA family (mir-556) MIPF0000476 An evolutionary conserved group of miRNA gene products including the human hsa-mir-648, their precursors and their orthologs and paralogs MIPF0000476 miRBase miRNA family (mir-648) MIPF0000477 An evolutionary conserved group of miRNA gene products including the human hsa-mir-578, their precursors and their orthologs and paralogs MIPF0000477 miRBase miRNA family (mir-578) MIPF0000478 An evolutionary conserved group of miRNA gene products including the human hsa-mir-651, their precursors and their orthologs and paralogs MIPF0000478 miRBase miRNA family (mir-651) MIPF0000479 An evolutionary conserved group of miRNA gene products including the human hsa-mir-597, their precursors and their orthologs and paralogs MIPF0000479 miRBase miRNA family (mir-597) MIPF0000480 An evolutionary conserved group of miRNA gene products including the human hsa-mir-607, their precursors and their orthologs and paralogs MIPF0000480 miRBase miRNA family (mir-607) MIPF0000482 An evolutionary conserved group of miRNA gene products including the human hsa-mir-583, their precursors and their orthologs and paralogs MIPF0000482 miRBase miRNA family (mir-583) MIPF0000483 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1271, their precursors and their orthologs and paralogs MIPF0000483 miRBase miRNA family (mir-1271) MIPF0000484 An evolutionary conserved group of miRNA gene products including the human hsa-mir-600, their precursors and their orthologs and paralogs MIPF0000484 miRBase miRNA family (mir-600) MIPF0000486 An evolutionary conserved group of miRNA gene products including the human hsa-mir-638, their precursors and their orthologs and paralogs MIPF0000486 miRBase miRNA family (mir-638) MIPF0000487 An evolutionary conserved group of miRNA gene products including the human hsa-mir-553, their precursors and their orthologs and paralogs MIPF0000487 miRBase miRNA family (mir-553) MIPF0000488 An evolutionary conserved group of miRNA gene products including the human hsa-mir-643, their precursors and their orthologs and paralogs MIPF0000488 miRBase miRNA family (mir-643) MIPF0000490 An evolutionary conserved group of miRNA gene products including the human hsa-mir-939, their precursors and their orthologs and paralogs MIPF0000490 miRBase miRNA family (mir-939) MIPF0000492 An evolutionary conserved group of miRNA gene products including the human hsa-mir-662, their precursors and their orthologs and paralogs MIPF0000492 miRBase miRNA family (mir-662) MIPF0000493 An evolutionary conserved group of miRNA gene products including the human hsa-mir-576, their precursors and their orthologs and paralogs MIPF0000493 miRBase miRNA family (mir-576) MIPF0000494 An evolutionary conserved group of miRNA gene products including the human hsa-mir-640, their precursors and their orthologs and paralogs MIPF0000494 miRBase miRNA family (mir-640) MIPF0000495 An evolutionary conserved group of miRNA gene products including the human hsa-mir-920, their precursors and their orthologs and paralogs MIPF0000495 miRBase miRNA family (mir-920) MIPF0000496 An evolutionary conserved group of miRNA gene products including the human hsa-mir-589, their precursors and their orthologs and paralogs MIPF0000496 miRBase miRNA family (mir-589) MIPF0000498 An evolutionary conserved group of miRNA gene products including the human hsa-mir-657, their precursors and their orthologs and paralogs MIPF0000498 miRBase miRNA family (mir-657) MIPF0000499 An evolutionary conserved group of miRNA gene products including the human hsa-mir-492, their precursors and their orthologs and paralogs MIPF0000499 miRBase miRNA family (mir-492) MIPF0000500 An evolutionary conserved group of miRNA gene products including the human hsa-mir-373, their precursors and their orthologs and paralogs MIPF0000500 miRBase miRNA family (mir-373) MIPF0000501 An evolutionary conserved group of miRNA gene products including the human hsa-mir-552, their precursors and their orthologs and paralogs MIPF0000501 miRBase miRNA family (mir-552) MIPF0000502 An evolutionary conserved group of miRNA gene products including the human hsa-mir-599, their precursors and their orthologs and paralogs MIPF0000502 miRBase miRNA family (mir-599) MIPF0000503 An evolutionary conserved group of miRNA gene products including the human hsa-mir-593, their precursors and their orthologs and paralogs MIPF0000503 miRBase miRNA family (mir-593) MIPF0000505 An evolutionary conserved group of miRNA gene products including the human hsa-mir-933, their precursors and their orthologs and paralogs MIPF0000505 miRBase miRNA family (mir-933) MIPF0000506 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1255b-2, hsa-mir-1255b-1, hsa-mir-1255a, their precursors and their orthologs and paralogs MIPF0000506 miRBase miRNA family (mir-1255) MIPF0000507 An evolutionary conserved group of miRNA gene products including the human hsa-mir-616, their precursors and their orthologs and paralogs MIPF0000507 miRBase miRNA family (mir-616) MIPF0000508 An evolutionary conserved group of miRNA gene products including the human hsa-mir-631, their precursors and their orthologs and paralogs MIPF0000508 miRBase miRNA family (mir-631) MIPF0000511 An evolutionary conserved group of miRNA gene products including the human hsa-mir-942, their precursors and their orthologs and paralogs MIPF0000511 miRBase miRNA family (mir-942) MIPF0000512 An evolutionary conserved group of miRNA gene products including the human hsa-mir-562, their precursors and their orthologs and paralogs MIPF0000512 miRBase miRNA family (mir-562) MIPF0000513 An evolutionary conserved group of miRNA gene products including the human hsa-mir-924, their precursors and their orthologs and paralogs MIPF0000513 miRBase miRNA family (mir-924) MIPF0000514 An evolutionary conserved group of miRNA gene products including the human hsa-mir-889, their precursors and their orthologs and paralogs MIPF0000514 miRBase miRNA family (mir-889) MIPF0000515 An evolutionary conserved group of miRNA gene products including the human hsa-mir-580, their precursors and their orthologs and paralogs MIPF0000515 miRBase miRNA family (mir-580) MIPF0000516 An evolutionary conserved group of miRNA gene products including the human hsa-mir-609, their precursors and their orthologs and paralogs MIPF0000516 miRBase miRNA family (mir-609) MIPF0000517 An evolutionary conserved group of miRNA gene products including the human hsa-mir-936, their precursors and their orthologs and paralogs MIPF0000517 miRBase miRNA family (mir-936) MIPF0000519 An evolutionary conserved group of miRNA gene products including the human hsa-mir-563, their precursors and their orthologs and paralogs MIPF0000519 miRBase miRNA family (mir-563) MIPF0000520 An evolutionary conserved group of miRNA gene products including the human hsa-mir-557, their precursors and their orthologs and paralogs MIPF0000520 miRBase miRNA family (mir-557) MIPF0000522 An evolutionary conserved group of miRNA gene products including the human hsa-mir-601, their precursors and their orthologs and paralogs MIPF0000522 miRBase miRNA family (mir-601) MIPF0000523 An evolutionary conserved group of miRNA gene products including the human hsa-mir-624, their precursors and their orthologs and paralogs MIPF0000523 miRBase miRNA family (mir-624) MIPF0000524 An evolutionary conserved group of miRNA gene products including the human hsa-mir-636, their precursors and their orthologs and paralogs MIPF0000524 miRBase miRNA family (mir-636) MIPF0000527 An evolutionary conserved group of miRNA gene products including the human hsa-mir-632, their precursors and their orthologs and paralogs MIPF0000527 miRBase miRNA family (mir-632) MIPF0000528 An evolutionary conserved group of miRNA gene products including the human hsa-mir-605, their precursors and their orthologs and paralogs MIPF0000528 miRBase miRNA family (mir-605) MIPF0000529 An evolutionary conserved group of miRNA gene products including the human hsa-mir-628, their precursors and their orthologs and paralogs MIPF0000529 miRBase miRNA family (mir-628) MIPF0000530 An evolutionary conserved group of miRNA gene products including the human hsa-mir-577, their precursors and their orthologs and paralogs MIPF0000530 miRBase miRNA family (mir-577) MIPF0000531 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1306, their precursors and their orthologs and paralogs MIPF0000531 miRBase miRNA family (mir-1306) MIPF0000532 An evolutionary conserved group of miRNA gene products including the human hsa-mir-885, their precursors and their orthologs and paralogs MIPF0000532 miRBase miRNA family (mir-885) MIPF0000533 An evolutionary conserved group of miRNA gene products including the human hsa-mir-584, their precursors and their orthologs and paralogs MIPF0000533 miRBase miRNA family (mir-584) MIPF0000534 An evolutionary conserved group of miRNA gene products including the human hsa-mir-625, their precursors and their orthologs and paralogs MIPF0000534 miRBase miRNA family (mir-625) MIPF0000535 An evolutionary conserved group of miRNA gene products including the human hsa-mir-569, their precursors and their orthologs and paralogs MIPF0000535 miRBase miRNA family (mir-569) MIPF0000536 An evolutionary conserved group of miRNA gene products including the human hsa-mir-922, their precursors and their orthologs and paralogs MIPF0000536 miRBase miRNA family (mir-922) MIPF0000537 An evolutionary conserved group of miRNA gene products including the human hsa-mir-572, their precursors and their orthologs and paralogs MIPF0000537 miRBase miRNA family (mir-572) MIPF0000538 An evolutionary conserved group of miRNA gene products including the human hsa-mir-558, their precursors and their orthologs and paralogs MIPF0000538 miRBase miRNA family (mir-558) MIPF0000539 An evolutionary conserved group of miRNA gene products including the human hsa-mir-611, their precursors and their orthologs and paralogs MIPF0000539 miRBase miRNA family (mir-611) MIPF0000540 An evolutionary conserved group of miRNA gene products including the human hsa-mir-940, their precursors and their orthologs and paralogs MIPF0000540 miRBase miRNA family (mir-940) MIPF0000541 An evolutionary conserved group of miRNA gene products including the human hsa-mir-944, their precursors and their orthologs and paralogs MIPF0000541 miRBase miRNA family (mir-944) MIPF0000542 An evolutionary conserved group of miRNA gene products including the human hsa-mir-934, their precursors and their orthologs and paralogs MIPF0000542 miRBase miRNA family (mir-934) MIPF0000545 An evolutionary conserved group of miRNA gene products including the human hsa-mir-765, their precursors and their orthologs and paralogs MIPF0000545 miRBase miRNA family (mir-765) MIPF0000546 An evolutionary conserved group of miRNA gene products including the human hsa-mir-633, their precursors and their orthologs and paralogs MIPF0000546 miRBase miRNA family (mir-633) MIPF0000547 An evolutionary conserved group of miRNA gene products including the human hsa-mir-649, their precursors and their orthologs and paralogs MIPF0000547 miRBase miRNA family (mir-649) MIPF0000548 An evolutionary conserved group of miRNA gene products including the human hsa-mir-422a, their precursors and their orthologs and paralogs MIPF0000548 miRBase miRNA family (mir-422) MIPF0000549 An evolutionary conserved group of miRNA gene products including the human hsa-mir-639, their precursors and their orthologs and paralogs MIPF0000549 miRBase miRNA family (mir-639) MIPF0000550 An evolutionary conserved group of miRNA gene products including the human hsa-mir-627, their precursors and their orthologs and paralogs MIPF0000550 miRBase miRNA family (mir-627) MIPF0000551 An evolutionary conserved group of miRNA gene products including the human hsa-mir-554, their precursors and their orthologs and paralogs MIPF0000551 miRBase miRNA family (mir-554) MIPF0000552 An evolutionary conserved group of miRNA gene products including the human hsa-mir-767, their precursors and their orthologs and paralogs MIPF0000552 miRBase miRNA family (mir-767) MIPF0000553 An evolutionary conserved group of miRNA gene products including the human hsa-mir-618, their precursors and their orthologs and paralogs MIPF0000553 miRBase miRNA family (mir-618) MIPF0000554 An evolutionary conserved group of miRNA gene products including the human hsa-mir-887, their precursors and their orthologs and paralogs MIPF0000554 miRBase miRNA family (mir-887) MIPF0000555 An evolutionary conserved group of miRNA gene products including the human hsa-mir-567, their precursors and their orthologs and paralogs MIPF0000555 miRBase miRNA family (mir-567) MIPF0000556 An evolutionary conserved group of miRNA gene products including the human hsa-mir-644, their precursors and their orthologs and paralogs MIPF0000556 miRBase miRNA family (mir-644) MIPF0000557 An evolutionary conserved group of miRNA gene products including the human hsa-mir-619, their precursors and their orthologs and paralogs MIPF0000557 miRBase miRNA family (mir-619) MIPF0000558 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1307, their precursors and their orthologs and paralogs MIPF0000558 miRBase miRNA family (mir-1307) MIPF0000559 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1285-2, hsa-mir-1285-1, their precursors and their orthologs and paralogs MIPF0000559 miRBase miRNA family (mir-1285) MIPF0000560 An evolutionary conserved group of miRNA gene products including the human hsa-mir-937, their precursors and their orthologs and paralogs MIPF0000560 miRBase miRNA family (mir-937) MIPF0000561 An evolutionary conserved group of miRNA gene products including the human hsa-mir-573, their precursors and their orthologs and paralogs MIPF0000561 miRBase miRNA family (mir-573) MIPF0000562 An evolutionary conserved group of miRNA gene products including the human hsa-mir-604, their precursors and their orthologs and paralogs MIPF0000562 miRBase miRNA family (mir-604) MIPF0000563 An evolutionary conserved group of miRNA gene products including the human hsa-mir-587, their precursors and their orthologs and paralogs MIPF0000563 miRBase miRNA family (mir-587) MIPF0000569 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1244-4, hsa-mir-1244-3, hsa-mir-1244-2, hsa-mir-1244, their precursors and their orthologs and paralogs MIPF0000569 miRBase miRNA family (mir-1244) MIPF0000576 An evolutionary conserved group of miRNA gene products including the human hsa-mir-566, their precursors and their orthologs and paralogs MIPF0000576 miRBase miRNA family (mir-566) MIPF0000578 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1233-2, hsa-mir-1233, their precursors and their orthologs and paralogs MIPF0000578 miRBase miRNA family (mir-1233) MIPF0000579 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1273g, hsa-mir-1273f, hsa-mir-1273e, hsa-mir-1273d, hsa-mir-1273, their precursors and their orthologs and paralogs MIPF0000579 miRBase miRNA family (mir-1273) MIPF0000583 An evolutionary conserved group of miRNA gene products including the human hsa-mir-555, their precursors and their orthologs and paralogs MIPF0000583 miRBase miRNA family (mir-555) MIPF0000584 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1297, their precursors and their orthologs and paralogs MIPF0000584 miRBase miRNA family (mir-1297) MIPF0000585 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1237, their precursors and their orthologs and paralogs MIPF0000585 miRBase miRNA family (mir-1237) MIPF0000586 An evolutionary conserved group of miRNA gene products including the human hsa-mir-575, their precursors and their orthologs and paralogs MIPF0000586 miRBase miRNA family (mir-575) MIPF0000587 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1282, their precursors and their orthologs and paralogs MIPF0000587 miRBase miRNA family (mir-1282) MIPF0000589 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1324, their precursors and their orthologs and paralogs MIPF0000589 miRBase miRNA family (mir-1324) MIPF0000590 An evolutionary conserved group of miRNA gene products including the human hsa-mir-613, their precursors and their orthologs and paralogs MIPF0000590 miRBase miRNA family (mir-613) MIPF0000591 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1278, their precursors and their orthologs and paralogs MIPF0000591 miRBase miRNA family (mir-1278) MIPF0000592 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1184-3, hsa-mir-1184-2, hsa-mir-1184, their precursors and their orthologs and paralogs MIPF0000592 miRBase miRNA family (mir-1184) MIPF0000594 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1256, their precursors and their orthologs and paralogs MIPF0000594 miRBase miRNA family (mir-1256) MIPF0000595 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1262, their precursors and their orthologs and paralogs MIPF0000595 miRBase miRNA family (mir-1262) MIPF0000596 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1207, their precursors and their orthologs and paralogs MIPF0000596 miRBase miRNA family (mir-1207) MIPF0000597 An evolutionary conserved group of miRNA gene products including the human hsa-mir-637, their precursors and their orthologs and paralogs MIPF0000597 miRBase miRNA family (mir-637) MIPF0000598 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1298, their precursors and their orthologs and paralogs MIPF0000598 miRBase miRNA family (mir-1298) MIPF0000599 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1291, their precursors and their orthologs and paralogs MIPF0000599 miRBase miRNA family (mir-1291) MIPF0000600 An evolutionary conserved group of miRNA gene products including the human hsa-mir-634, their precursors and their orthologs and paralogs MIPF0000600 miRBase miRNA family (mir-634) MIPF0000601 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1178, their precursors and their orthologs and paralogs MIPF0000601 miRBase miRNA family (mir-1178) MIPF0000603 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1294, their precursors and their orthologs and paralogs MIPF0000603 miRBase miRNA family (mir-1294) MIPF0000604 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1284, their precursors and their orthologs and paralogs MIPF0000604 miRBase miRNA family (mir-1284) MIPF0000605 An evolutionary conserved group of miRNA gene products including the human hsa-mir-646, their precursors and their orthologs and paralogs MIPF0000605 miRBase miRNA family (mir-646) MIPF0000606 An evolutionary conserved group of miRNA gene products including the human hsa-mir-935, their precursors and their orthologs and paralogs MIPF0000606 miRBase miRNA family (mir-935) MIPF0000608 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1303, their precursors and their orthologs and paralogs MIPF0000608 miRBase miRNA family (mir-1303) MIPF0000609 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1205, their precursors and their orthologs and paralogs MIPF0000609 miRBase miRNA family (mir-1205) MIPF0000610 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1290, their precursors and their orthologs and paralogs MIPF0000610 miRBase miRNA family (mir-1290) MIPF0000611 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1253, their precursors and their orthologs and paralogs MIPF0000611 miRBase miRNA family (mir-1253) MIPF0000612 An evolutionary conserved group of miRNA gene products including the human hsa-mir-564, their precursors and their orthologs and paralogs MIPF0000612 miRBase miRNA family (mir-564) MIPF0000613 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1202, their precursors and their orthologs and paralogs MIPF0000613 miRBase miRNA family (mir-1202) MIPF0000614 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1254-2, hsa-mir-1254, their precursors and their orthologs and paralogs MIPF0000614 miRBase miRNA family (mir-1254) MIPF0000615 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1266, their precursors and their orthologs and paralogs MIPF0000615 miRBase miRNA family (mir-1266) MIPF0000617 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1323, their precursors and their orthologs and paralogs MIPF0000617 miRBase miRNA family (mir-1323) MIPF0000619 An evolutionary conserved group of miRNA gene products including the human hsa-mir-622, their precursors and their orthologs and paralogs MIPF0000619 miRBase miRNA family (mir-622) MIPF0000620 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1245b, hsa-mir-1245, their precursors and their orthologs and paralogs MIPF0000620 miRBase miRNA family (mir-1245) MIPF0000621 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1251, their precursors and their orthologs and paralogs MIPF0000621 miRBase miRNA family (mir-1251) MIPF0000622 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1248, their precursors and their orthologs and paralogs MIPF0000622 miRBase miRNA family (mir-1248) MIPF0000623 An evolutionary conserved group of miRNA gene products including the human hsa-mir-561, their precursors and their orthologs and paralogs MIPF0000623 miRBase miRNA family (mir-561) MIPF0000624 An evolutionary conserved group of miRNA gene products including the human hsa-mir-762, their precursors and their orthologs and paralogs MIPF0000624 miRBase miRNA family (mir-762) MIPF0000625 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1299, their precursors and their orthologs and paralogs MIPF0000625 miRBase miRNA family (mir-1299) MIPF0000626 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1289-2, hsa-mir-1289-1, their precursors and their orthologs and paralogs MIPF0000626 miRBase miRNA family (mir-1289) MIPF0000627 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1246, their precursors and their orthologs and paralogs MIPF0000627 miRBase miRNA family (mir-1246) MIPF0000628 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1208, their precursors and their orthologs and paralogs MIPF0000628 miRBase miRNA family (mir-1208) MIPF0000631 An evolutionary conserved group of miRNA gene products including the human hsa-mir-621, their precursors and their orthologs and paralogs MIPF0000631 miRBase miRNA family (mir-621) MIPF0000632 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1179, their precursors and their orthologs and paralogs MIPF0000632 miRBase miRNA family (mir-1179) MIPF0000633 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1203, their precursors and their orthologs and paralogs MIPF0000633 miRBase miRNA family (mir-1203) MIPF0000634 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1206, their precursors and their orthologs and paralogs MIPF0000634 miRBase miRNA family (mir-1206) MIPF0000640 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1267, their precursors and their orthologs and paralogs MIPF0000640 miRBase miRNA family (mir-1267) MIPF0000641 An evolutionary conserved group of miRNA gene products including the human hsa-mir-591, their precursors and their orthologs and paralogs MIPF0000641 miRBase miRNA family (mir-591) MIPF0000643 An evolutionary conserved group of miRNA gene products including the human hsa-mir-658, their precursors and their orthologs and paralogs MIPF0000643 miRBase miRNA family (mir-658) MIPF0000645 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1272, their precursors and their orthologs and paralogs MIPF0000645 miRBase miRNA family (mir-1272) MIPF0000646 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1827, their precursors and their orthologs and paralogs MIPF0000646 miRBase miRNA family (mir-1827) MIPF0000647 An evolutionary conserved group of miRNA gene products including the human hsa-mir-614, their precursors and their orthologs and paralogs MIPF0000647 miRBase miRNA family (mir-614) MIPF0000649 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1296, their precursors and their orthologs and paralogs MIPF0000649 miRBase miRNA family (mir-1296) MIPF0000651 An evolutionary conserved group of miRNA gene products including the human hsa-mir-595, their precursors and their orthologs and paralogs MIPF0000651 miRBase miRNA family (mir-595) MIPF0000652 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1276, their precursors and their orthologs and paralogs MIPF0000652 miRBase miRNA family (mir-1276) MIPF0000653 An evolutionary conserved group of miRNA gene products including the human hsa-mir-630, their precursors and their orthologs and paralogs MIPF0000653 miRBase miRNA family (mir-630) MIPF0000656 An evolutionary conserved group of miRNA gene products including the human hsa-mir-559, their precursors and their orthologs and paralogs MIPF0000656 miRBase miRNA family (mir-559) MIPF0000657 An evolutionary conserved group of miRNA gene products including the human hsa-mir-645, their precursors and their orthologs and paralogs MIPF0000657 miRBase miRNA family (mir-645) MIPF0000658 An evolutionary conserved group of miRNA gene products including the human hsa-mir-302e, their precursors and their orthologs and paralogs MIPF0000658 miRBase miRNA family (mir-302_2) MIPF0000660 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1288, their precursors and their orthologs and paralogs MIPF0000660 miRBase miRNA family (mir-1288) MIPF0000661 An evolutionary conserved group of miRNA gene products including the human hsa-mir-610, their precursors and their orthologs and paralogs MIPF0000661 miRBase miRNA family (mir-610) MIPF0000662 An evolutionary conserved group of miRNA gene products including the human hsa-mir-635, their precursors and their orthologs and paralogs MIPF0000662 miRBase miRNA family (mir-635) MIPF0000663 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1322, their precursors and their orthologs and paralogs MIPF0000663 miRBase miRNA family (mir-1322) MIPF0000665 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1181, their precursors and their orthologs and paralogs MIPF0000665 miRBase miRNA family (mir-1181) MIPF0000667 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1249, their precursors and their orthologs and paralogs MIPF0000667 miRBase miRNA family (mir-1249) MIPF0000668 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1183, their precursors and their orthologs and paralogs MIPF0000668 miRBase miRNA family (mir-1183) MIPF0000669 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1247, their precursors and their orthologs and paralogs MIPF0000669 miRBase miRNA family (mir-1247) MIPF0000670 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1825, their precursors and their orthologs and paralogs MIPF0000670 miRBase miRNA family (mir-1825) MIPF0000671 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1204, their precursors and their orthologs and paralogs MIPF0000671 miRBase miRNA family (mir-1204) MIPF0000672 An evolutionary conserved group of miRNA gene products including the human hsa-mir-617, their precursors and their orthologs and paralogs MIPF0000672 miRBase miRNA family (mir-617) MIPF0000673 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1182, their precursors and their orthologs and paralogs MIPF0000673 miRBase miRNA family (mir-1182) MIPF0000674 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1275, their precursors and their orthologs and paralogs MIPF0000674 miRBase miRNA family (mir-1275) MIPF0000675 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1292, their precursors and their orthologs and paralogs MIPF0000675 miRBase miRNA family (mir-1292) MIPF0000676 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1295, their precursors and their orthologs and paralogs MIPF0000676 miRBase miRNA family (mir-1295) MIPF0000677 An evolutionary conserved group of miRNA gene products including the human hsa-mir-766, their precursors and their orthologs and paralogs MIPF0000677 miRBase miRNA family (mir-766) MIPF0000679 An evolutionary conserved group of miRNA gene products including the human hsa-mir-641, their precursors and their orthologs and paralogs MIPF0000679 miRBase miRNA family (mir-641) MIPF0000681 An evolutionary conserved group of miRNA gene products including the human hsa-mir-588, their precursors and their orthologs and paralogs MIPF0000681 miRBase miRNA family (mir-588) MIPF0000682 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1286, their precursors and their orthologs and paralogs MIPF0000682 miRBase miRNA family (mir-1286) MIPF0000684 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1258, their precursors and their orthologs and paralogs MIPF0000684 miRBase miRNA family (mir-1258) MIPF0000687 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1263, their precursors and their orthologs and paralogs MIPF0000687 miRBase miRNA family (mir-1263) MIPF0000688 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1265, their precursors and their orthologs and paralogs MIPF0000688 miRBase miRNA family (mir-1265) MIPF0000689 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1236, their precursors and their orthologs and paralogs MIPF0000689 miRBase miRNA family (mir-1236) MIPF0000690 An evolutionary conserved group of miRNA gene products including the human hsa-mir-943, their precursors and their orthologs and paralogs MIPF0000690 miRBase miRNA family (mir-943) MIPF0000691 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1293, their precursors and their orthologs and paralogs MIPF0000691 miRBase miRNA family (mir-1293) MIPF0000695 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1281, their precursors and their orthologs and paralogs MIPF0000695 miRBase miRNA family (mir-1281) MIPF0000696 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1250, their precursors and their orthologs and paralogs MIPF0000696 miRBase miRNA family (mir-1250) MIPF0000706 An evolutionary conserved group of miRNA gene products including the human hsa-mir-759, their precursors and their orthologs and paralogs MIPF0000706 miRBase miRNA family (mir-759) MIPF0000707 An evolutionary conserved group of miRNA gene products including the human hsa-mir-764, their precursors and their orthologs and paralogs MIPF0000707 miRBase miRNA family (mir-764) MIPF0000709 An evolutionary conserved group of miRNA gene products including the human hsa-mir-761, their precursors and their orthologs and paralogs MIPF0000709 miRBase miRNA family (mir-761) MIPF0000714 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1193, their precursors and their orthologs and paralogs MIPF0000714 miRBase miRNA family (mir-1193) MIPF0000721 An evolutionary conserved group of miRNA gene products including the human hsa-mir-718, their precursors and their orthologs and paralogs MIPF0000721 miRBase miRNA family (mir-718) MIPF0000725 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1287, their precursors and their orthologs and paralogs MIPF0000725 miRBase miRNA family (mir-1287) MIPF0000727 An evolutionary conserved group of miRNA gene products including the human hsa-mir-769, their precursors and their orthologs and paralogs MIPF0000727 miRBase miRNA family (mir-769) MIPF0000734 An evolutionary conserved group of miRNA gene products including the human hsa-mir-670, their precursors and their orthologs and paralogs MIPF0000734 miRBase miRNA family (mir-670) MIPF0000742 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1301, their precursors and their orthologs and paralogs MIPF0000742 miRBase miRNA family (mir-1301) MIPF0000748 An evolutionary conserved group of miRNA gene products including the human hsa-mir-711, their precursors and their orthologs and paralogs MIPF0000748 miRBase miRNA family (mir-711) MIPF0000757 An evolutionary conserved group of miRNA gene products including the human hsa-mir-571, their precursors and their orthologs and paralogs MIPF0000757 miRBase miRNA family (mir-571) MIPF0000767 An evolutionary conserved group of miRNA gene products including the human hsa-mir-602, their precursors and their orthologs and paralogs MIPF0000767 miRBase miRNA family (mir-602) MIPF0000768 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1912, their precursors and their orthologs and paralogs MIPF0000768 miRBase miRNA family (mir-1912) MIPF0000777 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1468, their precursors and their orthologs and paralogs MIPF0000777 miRBase miRNA family (mir-1468) MIPF0000780 An evolutionary conserved group of miRNA gene products including the human hsa-mir-606, their precursors and their orthologs and paralogs MIPF0000780 miRBase miRNA family (mir-606) MIPF0000789 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1180, their precursors and their orthologs and paralogs MIPF0000789 miRBase miRNA family (mir-1180) MIPF0000798 An evolutionary conserved group of miRNA gene products including the human hsa-mir-623, their precursors and their orthologs and paralogs MIPF0000798 miRBase miRNA family (mir-623) MIPF0000802 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1261, their precursors and their orthologs and paralogs MIPF0000802 miRBase miRNA family (mir-1261) MIPF0000808 An evolutionary conserved group of miRNA gene products including the human hsa-mir-596, their precursors and their orthologs and paralogs MIPF0000808 miRBase miRNA family (mir-596) MIPF0000845 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3130-2, hsa-mir-3130-1, their precursors and their orthologs and paralogs MIPF0000845 miRBase miRNA family (mir-3130) MIPF0000846 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3202-2, hsa-mir-3202-1, their precursors and their orthologs and paralogs MIPF0000846 miRBase miRNA family (mir-3202) MIPF0000877 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1270, their precursors and their orthologs and paralogs MIPF0000877 miRBase miRNA family (mir-1270) MIPF0000891 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3156-3, hsa-mir-3156-2, hsa-mir-3156-1, their precursors and their orthologs and paralogs MIPF0000891 miRBase miRNA family (mir-3156) MIPF0000894 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3180-5, hsa-mir-3180-4, hsa-mir-3180-3, hsa-mir-3180-2, hsa-mir-3180-1, their precursors and their orthologs and paralogs MIPF0000894 miRBase miRNA family (mir-3180) MIPF0000900 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3179-4, hsa-mir-3179-3, hsa-mir-3179-2, hsa-mir-3179-1, their precursors and their orthologs and paralogs MIPF0000900 miRBase miRNA family (mir-3179) MIPF0000903 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1538, their precursors and their orthologs and paralogs MIPF0000903 miRBase miRNA family (mir-1538) MIPF0000917 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1537, their precursors and their orthologs and paralogs MIPF0000917 miRBase miRNA family (mir-1537) MIPF0000919 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4283-2, hsa-mir-4283-1, their precursors and their orthologs and paralogs MIPF0000919 miRBase miRNA family (mir-4283) MIPF0000924 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1228, their precursors and their orthologs and paralogs MIPF0000924 miRBase miRNA family (mir-1228) MIPF0000938 An evolutionary conserved group of miRNA gene products including the human hsa-mir-2355, their precursors and their orthologs and paralogs MIPF0000938 miRBase miRNA family (mir-2355) MIPF0000939 An evolutionary conserved group of miRNA gene products including the human hsa-mir-647, their precursors and their orthologs and paralogs MIPF0000939 miRBase miRNA family (mir-647) MIPF0000941 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1238, their precursors and their orthologs and paralogs MIPF0000941 miRBase miRNA family (mir-1238) MIPF0000946 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1268, their precursors and their orthologs and paralogs MIPF0000946 miRBase miRNA family (mir-1268) MIPF0000963 An evolutionary conserved group of miRNA gene products including the human hsa-mir-2861, their precursors and their orthologs and paralogs MIPF0000963 miRBase miRNA family (mir-2861) MIPF0000965 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1305, their precursors and their orthologs and paralogs MIPF0000965 miRBase miRNA family (mir-1305) MIPF0000968 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1252, their precursors and their orthologs and paralogs MIPF0000968 miRBase miRNA family (mir-1252) MIPF0000971 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3119-2, hsa-mir-3119-1, their precursors and their orthologs and paralogs MIPF0000971 miRBase miRNA family (mir-3119) MIPF0000972 An evolutionary conserved group of miRNA gene products including the human hsa-mir-608, their precursors and their orthologs and paralogs MIPF0000972 miRBase miRNA family (mir-608) MIPF0000973 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1909, their precursors and their orthologs and paralogs MIPF0000973 miRBase miRNA family (mir-1909) MIPF0000979 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1469, their precursors and their orthologs and paralogs MIPF0000979 miRBase miRNA family (mir-1469) MIPF0000982 An evolutionary conserved group of miRNA gene products including the human hsa-mir-921, their precursors and their orthologs and paralogs MIPF0000982 miRBase miRNA family (mir-921) MIPF0000984 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1269, their precursors and their orthologs and paralogs MIPF0000984 miRBase miRNA family (mir-1269) MIPF0000987 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1910, their precursors and their orthologs and paralogs MIPF0000987 miRBase miRNA family (mir-1910) MIPF0000998 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1257, their precursors and their orthologs and paralogs MIPF0000998 miRBase miRNA family (mir-1257) MIPF0001002 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3116-2, hsa-mir-3116-1, their precursors and their orthologs and paralogs MIPF0001002 miRBase miRNA family (mir-3116) MIPF0001015 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1913, their precursors and their orthologs and paralogs MIPF0001015 miRBase miRNA family (mir-1913) MIPF0001020 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1260, their precursors and their orthologs and paralogs MIPF0001020 miRBase miRNA family (mir-1260a) MIPF0001021 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1908, their precursors and their orthologs and paralogs MIPF0001021 miRBase miRNA family (mir-1908) MIPF0001025 An evolutionary conserved group of miRNA gene products including the human hsa-mir-5708, hsa-mir-1972-2, hsa-mir-1972, their precursors and their orthologs and paralogs MIPF0001025 miRBase miRNA family (mir-1972) MIPF0001026 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3199-2, hsa-mir-3199-1, their precursors and their orthologs and paralogs MIPF0001026 miRBase miRNA family (mir-3199) MIPF0001028 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3160-2, hsa-mir-3160-1, their precursors and their orthologs and paralogs MIPF0001028 miRBase miRNA family (mir-3160) MIPF0001033 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4315-2, hsa-mir-4315-1, their precursors and their orthologs and paralogs MIPF0001033 miRBase miRNA family (mir-4315) MIPF0001036 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1200, their precursors and their orthologs and paralogs MIPF0001036 miRBase miRNA family (mir-1200) MIPF0001037 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1915, their precursors and their orthologs and paralogs MIPF0001037 miRBase miRNA family (mir-1915) MIPF0001040 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1914, their precursors and their orthologs and paralogs MIPF0001040 miRBase miRNA family (mir-1914) MIPF0001064 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1304, their precursors and their orthologs and paralogs MIPF0001064 miRBase miRNA family (mir-1304) MIPF0001065 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3158-2, hsa-mir-3158-1, their precursors and their orthologs and paralogs MIPF0001065 miRBase miRNA family (mir-3158) MIPF0001069 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1471, their precursors and their orthologs and paralogs MIPF0001069 miRBase miRNA family (mir-1471) MIPF0001102 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3150b, hsa-mir-3150, their precursors and their orthologs and paralogs MIPF0001102 miRBase miRNA family (mir-3150) MIPF0001103 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3074, their precursors and their orthologs and paralogs MIPF0001103 miRBase miRNA family (mir-3074) MIPF0001105 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3065, their precursors and their orthologs and paralogs MIPF0001105 miRBase miRNA family (mir-3065) MIPF0001118 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3926-2, hsa-mir-3926-1, their precursors and their orthologs and paralogs MIPF0001118 miRBase miRNA family (mir-3926) MIPF0001134 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3913-2, hsa-mir-3913-1, their precursors and their orthologs and paralogs MIPF0001134 miRBase miRNA family (mir-3913) MIPF0001144 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3689f, hsa-mir-3689e, hsa-mir-3689d-2, hsa-mir-3689d-1, hsa-mir-3689c, hsa-mir-3689b, hsa-mir-3689a, their precursors and their orthologs and paralogs MIPF0001144 miRBase miRNA family (mir-3689) MIPF0001148 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3910-2, hsa-mir-3910-1, their precursors and their orthologs and paralogs MIPF0001148 miRBase miRNA family (mir-3910) MIPF0001169 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3914-2, hsa-mir-3914-1, their precursors and their orthologs and paralogs MIPF0001169 miRBase miRNA family (mir-3914) MIPF0001179 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3622b, hsa-mir-3622a, their precursors and their orthologs and paralogs MIPF0001179 miRBase miRNA family (mir-3622) MIPF0001206 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1343, their precursors and their orthologs and paralogs MIPF0001206 miRBase miRNA family (mir-1343) MIPF0001207 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4509-3, hsa-mir-4509-2, hsa-mir-4509-1, their precursors and their orthologs and paralogs MIPF0001207 miRBase miRNA family (mir-4509) MIPF0001210 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4776-2, hsa-mir-4776-1, their precursors and their orthologs and paralogs MIPF0001210 miRBase miRNA family (mir-4776) MIPF0001216 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3198-2, hsa-mir-3198, their precursors and their orthologs and paralogs MIPF0001216 miRBase miRNA family (mir-3198) MIPF0001219 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3135b, hsa-mir-3135, their precursors and their orthologs and paralogs MIPF0001219 miRBase miRNA family (mir-3135) MIPF0001220 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4435-2, hsa-mir-4435-1, their precursors and their orthologs and paralogs MIPF0001220 miRBase miRNA family (mir-4435) MIPF0001228 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4679-2, hsa-mir-4679-1, their precursors and their orthologs and paralogs MIPF0001228 miRBase miRNA family (mir-4679) MIPF0001234 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4650-2, hsa-mir-4650-1, their precursors and their orthologs and paralogs MIPF0001234 miRBase miRNA family (mir-4650) MIPF0001236 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4436b-2, hsa-mir-4436b, hsa-mir-4436a, their precursors and their orthologs and paralogs MIPF0001236 miRBase miRNA family (mir-4436) MIPF0001238 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3064, their precursors and their orthologs and paralogs MIPF0001238 miRBase miRNA family (mir-3064) MIPF0001242 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3155b, hsa-mir-3155, their precursors and their orthologs and paralogs MIPF0001242 miRBase miRNA family (mir-3155) MIPF0001245 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4662b, hsa-mir-4662a, their precursors and their orthologs and paralogs MIPF0001245 miRBase miRNA family (mir-4662) MIPF0001250 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4773-2, hsa-mir-4773-1, their precursors and their orthologs and paralogs MIPF0001250 miRBase miRNA family (mir-4773) MIPF0001251 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3191, hsa-mir-3190, their precursors and their orthologs and paralogs MIPF0001251 miRBase miRNA family (mir-3190) MIPF0001256 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4659b, hsa-mir-4659a, their precursors and their orthologs and paralogs MIPF0001256 miRBase miRNA family (mir-4659) MIPF0001258 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4771-2, hsa-mir-4771-1, their precursors and their orthologs and paralogs MIPF0001258 miRBase miRNA family (mir-4771) MIPF0001261 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3529, their precursors and their orthologs and paralogs MIPF0001261 miRBase miRNA family (mir-3529) MIPF0001263 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3688-2, hsa-mir-3688, their precursors and their orthologs and paralogs MIPF0001263 miRBase miRNA family (mir-3688) MIPF0001271 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3960, their precursors and their orthologs and paralogs MIPF0001271 miRBase miRNA family (mir-3960) MIPF0001272 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4520b, hsa-mir-4520a, their precursors and their orthologs and paralogs MIPF0001272 miRBase miRNA family (mir-4520) MIPF0001274 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4477b, hsa-mir-4477a, their precursors and their orthologs and paralogs MIPF0001274 miRBase miRNA family (mir-4477) MIPF0001309 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1231, their precursors and their orthologs and paralogs MIPF0001309 miRBase miRNA family (mir-1231) MIPF0001310 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4444-2, hsa-mir-4444, their precursors and their orthologs and paralogs MIPF0001310 miRBase miRNA family (mir-4444) MIPF0001319 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4536-2, hsa-mir-4536, their precursors and their orthologs and paralogs MIPF0001319 miRBase miRNA family (mir-4536) MIPF0001325 An evolutionary conserved group of miRNA gene products including the human hsa-mir-5701-2, hsa-mir-5701-1, their precursors and their orthologs and paralogs MIPF0001325 miRBase miRNA family (mir-5701) MIPF0001330 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4524b, hsa-mir-4524, their precursors and their orthologs and paralogs MIPF0001330 miRBase miRNA family (mir-4524) MIPF0001338 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3680-2, hsa-mir-3680, their precursors and their orthologs and paralogs MIPF0001338 miRBase miRNA family (mir-3680) MIPF0001340 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3670-4, hsa-mir-3670-3, hsa-mir-3670-2, hsa-mir-3670, their precursors and their orthologs and paralogs MIPF0001340 miRBase miRNA family (mir-3670) MIPF0001343 An evolutionary conserved group of miRNA gene products including the human hsa-mir-5681b, hsa-mir-5681a, their precursors and their orthologs and paralogs MIPF0001343 miRBase miRNA family (mir-5681) MIPF0001351 An evolutionary conserved group of miRNA gene products including the human hsa-mir-5692a-2, hsa-mir-5692a-1, hsa-mir-5692c-2, hsa-mir-5692c-1, their precursors and their orthologs and paralogs MIPF0001351 miRBase miRNA family (mir-5692) MIPF0001356 An evolutionary conserved group of miRNA gene products including the human hsa-mir-5583-2, hsa-mir-5583-1, their precursors and their orthologs and paralogs MIPF0001356 miRBase miRNA family (mir-5583) MIPF0001381 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1260b, their precursors and their orthologs and paralogs MIPF0001381 miRBase miRNA family (mir-1260b) MIPF0001382 An evolutionary conserved group of miRNA gene products including the human hsa-mir-6511a-4, hsa-mir-6511a-3, hsa-mir-6511a-2, hsa-mir-6511b-2, hsa-mir-6511b-1, hsa-mir-6511a-1, their precursors and their orthologs and paralogs MIPF0001382 miRBase miRNA family (mir-6511) MIPF0001383 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3173, their precursors and their orthologs and paralogs MIPF0001383 miRBase miRNA family (mir-3173) MIPF0001384 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4743, their precursors and their orthologs and paralogs MIPF0001384 miRBase miRNA family (mir-4743) MIPF0001385 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4446, their precursors and their orthologs and paralogs MIPF0001385 miRBase miRNA family (mir-4446) MIPF0001387 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3154, their precursors and their orthologs and paralogs MIPF0001387 miRBase miRNA family (mir-3154) MIPF0001390 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4667, their precursors and their orthologs and paralogs MIPF0001390 miRBase miRNA family (mir-4667) MIPF0001394 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3151, their precursors and their orthologs and paralogs MIPF0001394 miRBase miRNA family (mir-3151) MIPF0001397 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3660, their precursors and their orthologs and paralogs MIPF0001397 miRBase miRNA family (mir-3660) MIPF0001399 An evolutionary conserved group of miRNA gene products including the human hsa-mir-2110, their precursors and their orthologs and paralogs MIPF0001399 miRBase miRNA family (mir-2110) MIPF0001400 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3943, their precursors and their orthologs and paralogs MIPF0001400 miRBase miRNA family (mir-3943) MIPF0001401 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3193, their precursors and their orthologs and paralogs MIPF0001401 miRBase miRNA family (mir-3193) MIPF0001402 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4796, their precursors and their orthologs and paralogs MIPF0001402 miRBase miRNA family (mir-4796) MIPF0001405 An evolutionary conserved group of miRNA gene products including the human hsa-mir-6127, their precursors and their orthologs and paralogs MIPF0001405 miRBase miRNA family (mir-6127) MIPF0001411 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3613, their precursors and their orthologs and paralogs MIPF0001411 miRBase miRNA family (mir-3613) MIPF0001412 An evolutionary conserved group of miRNA gene products including the human hsa-mir-6131, their precursors and their orthologs and paralogs MIPF0001412 miRBase miRNA family (mir-6131) MIPF0001413 An evolutionary conserved group of miRNA gene products including the human hsa-mir-6130, their precursors and their orthologs and paralogs MIPF0001413 miRBase miRNA family (mir-6130) MIPF0001415 An evolutionary conserved group of miRNA gene products including the human hsa-mir-6133, their precursors and their orthologs and paralogs MIPF0001415 miRBase miRNA family (mir-6133) MIPF0001417 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3121, their precursors and their orthologs and paralogs MIPF0001417 miRBase miRNA family (mir-3121) MIPF0001423 An evolutionary conserved group of miRNA gene products including the human hsa-mir-6129, their precursors and their orthologs and paralogs MIPF0001423 miRBase miRNA family (mir-6129) MIPF0001427 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3145, their precursors and their orthologs and paralogs MIPF0001427 miRBase miRNA family (mir-3145) MIPF0001428 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3138, their precursors and their orthologs and paralogs MIPF0001428 miRBase miRNA family (mir-3138) MIPF0001429 An evolutionary conserved group of miRNA gene products including the human hsa-mir-23c, their precursors and their orthologs and paralogs MIPF0001429 miRBase miRNA family (mir-23c) MIPF0001438 An evolutionary conserved group of miRNA gene products including the human hsa-mir-6132, their precursors and their orthologs and paralogs MIPF0001438 miRBase miRNA family (mir-6132) MIPF0001439 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3127, their precursors and their orthologs and paralogs MIPF0001439 miRBase miRNA family (mir-3127) MIPF0001440 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4484, their precursors and their orthologs and paralogs MIPF0001440 miRBase miRNA family (mir-4484) MIPF0001441 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3200, their precursors and their orthologs and paralogs MIPF0001441 miRBase miRNA family (mir-3200) MIPF0001442 An evolutionary conserved group of miRNA gene products including the human hsa-mir-6128, their precursors and their orthologs and paralogs MIPF0001442 miRBase miRNA family (mir-6128) MIPF0001445 An evolutionary conserved group of miRNA gene products including the human hsa-mir-6134, their precursors and their orthologs and paralogs MIPF0001445 miRBase miRNA family (mir-6134) MIPF0001451 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4529, their precursors and their orthologs and paralogs MIPF0001451 miRBase miRNA family (mir-4529) MIPF0001458 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3129, their precursors and their orthologs and paralogs MIPF0001458 miRBase miRNA family (mir-3129) MIPF0001460 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4660, their precursors and their orthologs and paralogs MIPF0001460 miRBase miRNA family (mir-4660) MIPF0001462 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3927, their precursors and their orthologs and paralogs MIPF0001462 miRBase miRNA family (mir-3927) MIPF0001463 An evolutionary conserved group of miRNA gene products including the human hsa-mir-378j, their precursors and their orthologs and paralogs MIPF0001463 miRBase miRNA family (mir-378_2) MIPF0001464 An evolutionary conserved group of miRNA gene products including the human hsa-mir-2114, their precursors and their orthologs and paralogs MIPF0001464 miRBase miRNA family (mir-2114) MIPF0001467 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4510, their precursors and their orthologs and paralogs MIPF0001467 miRBase miRNA family (mir-4510) MIPF0001474 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4429, their precursors and their orthologs and paralogs MIPF0001474 miRBase miRNA family (mir-4429) MIPF0001476 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4716, their precursors and their orthologs and paralogs MIPF0001476 miRBase miRNA family (mir-4716) MIPF0001477 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3617, their precursors and their orthologs and paralogs MIPF0001477 miRBase miRNA family (mir-3617) MIPF0001481 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1273c, their precursors and their orthologs and paralogs MIPF0001481 miRBase miRNA family (mir-1273c) MIPF0001488 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3188, their precursors and their orthologs and paralogs MIPF0001488 miRBase miRNA family (mir-3188) MIPF0001500 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3937, their precursors and their orthologs and paralogs MIPF0001500 miRBase miRNA family (mir-3937) MIPF0001506 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3117, their precursors and their orthologs and paralogs MIPF0001506 miRBase miRNA family (mir-3117) MIPF0001507 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4654, their precursors and their orthologs and paralogs MIPF0001507 miRBase miRNA family (mir-4654) MIPF0001508 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4504, their precursors and their orthologs and paralogs MIPF0001508 miRBase miRNA family (mir-4504) MIPF0001509 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3132, their precursors and their orthologs and paralogs MIPF0001509 miRBase miRNA family (mir-3132) MIPF0001510 An evolutionary conserved group of miRNA gene products including the human hsa-mir-6089-2, hsa-mir-6089-1, their precursors and their orthologs and paralogs MIPF0001510 miRBase miRNA family (mir-6089) MIPF0001511 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4803, their precursors and their orthologs and paralogs MIPF0001511 miRBase miRNA family (mir-4803) MIPF0001512 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4515, their precursors and their orthologs and paralogs MIPF0001512 miRBase miRNA family (mir-4515) MIPF0001518 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3664, their precursors and their orthologs and paralogs MIPF0001518 miRBase miRNA family (mir-3664) MIPF0001519 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3612, their precursors and their orthologs and paralogs MIPF0001519 miRBase miRNA family (mir-3612) MIPF0001520 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3938, their precursors and their orthologs and paralogs MIPF0001520 miRBase miRNA family (mir-3938) MIPF0001521 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4738, their precursors and their orthologs and paralogs MIPF0001521 miRBase miRNA family (mir-4738) MIPF0001522 An evolutionary conserved group of miRNA gene products including the human hsa-mir-2278, their precursors and their orthologs and paralogs MIPF0001522 miRBase miRNA family (mir-2278) MIPF0001525 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3126, their precursors and their orthologs and paralogs MIPF0001525 miRBase miRNA family (mir-3126) MIPF0001527 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3923, their precursors and their orthologs and paralogs MIPF0001527 miRBase miRNA family (mir-3923) MIPF0001529 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4791, their precursors and their orthologs and paralogs MIPF0001529 miRBase miRNA family (mir-4791) MIPF0001530 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3661, their precursors and their orthologs and paralogs MIPF0001530 miRBase miRNA family (mir-3661) MIPF0001540 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3615, their precursors and their orthologs and paralogs MIPF0001540 miRBase miRNA family (mir-3615) MIPF0001545 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4526, their precursors and their orthologs and paralogs MIPF0001545 miRBase miRNA family (mir-4526) MIPF0001546 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4782, their precursors and their orthologs and paralogs MIPF0001546 miRBase miRNA family (mir-4782) MIPF0001548 An evolutionary conserved group of miRNA gene products including the human hsa-mir-6500, hsa-mir-4421, their precursors and their orthologs and paralogs MIPF0001548 miRBase miRNA family (mir-4421) MIPF0001549 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3122, their precursors and their orthologs and paralogs MIPF0001549 miRBase miRNA family (mir-3122) MIPF0001551 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4672, their precursors and their orthologs and paralogs MIPF0001551 miRBase miRNA family (mir-4672) MIPF0001552 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4742, their precursors and their orthologs and paralogs MIPF0001552 miRBase miRNA family (mir-4742) MIPF0001555 An evolutionary conserved group of miRNA gene products including the human hsa-mir-629, their precursors and their orthologs and paralogs MIPF0001555 miRBase miRNA family (mir-629) MIPF0001566 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3607, their precursors and their orthologs and paralogs MIPF0001566 miRBase miRNA family (mir-3607) MIPF0001569 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3174, their precursors and their orthologs and paralogs MIPF0001569 miRBase miRNA family (mir-3174) MIPF0001573 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4788, their precursors and their orthologs and paralogs MIPF0001573 miRBase miRNA family (mir-4788) MIPF0001574 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4798, their precursors and their orthologs and paralogs MIPF0001574 miRBase miRNA family (mir-4798) MIPF0001575 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3136, their precursors and their orthologs and paralogs MIPF0001575 miRBase miRNA family (mir-3136) MIPF0001578 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4774, their precursors and their orthologs and paralogs MIPF0001578 miRBase miRNA family (mir-4774) MIPF0001582 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4451, their precursors and their orthologs and paralogs MIPF0001582 miRBase miRNA family (mir-4451) MIPF0001584 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3934, their precursors and their orthologs and paralogs MIPF0001584 miRBase miRNA family (mir-3934) MIPF0001586 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4637, their precursors and their orthologs and paralogs MIPF0001586 miRBase miRNA family (mir-4637) MIPF0001587 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4423, their precursors and their orthologs and paralogs MIPF0001587 miRBase miRNA family (mir-4423) MIPF0001597 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3192, their precursors and their orthologs and paralogs MIPF0001597 miRBase miRNA family (mir-3192) MIPF0001599 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3940, their precursors and their orthologs and paralogs MIPF0001599 miRBase miRNA family (mir-3940) MIPF0001601 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3912, their precursors and their orthologs and paralogs MIPF0001601 miRBase miRNA family (mir-3912) MIPF0001614 An evolutionary conserved group of miRNA gene products including the human hsa-mir-2392, their precursors and their orthologs and paralogs MIPF0001614 miRBase miRNA family (mir-2392) MIPF0001615 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3140, their precursors and their orthologs and paralogs MIPF0001615 miRBase miRNA family (mir-3140) MIPF0001618 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3690-2, hsa-mir-3690, their precursors and their orthologs and paralogs MIPF0001618 miRBase miRNA family (mir-3690) MIPF0001623 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4488, their precursors and their orthologs and paralogs MIPF0001623 miRBase miRNA family (mir-4488) MIPF0001626 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3146, their precursors and their orthologs and paralogs MIPF0001626 miRBase miRNA family (mir-3146) MIPF0001630 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4428, their precursors and their orthologs and paralogs MIPF0001630 miRBase miRNA family (mir-4428) MIPF0001633 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1976, their precursors and their orthologs and paralogs MIPF0001633 miRBase miRNA family (mir-1976) MIPF0001635 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3165, their precursors and their orthologs and paralogs MIPF0001635 miRBase miRNA family (mir-3165) MIPF0001637 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3170, their precursors and their orthologs and paralogs MIPF0001637 miRBase miRNA family (mir-3170) MIPF0001639 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3605, their precursors and their orthologs and paralogs MIPF0001639 miRBase miRNA family (mir-3605) MIPF0001640 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4427, their precursors and their orthologs and paralogs MIPF0001640 miRBase miRNA family (mir-4427) MIPF0001659 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1199, their precursors and their orthologs and paralogs MIPF0001659 miRBase miRNA family (mir-1199) MIPF0001672 An evolutionary conserved group of miRNA gene products including the human hsa-mir-6516, their precursors and their orthologs and paralogs MIPF0001672 miRBase miRNA family (mir-6516) MIPF0001692 An evolutionary conserved group of miRNA gene products including the human hsa-mir-6770-3, hsa-mir-6770-2, hsa-mir-6770-1, their precursors and their orthologs and paralogs MIPF0001692 miRBase miRNA family (mir-6770) MIPF0001693 An evolutionary conserved group of miRNA gene products including the human hsa-mir-7973-2, hsa-mir-7973-1, their precursors and their orthologs and paralogs MIPF0001693 miRBase miRNA family (mir-7973) MIPF0001698 An evolutionary conserved group of miRNA gene products including the human hsa-mir-6859-4, hsa-mir-6859-3, hsa-mir-6859-2, hsa-mir-6859-1, their precursors and their orthologs and paralogs MIPF0001698 miRBase miRNA family (mir-6859) MIPF0001708 An evolutionary conserved group of miRNA gene products including the human hsa-mir-6715a, their precursors and their orthologs and paralogs MIPF0001708 miRBase miRNA family (mir-6715) MIPF0001710 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3618, their precursors and their orthologs and paralogs MIPF0001710 miRBase miRNA family (mir-3618) MIPF0001726 An evolutionary conserved group of miRNA gene products including the human hsa-mir-6794, their precursors and their orthologs and paralogs MIPF0001726 miRBase miRNA family (mir-6794) MIPF0001747 An evolutionary conserved group of miRNA gene products including the human hsa-mir-6827, their precursors and their orthologs and paralogs MIPF0001747 miRBase miRNA family (mir-6827) MIPF0001748 An evolutionary conserved group of miRNA gene products including the human hsa-mir-5697, their precursors and their orthologs and paralogs MIPF0001748 miRBase miRNA family (mir-5697) MIPF0001759 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4703, their precursors and their orthologs and paralogs MIPF0001759 miRBase miRNA family (mir-4703) MIPF0001764 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4766, their precursors and their orthologs and paralogs MIPF0001764 miRBase miRNA family (mir-4766) MIPF0001787 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1911, their precursors and their orthologs and paralogs MIPF0001787 miRBase miRNA family (mir-1911) MIPF0001799 An evolutionary conserved group of miRNA gene products including the human hsa-mir-8071-2, hsa-mir-8071-1, their precursors and their orthologs and paralogs MIPF0001799 miRBase miRNA family (mir-8071) MIPF0001805 An evolutionary conserved group of miRNA gene products including the human hsa-mir-6505, their precursors and their orthologs and paralogs MIPF0001805 miRBase miRNA family (mir-6505) MIPF0001811 An evolutionary conserved group of miRNA gene products including the human hsa-mir-6790, their precursors and their orthologs and paralogs MIPF0001811 miRBase miRNA family (mir-6790) MIPF0001821 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1243, their precursors and their orthologs and paralogs MIPF0001821 miRBase miRNA family (mir-1243) MIPF0001823 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3167, their precursors and their orthologs and paralogs MIPF0001823 miRBase miRNA family (mir-3167) MIPF0001825 An evolutionary conserved group of miRNA gene products including the human hsa-mir-7641-2, hsa-mir-7641-1, their precursors and their orthologs and paralogs MIPF0001825 miRBase miRNA family (mir-7641) MIPF0001826 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4433b, hsa-mir-4433, their precursors and their orthologs and paralogs MIPF0001826 miRBase miRNA family (mir-4433) MIPF0001848 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4677, their precursors and their orthologs and paralogs MIPF0001848 miRBase miRNA family (mir-4677) MIPF0001855 An evolutionary conserved group of miRNA gene products including the human hsa-mir-6862-2, hsa-mir-6862-1, their precursors and their orthologs and paralogs MIPF0001855 miRBase miRNA family (mir-6862) MIPF0001920 An evolutionary conserved group of miRNA gene products including the human hsa-mir-6724-4, hsa-mir-6724-3, hsa-mir-6724-2, hsa-mir-6724, their precursors and their orthologs and paralogs MIPF0001920 miRBase miRNA family (mir-6724) MIPF0001928 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3118-3, hsa-mir-3118-2, hsa-mir-3118-1, their precursors and their orthologs and paralogs MIPF0001928 miRBase miRNA family (mir-3118) MIPF0001935 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3149, their precursors and their orthologs and paralogs MIPF0001935 miRBase miRNA family (mir-3149) MIPF0001937 An evolutionary conserved group of miRNA gene products including the human hsa-mir-1277, their precursors and their orthologs and paralogs MIPF0001937 miRBase miRNA family (mir-1277) MIPF0001984 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3648-2, hsa-mir-3648, their precursors and their orthologs and paralogs MIPF0001984 miRBase miRNA family (mir-3648) MIPF0001988 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4680, their precursors and their orthologs and paralogs MIPF0001988 miRBase miRNA family (mir-4680) MIPF0002009 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4657, their precursors and their orthologs and paralogs MIPF0002009 miRBase miRNA family (mir-4657) MIPF0002050 An evolutionary conserved group of miRNA gene products including the human hsa-mir-8069-2, hsa-mir-8069, their precursors and their orthologs and paralogs MIPF0002050 miRBase miRNA family (mir-8069) MIPF0002051 An evolutionary conserved group of miRNA gene products including the human hsa-mir-3687-2, hsa-mir-3687, their precursors and their orthologs and paralogs MIPF0002051 miRBase miRNA family (mir-3687) MIPF0002103 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4449, their precursors and their orthologs and paralogs MIPF0002103 miRBase miRNA family (mir-4449) MIPF0002104 An evolutionary conserved group of miRNA gene products including the human hsa-mir-4523, their precursors and their orthologs and paralogs MIPF0002104 miRBase miRNA family (mir-4523) BFO:0000001 entity Entity Julius Caesar Verdi’s Requiem the Second World War your body mass index BFO 2 Reference: In all areas of empirical inquiry we encounter general terms of two sorts. First are general terms which refer to universals or types:animaltuberculosissurgical procedurediseaseSecond, are general terms used to refer to groups of entities which instantiate a given universal but do not correspond to the extension of any subuniversal of that universal because there is nothing intrinsic to the entities in question by virtue of which they – and only they – are counted as belonging to the given group. Examples are: animal purchased by the Emperortuberculosis diagnosed on a Wednesdaysurgical procedure performed on a patient from Stockholmperson identified as candidate for clinical trial #2056-555person who is signatory of Form 656-PPVpainting by Leonardo da VinciSuch terms, which represent what are called ‘specializations’ in [81 Entity doesn't have a closure axiom because the subclasses don't necessarily exhaust all possibilites. For example Werner Ceusters 'portions of reality' include 4 sorts, entities (as BFO construes them), universals, configurations, and relations. It is an open question as to whether entities as construed in BFO will at some point also include these other portions of reality. See, for example, 'How to track absolutely everything' at http://www.referent-tracking.com/_RTU/papers/CeustersICbookRevised.pdf An entity is anything that exists or has existed or will exist. (axiom label in BFO2 Reference: [001-001]) entity Entity doesn't have a closure axiom because the subclasses don't necessarily exhaust all possibilites. For example Werner Ceusters 'portions of reality' include 4 sorts, entities (as BFO construes them), universals, configurations, and relations. It is an open question as to whether entities as construed in BFO will at some point also include these other portions of reality. See, for example, 'How to track absolutely everything' at http://www.referent-tracking.com/_RTU/papers/CeustersICbookRevised.pdf per discussion with Barry Smith An entity is anything that exists or has existed or will exist. (axiom label in BFO2 Reference: [001-001]) BFO:0000002 continuant Continuant BFO 2 Reference: Continuant entities are entities which can be sliced to yield parts only along the spatial dimension, yielding for example the parts of your table which we call its legs, its top, its nails. ‘My desk stretches from the window to the door. It has spatial parts, and can be sliced (in space) in two. With respect to time, however, a thing is a continuant.’ [60, p. 240 Continuant doesn't have a closure axiom because the subclasses don't necessarily exhaust all possibilites. For example, in an expansion involving bringing in some of Ceuster's other portions of reality, questions are raised as to whether universals are continuants A continuant is an entity that persists, endures, or continues to exist through time while maintaining its identity. (axiom label in BFO2 Reference: [008-002]) if b is a continuant and if, for some t, c has_continuant_part b at t, then c is a continuant. (axiom label in BFO2 Reference: [126-001]) if b is a continuant and if, for some t, cis continuant_part of b at t, then c is a continuant. (axiom label in BFO2 Reference: [009-002]) if b is a material entity, then there is some temporal interval (referred to below as a one-dimensional temporal region) during which b exists. (axiom label in BFO2 Reference: [011-002]) (forall (x y) (if (and (Continuant x) (exists (t) (continuantPartOfAt y x t))) (Continuant y))) // axiom label in BFO2 CLIF: [009-002] (forall (x y) (if (and (Continuant x) (exists (t) (hasContinuantPartOfAt y x t))) (Continuant y))) // axiom label in BFO2 CLIF: [126-001] (forall (x) (if (Continuant x) (Entity x))) // axiom label in BFO2 CLIF: [008-002] (forall (x) (if (Material Entity x) (exists (t) (and (TemporalRegion t) (existsAt x t))))) // axiom label in BFO2 CLIF: [011-002] continuant Continuant doesn't have a closure axiom because the subclasses don't necessarily exhaust all possibilites. For example, in an expansion involving bringing in some of Ceuster's other portions of reality, questions are raised as to whether universals are continuants A continuant is an entity that persists, endures, or continues to exist through time while maintaining its identity. (axiom label in BFO2 Reference: [008-002]) if b is a continuant and if, for some t, c has_continuant_part b at t, then c is a continuant. (axiom label in BFO2 Reference: [126-001]) if b is a continuant and if, for some t, cis continuant_part of b at t, then c is a continuant. (axiom label in BFO2 Reference: [009-002]) if b is a material entity, then there is some temporal interval (referred to below as a one-dimensional temporal region) during which b exists. (axiom label in BFO2 Reference: [011-002]) (forall (x y) (if (and (Continuant x) (exists (t) (continuantPartOfAt y x t))) (Continuant y))) // axiom label in BFO2 CLIF: [009-002] (forall (x y) (if (and (Continuant x) (exists (t) (hasContinuantPartOfAt y x t))) (Continuant y))) // axiom label in BFO2 CLIF: [126-001] (forall (x) (if (Continuant x) (Entity x))) // axiom label in BFO2 CLIF: [008-002] (forall (x) (if (Material Entity x) (exists (t) (and (TemporalRegion t) (existsAt x t))))) // axiom label in BFO2 CLIF: [011-002] BFO:0000003 occurrent Occurrent BFO 2 Reference: every occurrent that is not a temporal or spatiotemporal region is s-dependent on some independent continuant that is not a spatial region BFO 2 Reference: s-dependence obtains between every process and its participants in the sense that, as a matter of necessity, this process could not have existed unless these or those participants existed also. A process may have a succession of participants at different phases of its unfolding. Thus there may be different players on the field at different times during the course of a football game; but the process which is the entire game s-depends_on all of these players nonetheless. Some temporal parts of this process will s-depend_on on only some of the players. Occurrent doesn't have a closure axiom because the subclasses don't necessarily exhaust all possibilites. An example would be the sum of a process and the process boundary of another process. Simons uses different terminology for relations of occurrents to regions: Denote the spatio-temporal location of a given occurrent e by 'spn[e]' and call this region its span. We may say an occurrent is at its span, in any larger region, and covers any smaller region. Now suppose we have fixed a frame of reference so that we can speak not merely of spatio-temporal but also of spatial regions (places) and temporal regions (times). The spread of an occurrent, (relative to a frame of reference) is the space it exactly occupies, and its spell is likewise the time it exactly occupies. We write 'spr[e]' and `spl[e]' respectively for the spread and spell of e, omitting mention of the frame. An occurrent is an entity that unfolds itself in time or it is the instantaneous boundary of such an entity (for example a beginning or an ending) or it is a temporal or spatiotemporal region which such an entity occupies_temporal_region or occupies_spatiotemporal_region. (axiom label in BFO2 Reference: [077-002]) Every occurrent occupies_spatiotemporal_region some spatiotemporal region. (axiom label in BFO2 Reference: [108-001]) b is an occurrent entity iff b is an entity that has temporal parts. (axiom label in BFO2 Reference: [079-001]) (forall (x) (if (Occurrent x) (exists (r) (and (SpatioTemporalRegion r) (occupiesSpatioTemporalRegion x r))))) // axiom label in BFO2 CLIF: [108-001] (forall (x) (iff (Occurrent x) (and (Entity x) (exists (y) (temporalPartOf y x))))) // axiom label in BFO2 CLIF: [079-001] occurrent Occurrent doesn't have a closure axiom because the subclasses don't necessarily exhaust all possibilites. An example would be the sum of a process and the process boundary of another process. per discussion with Barry Smith Simons uses different terminology for relations of occurrents to regions: Denote the spatio-temporal location of a given occurrent e by 'spn[e]' and call this region its span. We may say an occurrent is at its span, in any larger region, and covers any smaller region. Now suppose we have fixed a frame of reference so that we can speak not merely of spatio-temporal but also of spatial regions (places) and temporal regions (times). The spread of an occurrent, (relative to a frame of reference) is the space it exactly occupies, and its spell is likewise the time it exactly occupies. We write 'spr[e]' and `spl[e]' respectively for the spread and spell of e, omitting mention of the frame. An occurrent is an entity that unfolds itself in time or it is the instantaneous boundary of such an entity (for example a beginning or an ending) or it is a temporal or spatiotemporal region which such an entity occupies_temporal_region or occupies_spatiotemporal_region. (axiom label in BFO2 Reference: [077-002]) Every occurrent occupies_spatiotemporal_region some spatiotemporal region. (axiom label in BFO2 Reference: [108-001]) b is an occurrent entity iff b is an entity that has temporal parts. (axiom label in BFO2 Reference: [079-001]) (forall (x) (if (Occurrent x) (exists (r) (and (SpatioTemporalRegion r) (occupiesSpatioTemporalRegion x r))))) // axiom label in BFO2 CLIF: [108-001] (forall (x) (iff (Occurrent x) (and (Entity x) (exists (y) (temporalPartOf y x))))) // axiom label in BFO2 CLIF: [079-001] BFO:0000004 ic IndependentContinuant a chair a heart a leg a molecule a spatial region an atom an orchestra. an organism the bottom right portion of a human torso the interior of your mouth b is an independent continuant = Def. b is a continuant which is such that there is no c and no t such that b s-depends_on c at t. (axiom label in BFO2 Reference: [017-002]) For any independent continuant b and any time t there is some spatial region r such that b is located_in r at t. (axiom label in BFO2 Reference: [134-001]) For every independent continuant b and time t during the region of time spanned by its life, there are entities which s-depends_on b during t. (axiom label in BFO2 Reference: [018-002]) (forall (x t) (if (IndependentContinuant x) (exists (r) (and (SpatialRegion r) (locatedInAt x r t))))) // axiom label in BFO2 CLIF: [134-001] (forall (x t) (if (and (IndependentContinuant x) (existsAt x t)) (exists (y) (and (Entity y) (specificallyDependsOnAt y x t))))) // axiom label in BFO2 CLIF: [018-002] (iff (IndependentContinuant a) (and (Continuant a) (not (exists (b t) (specificallyDependsOnAt a b t))))) // axiom label in BFO2 CLIF: [017-002] independent continuant b is an independent continuant = Def. b is a continuant which is such that there is no c and no t such that b s-depends_on c at t. (axiom label in BFO2 Reference: [017-002]) For any independent continuant b and any time t there is some spatial region r such that b is located_in r at t. (axiom label in BFO2 Reference: [134-001]) For every independent continuant b and time t during the region of time spanned by its life, there are entities which s-depends_on b during t. (axiom label in BFO2 Reference: [018-002]) (forall (x t) (if (IndependentContinuant x) (exists (r) (and (SpatialRegion r) (locatedInAt x r t))))) // axiom label in BFO2 CLIF: [134-001] (forall (x t) (if (and (IndependentContinuant x) (existsAt x t)) (exists (y) (and (Entity y) (specificallyDependsOnAt y x t))))) // axiom label in BFO2 CLIF: [018-002] (iff (IndependentContinuant a) (and (Continuant a) (not (exists (b t) (specificallyDependsOnAt a b t))))) // axiom label in BFO2 CLIF: [017-002] BFO:0000006 s-region SpatialRegion BFO 2 Reference: Spatial regions do not participate in processes. Spatial region doesn't have a closure axiom because the subclasses don't exhaust all possibilites. An example would be the union of a spatial point and a spatial line that doesn't overlap the point, or two spatial lines that intersect at a single point. In both cases the resultant spatial region is neither 0-dimensional, 1-dimensional, 2-dimensional, or 3-dimensional. A spatial region is a continuant entity that is a continuant_part_of spaceR as defined relative to some frame R. (axiom label in BFO2 Reference: [035-001]) All continuant parts of spatial regions are spatial regions. (axiom label in BFO2 Reference: [036-001]) (forall (x y t) (if (and (SpatialRegion x) (continuantPartOfAt y x t)) (SpatialRegion y))) // axiom label in BFO2 CLIF: [036-001] (forall (x) (if (SpatialRegion x) (Continuant x))) // axiom label in BFO2 CLIF: [035-001] spatial region Spatial region doesn't have a closure axiom because the subclasses don't exhaust all possibilites. An example would be the union of a spatial point and a spatial line that doesn't overlap the point, or two spatial lines that intersect at a single point. In both cases the resultant spatial region is neither 0-dimensional, 1-dimensional, 2-dimensional, or 3-dimensional. per discussion with Barry Smith A spatial region is a continuant entity that is a continuant_part_of spaceR as defined relative to some frame R. (axiom label in BFO2 Reference: [035-001]) All continuant parts of spatial regions are spatial regions. (axiom label in BFO2 Reference: [036-001]) (forall (x y t) (if (and (SpatialRegion x) (continuantPartOfAt y x t)) (SpatialRegion y))) // axiom label in BFO2 CLIF: [036-001] (forall (x) (if (SpatialRegion x) (Continuant x))) // axiom label in BFO2 CLIF: [035-001] BFO:0000008 t-region TemporalRegion Temporal region doesn't have a closure axiom because the subclasses don't exhaust all possibilites. An example would be the mereological sum of a temporal instant and a temporal interval that doesn't overlap the instant. In this case the resultant temporal region is neither 0-dimensional nor 1-dimensional A temporal region is an occurrent entity that is part of time as defined relative to some reference frame. (axiom label in BFO2 Reference: [100-001]) All parts of temporal regions are temporal regions. (axiom label in BFO2 Reference: [101-001]) Every temporal region t is such that t occupies_temporal_region t. (axiom label in BFO2 Reference: [119-002]) (forall (r) (if (TemporalRegion r) (occupiesTemporalRegion r r))) // axiom label in BFO2 CLIF: [119-002] (forall (x y) (if (and (TemporalRegion x) (occurrentPartOf y x)) (TemporalRegion y))) // axiom label in BFO2 CLIF: [101-001] (forall (x) (if (TemporalRegion x) (Occurrent x))) // axiom label in BFO2 CLIF: [100-001] temporal region Temporal region doesn't have a closure axiom because the subclasses don't exhaust all possibilites. An example would be the mereological sum of a temporal instant and a temporal interval that doesn't overlap the instant. In this case the resultant temporal region is neither 0-dimensional nor 1-dimensional per discussion with Barry Smith A temporal region is an occurrent entity that is part of time as defined relative to some reference frame. (axiom label in BFO2 Reference: [100-001]) All parts of temporal regions are temporal regions. (axiom label in BFO2 Reference: [101-001]) Every temporal region t is such that t occupies_temporal_region t. (axiom label in BFO2 Reference: [119-002]) (forall (r) (if (TemporalRegion r) (occupiesTemporalRegion r r))) // axiom label in BFO2 CLIF: [119-002] (forall (x y) (if (and (TemporalRegion x) (occurrentPartOf y x)) (TemporalRegion y))) // axiom label in BFO2 CLIF: [101-001] (forall (x) (if (TemporalRegion x) (Occurrent x))) // axiom label in BFO2 CLIF: [100-001] BFO:0000009 2d-s-region TwoDimensionalSpatialRegion an infinitely thin plane in space. the surface of a sphere-shaped part of space A two-dimensional spatial region is a spatial region that is of two dimensions. (axiom label in BFO2 Reference: [039-001]) (forall (x) (if (TwoDimensionalSpatialRegion x) (SpatialRegion x))) // axiom label in BFO2 CLIF: [039-001] two-dimensional spatial region A two-dimensional spatial region is a spatial region that is of two dimensions. (axiom label in BFO2 Reference: [039-001]) (forall (x) (if (TwoDimensionalSpatialRegion x) (SpatialRegion x))) // axiom label in BFO2 CLIF: [039-001] BFO:0000011 st-region SpatiotemporalRegion the spatiotemporal region occupied by a human life the spatiotemporal region occupied by a process of cellular meiosis. the spatiotemporal region occupied by the development of a cancer tumor A spatiotemporal region is an occurrent entity that is part of spacetime. (axiom label in BFO2 Reference: [095-001]) All parts of spatiotemporal regions are spatiotemporal regions. (axiom label in BFO2 Reference: [096-001]) Each spatiotemporal region at any time t projects_onto some spatial region at t. (axiom label in BFO2 Reference: [099-001]) Each spatiotemporal region projects_onto some temporal region. (axiom label in BFO2 Reference: [098-001]) Every spatiotemporal region occupies_spatiotemporal_region itself. Every spatiotemporal region s is such that s occupies_spatiotemporal_region s. (axiom label in BFO2 Reference: [107-002]) (forall (r) (if (SpatioTemporalRegion r) (occupiesSpatioTemporalRegion r r))) // axiom label in BFO2 CLIF: [107-002] (forall (x t) (if (SpatioTemporalRegion x) (exists (y) (and (SpatialRegion y) (spatiallyProjectsOntoAt x y t))))) // axiom label in BFO2 CLIF: [099-001] (forall (x y) (if (and (SpatioTemporalRegion x) (occurrentPartOf y x)) (SpatioTemporalRegion y))) // axiom label in BFO2 CLIF: [096-001] (forall (x) (if (SpatioTemporalRegion x) (Occurrent x))) // axiom label in BFO2 CLIF: [095-001] (forall (x) (if (SpatioTemporalRegion x) (exists (y) (and (TemporalRegion y) (temporallyProjectsOnto x y))))) // axiom label in BFO2 CLIF: [098-001] spatiotemporal region A spatiotemporal region is an occurrent entity that is part of spacetime. (axiom label in BFO2 Reference: [095-001]) All parts of spatiotemporal regions are spatiotemporal regions. (axiom label in BFO2 Reference: [096-001]) Each spatiotemporal region at any time t projects_onto some spatial region at t. (axiom label in BFO2 Reference: [099-001]) Each spatiotemporal region projects_onto some temporal region. (axiom label in BFO2 Reference: [098-001]) Every spatiotemporal region s is such that s occupies_spatiotemporal_region s. (axiom label in BFO2 Reference: [107-002]) (forall (r) (if (SpatioTemporalRegion r) (occupiesSpatioTemporalRegion r r))) // axiom label in BFO2 CLIF: [107-002] (forall (x t) (if (SpatioTemporalRegion x) (exists (y) (and (SpatialRegion y) (spatiallyProjectsOntoAt x y t))))) // axiom label in BFO2 CLIF: [099-001] (forall (x y) (if (and (SpatioTemporalRegion x) (occurrentPartOf y x)) (SpatioTemporalRegion y))) // axiom label in BFO2 CLIF: [096-001] (forall (x) (if (SpatioTemporalRegion x) (Occurrent x))) // axiom label in BFO2 CLIF: [095-001] (forall (x) (if (SpatioTemporalRegion x) (exists (y) (and (TemporalRegion y) (temporallyProjectsOnto x y))))) // axiom label in BFO2 CLIF: [098-001] BFO:0000015 process Process a process of cell-division, \ a beating of the heart a process of meiosis a process of sleeping the course of a disease the flight of a bird the life of an organism your process of aging. p is a process = Def. p is an occurrent that has temporal proper parts and for some time t, p s-depends_on some material entity at t. (axiom label in BFO2 Reference: [083-003]) BFO 2 Reference: The realm of occurrents is less pervasively marked by the presence of natural units than is the case in the realm of independent continuants. Thus there is here no counterpart of ‘object’. In BFO 1.0 ‘process’ served as such a counterpart. In BFO 2.0 ‘process’ is, rather, the occurrent counterpart of ‘material entity’. Those natural – as contrasted with engineered, which here means: deliberately executed – units which do exist in the realm of occurrents are typically either parasitic on the existence of natural units on the continuant side, or they are fiat in nature. Thus we can count lives; we can count football games; we can count chemical reactions performed in experiments or in chemical manufacturing. We cannot count the processes taking place, for instance, in an episode of insect mating behavior.Even where natural units are identifiable, for example cycles in a cyclical process such as the beating of a heart or an organism’s sleep/wake cycle, the processes in question form a sequence with no discontinuities (temporal gaps) of the sort that we find for instance where billiard balls or zebrafish or planets are separated by clear spatial gaps. Lives of organisms are process units, but they too unfold in a continuous series from other, prior processes such as fertilization, and they unfold in turn in continuous series of post-life processes such as post-mortem decay. Clear examples of boundaries of processes are almost always of the fiat sort (midnight, a time of death as declared in an operating theater or on a death certificate, the initiation of a state of war) (iff (Process a) (and (Occurrent a) (exists (b) (properTemporalPartOf b a)) (exists (c t) (and (MaterialEntity c) (specificallyDependsOnAt a c t))))) // axiom label in BFO2 CLIF: [083-003] process p is a process = Def. p is an occurrent that has temporal proper parts and for some time t, p s-depends_on some material entity at t. (axiom label in BFO2 Reference: [083-003]) (iff (Process a) (and (Occurrent a) (exists (b) (properTemporalPartOf b a)) (exists (c t) (and (MaterialEntity c) (specificallyDependsOnAt a c t))))) // axiom label in BFO2 CLIF: [083-003] BFO:0000016 disposition Disposition an atom of element X has the disposition to decay to an atom of element Y certain people have a predisposition to colon cancer children are innately disposed to categorize objects in certain ways. the cell wall is disposed to filter chemicals in endocytosis and exocytosis BFO 2 Reference: Dispositions exist along a strength continuum. Weaker forms of disposition are realized in only a fraction of triggering cases. These forms occur in a significant number of cases of a similar type. b is a disposition means: b is a realizable entity & b’s bearer is some material entity & b is such that if it ceases to exist, then its bearer is physically changed, & b’s realization occurs when and because this bearer is in some special physical circumstances, & this realization occurs in virtue of the bearer’s physical make-up. (axiom label in BFO2 Reference: [062-002]) If b is a realizable entity then for all t at which b exists, b s-depends_on some material entity at t. (axiom label in BFO2 Reference: [063-002]) (forall (x t) (if (and (RealizableEntity x) (existsAt x t)) (exists (y) (and (MaterialEntity y) (specificallyDepends x y t))))) // axiom label in BFO2 CLIF: [063-002] (forall (x) (if (Disposition x) (and (RealizableEntity x) (exists (y) (and (MaterialEntity y) (bearerOfAt x y t)))))) // axiom label in BFO2 CLIF: [062-002] disposition b is a disposition means: b is a realizable entity & b’s bearer is some material entity & b is such that if it ceases to exist, then its bearer is physically changed, & b’s realization occurs when and because this bearer is in some special physical circumstances, & this realization occurs in virtue of the bearer’s physical make-up. (axiom label in BFO2 Reference: [062-002]) If b is a realizable entity then for all t at which b exists, b s-depends_on some material entity at t. (axiom label in BFO2 Reference: [063-002]) (forall (x t) (if (and (RealizableEntity x) (existsAt x t)) (exists (y) (and (MaterialEntity y) (specificallyDepends x y t))))) // axiom label in BFO2 CLIF: [063-002] (forall (x) (if (Disposition x) (and (RealizableEntity x) (exists (y) (and (MaterialEntity y) (bearerOfAt x y t)))))) // axiom label in BFO2 CLIF: [062-002] BFO:0000017 realizable RealizableEntity the disposition of this piece of metal to conduct electricity. the disposition of your blood to coagulate the function of your reproductive organs the role of being a doctor the role of this boundary to delineate where Utah and Colorado meet To say that b is a realizable entity is to say that b is a specifically dependent continuant that inheres in some independent continuant which is not a spatial region and is of a type instances of which are realized in processes of a correlated type. (axiom label in BFO2 Reference: [058-002]) All realizable dependent continuants have independent continuants that are not spatial regions as their bearers. (axiom label in BFO2 Reference: [060-002]) (forall (x t) (if (RealizableEntity x) (exists (y) (and (IndependentContinuant y) (not (SpatialRegion y)) (bearerOfAt y x t))))) // axiom label in BFO2 CLIF: [060-002] (forall (x) (if (RealizableEntity x) (and (SpecificallyDependentContinuant x) (exists (y) (and (IndependentContinuant y) (not (SpatialRegion y)) (inheresIn x y)))))) // axiom label in BFO2 CLIF: [058-002] realizable entity To say that b is a realizable entity is to say that b is a specifically dependent continuant that inheres in some independent continuant which is not a spatial region and is of a type instances of which are realized in processes of a correlated type. (axiom label in BFO2 Reference: [058-002]) All realizable dependent continuants have independent continuants that are not spatial regions as their bearers. (axiom label in BFO2 Reference: [060-002]) (forall (x t) (if (RealizableEntity x) (exists (y) (and (IndependentContinuant y) (not (SpatialRegion y)) (bearerOfAt y x t))))) // axiom label in BFO2 CLIF: [060-002] (forall (x) (if (RealizableEntity x) (and (SpecificallyDependentContinuant x) (exists (y) (and (IndependentContinuant y) (not (SpatialRegion y)) (inheresIn x y)))))) // axiom label in BFO2 CLIF: [058-002] BFO:0000018 0d-s-region ZeroDimensionalSpatialRegion A zero-dimensional spatial region is a point in space. (axiom label in BFO2 Reference: [037-001]) (forall (x) (if (ZeroDimensionalSpatialRegion x) (SpatialRegion x))) // axiom label in BFO2 CLIF: [037-001] zero-dimensional spatial region A zero-dimensional spatial region is a point in space. (axiom label in BFO2 Reference: [037-001]) (forall (x) (if (ZeroDimensionalSpatialRegion x) (SpatialRegion x))) // axiom label in BFO2 CLIF: [037-001] BFO:0000019 quality Quality the ambient temperature of this portion of air the color of a tomato the length of the circumference of your waist the mass of this piece of gold. the shape of your nose the shape of your nostril a quality is a specifically dependent continuant that, in contrast to roles and dispositions, does not require any further process in order to be realized. (axiom label in BFO2 Reference: [055-001]) If an entity is a quality at any time that it exists, then it is a quality at every time that it exists. (axiom label in BFO2 Reference: [105-001]) (forall (x) (if (Quality x) (SpecificallyDependentContinuant x))) // axiom label in BFO2 CLIF: [055-001] (forall (x) (if (exists (t) (and (existsAt x t) (Quality x))) (forall (t_1) (if (existsAt x t_1) (Quality x))))) // axiom label in BFO2 CLIF: [105-001] quality a quality is a specifically dependent continuant that, in contrast to roles and dispositions, does not require any further process in order to be realized. (axiom label in BFO2 Reference: [055-001]) If an entity is a quality at any time that it exists, then it is a quality at every time that it exists. (axiom label in BFO2 Reference: [105-001]) (forall (x) (if (Quality x) (SpecificallyDependentContinuant x))) // axiom label in BFO2 CLIF: [055-001] (forall (x) (if (exists (t) (and (existsAt x t) (Quality x))) (forall (t_1) (if (existsAt x t_1) (Quality x))))) // axiom label in BFO2 CLIF: [105-001] BFO:0000020 sdc SpecificallyDependentContinuant Reciprocal specifically dependent continuants: the function of this key to open this lock and the mutually dependent disposition of this lock: to be opened by this key of one-sided specifically dependent continuants: the mass of this tomato of relational dependent continuants (multiple bearers): John’s love for Mary, the ownership relation between John and this statue, the relation of authority between John and his subordinates. the disposition of this fish to decay the function of this heart: to pump blood the mutual dependence of proton donors and acceptors in chemical reactions [79 the mutual dependence of the role predator and the role prey as played by two organisms in a given interaction the pink color of a medium rare piece of grilled filet mignon at its center the role of being a doctor the shape of this hole. the smell of this portion of mozzarella b is a specifically dependent continuant = Def. b is a continuant & there is some independent continuant c which is not a spatial region and which is such that b s-depends_on c at every time t during the course of b’s existence. (axiom label in BFO2 Reference: [050-003]) Specifically dependent continuant doesn't have a closure axiom because the subclasses don't necessarily exhaust all possibilites. We're not sure what else will develop here, but for example there are questions such as what are promises, obligation, etc. (iff (SpecificallyDependentContinuant a) (and (Continuant a) (forall (t) (if (existsAt a t) (exists (b) (and (IndependentContinuant b) (not (SpatialRegion b)) (specificallyDependsOnAt a b t))))))) // axiom label in BFO2 CLIF: [050-003] specifically dependent continuant b is a specifically dependent continuant = Def. b is a continuant & there is some independent continuant c which is not a spatial region and which is such that b s-depends_on c at every time t during the course of b’s existence. (axiom label in BFO2 Reference: [050-003]) Specifically dependent continuant doesn't have a closure axiom because the subclasses don't necessarily exhaust all possibilites. We're not sure what else will develop here, but for example there are questions such as what are promises, obligation, etc. per discussion with Barry Smith (iff (SpecificallyDependentContinuant a) (and (Continuant a) (forall (t) (if (existsAt a t) (exists (b) (and (IndependentContinuant b) (not (SpatialRegion b)) (specificallyDependsOnAt a b t))))))) // axiom label in BFO2 CLIF: [050-003] BFO:0000023 role Role John’s role of husband to Mary is dependent on Mary’s role of wife to John, and both are dependent on the object aggregate comprising John and Mary as member parts joined together through the relational quality of being married. the priest role the role of a boundary to demarcate two neighboring administrative territories the role of a building in serving as a military target the role of a stone in marking a property boundary the role of subject in a clinical trial the student role BFO 2 Reference: One major family of examples of non-rigid universals involves roles, and ontologies developed for corresponding administrative purposes may consist entirely of representatives of entities of this sort. Thus ‘professor’, defined as follows,b instance_of professor at t =Def. there is some c, c instance_of professor role & c inheres_in b at t.denotes a non-rigid universal and so also do ‘nurse’, ‘student’, ‘colonel’, ‘taxpayer’, and so forth. (These terms are all, in the jargon of philosophy, phase sortals.) By using role terms in definitions, we can create a BFO conformant treatment of such entities drawing on the fact that, while an instance of professor may be simultaneously an instance of trade union member, no instance of the type professor role is also (at any time) an instance of the type trade union member role (any more than any instance of the type color is at any time an instance of the type length).If an ontology of employment positions should be defined in terms of roles following the above pattern, this enables the ontology to do justice to the fact that individuals instantiate the corresponding universals – professor, sergeant, nurse – only during certain phases in their lives. b is a role means: b is a realizable entity & b exists because there is some single bearer that is in some special physical, social, or institutional set of circumstances in which this bearer does not have to be& b is not such that, if it ceases to exist, then the physical make-up of the bearer is thereby changed. (axiom label in BFO2 Reference: [061-001]) (forall (x) (if (Role x) (RealizableEntity x))) // axiom label in BFO2 CLIF: [061-001] role b is a role means: b is a realizable entity & b exists because there is some single bearer that is in some special physical, social, or institutional set of circumstances in which this bearer does not have to be& b is not such that, if it ceases to exist, then the physical make-up of the bearer is thereby changed. (axiom label in BFO2 Reference: [061-001]) (forall (x) (if (Role x) (RealizableEntity x))) // axiom label in BFO2 CLIF: [061-001] BFO:0000024 fiat-object-part FiatObjectPart or with divisions drawn by cognitive subjects for practical reasons, such as the division of a cake (before slicing) into (what will become) slices (and thus member parts of an object aggregate). However, this does not mean that fiat object parts are dependent for their existence on divisions or delineations effected by cognitive subjects. If, for example, it is correct to conceive geological layers of the Earth as fiat object parts of the Earth, then even though these layers were first delineated in recent times, still existed long before such delineation and what holds of these layers (for example that the oldest layers are also the lowest layers) did not begin to hold because of our acts of delineation.Treatment of material entity in BFOExamples viewed by some as problematic cases for the trichotomy of fiat object part, object, and object aggregate include: a mussel on (and attached to) a rock, a slime mold, a pizza, a cloud, a galaxy, a railway train with engine and multiple carriages, a clonal stand of quaking aspen, a bacterial community (biofilm), a broken femur. Note that, as Aristotle already clearly recognized, such problematic cases – which lie at or near the penumbra of instances defined by the categories in question – need not invalidate these categories. The existence of grey objects does not prove that there are not objects which are black and objects which are white; the existence of mules does not prove that there are not objects which are donkeys and objects which are horses. It does, however, show that the examples in question need to be addressed carefully in order to show how they can be fitted into the proposed scheme, for example by recognizing additional subdivisions [29 the FMA:regional parts of an intact human body. the Western hemisphere of the Earth the division of the brain into regions the division of the planet into hemispheres the dorsal and ventral surfaces of the body the upper and lower lobes of the left lung BFO 2 Reference: Most examples of fiat object parts are associated with theoretically drawn divisions b is a fiat object part = Def. b is a material entity which is such that for all times t, if b exists at t then there is some object c such that b proper continuant_part of c at t and c is demarcated from the remainder of c by a two-dimensional continuant fiat boundary. (axiom label in BFO2 Reference: [027-004]) (forall (x) (if (FiatObjectPart x) (and (MaterialEntity x) (forall (t) (if (existsAt x t) (exists (y) (and (Object y) (properContinuantPartOfAt x y t)))))))) // axiom label in BFO2 CLIF: [027-004] fiat object part b is a fiat object part = Def. b is a material entity which is such that for all times t, if b exists at t then there is some object c such that b proper continuant_part of c at t and c is demarcated from the remainder of c by a two-dimensional continuant fiat boundary. (axiom label in BFO2 Reference: [027-004]) (forall (x) (if (FiatObjectPart x) (and (MaterialEntity x) (forall (t) (if (existsAt x t) (exists (y) (and (Object y) (properContinuantPartOfAt x y t)))))))) // axiom label in BFO2 CLIF: [027-004] BFO:0000026 1d-s-region OneDimensionalSpatialRegion an edge of a cube-shaped portion of space. A one-dimensional spatial region is a line or aggregate of lines stretching from one point in space to another. (axiom label in BFO2 Reference: [038-001]) (forall (x) (if (OneDimensionalSpatialRegion x) (SpatialRegion x))) // axiom label in BFO2 CLIF: [038-001] one-dimensional spatial region A one-dimensional spatial region is a line or aggregate of lines stretching from one point in space to another. (axiom label in BFO2 Reference: [038-001]) (forall (x) (if (OneDimensionalSpatialRegion x) (SpatialRegion x))) // axiom label in BFO2 CLIF: [038-001] BFO:0000027 object-aggregate ObjectAggregate a collection of cells in a blood biobank. a swarm of bees is an aggregate of members who are linked together through natural bonds a symphony orchestra an organization is an aggregate whose member parts have roles of specific types (for example in a jazz band, a chess club, a football team) defined by fiat: the aggregate of members of an organization defined through physical attachment: the aggregate of atoms in a lump of granite defined through physical containment: the aggregate of molecules of carbon dioxide in a sealed container defined via attributive delimitations such as: the patients in this hospital the aggregate of bearings in a constant velocity axle joint the aggregate of blood cells in your body the nitrogen atoms in the atmosphere the restaurants in Palo Alto your collection of Meissen ceramic plates. An entity a is an object aggregate if and only if there is a mutually exhaustive and pairwise disjoint partition of a into objects BFO 2 Reference: object aggregates may gain and lose parts while remaining numerically identical (one and the same individual) over time. This holds both for aggregates whose membership is determined naturally (the aggregate of cells in your body) and aggregates determined by fiat (a baseball team, a congressional committee). ISBN:978-3-938793-98-5pp124-158#Thomas Bittner and Barry Smith, 'A Theory of Granular Partitions', in K. Munn and B. Smith (eds.), Applied Ontology: An Introduction, Frankfurt/Lancaster: ontos, 2008, 125-158. b is an object aggregate means: b is a material entity consisting exactly of a plurality of objects as member_parts at all times at which b exists. (axiom label in BFO2 Reference: [025-004]) (forall (x) (if (ObjectAggregate x) (and (MaterialEntity x) (forall (t) (if (existsAt x t) (exists (y z) (and (Object y) (Object z) (memberPartOfAt y x t) (memberPartOfAt z x t) (not (= y z)))))) (not (exists (w t_1) (and (memberPartOfAt w x t_1) (not (Object w)))))))) // axiom label in BFO2 CLIF: [025-004] object aggregate An entity a is an object aggregate if and only if there is a mutually exhaustive and pairwise disjoint partition of a into objects An entity a is an object aggregate if and only if there is a mutually exhaustive and pairwise disjoint partition of a into objects ISBN:978-3-938793-98-5pp124-158#Thomas Bittner and Barry Smith, 'A Theory of Granular Partitions', in K. Munn and B. Smith (eds.), Applied Ontology: An Introduction, Frankfurt/Lancaster: ontos, 2008, 125-158. b is an object aggregate means: b is a material entity consisting exactly of a plurality of objects as member_parts at all times at which b exists. (axiom label in BFO2 Reference: [025-004]) (forall (x) (if (ObjectAggregate x) (and (MaterialEntity x) (forall (t) (if (existsAt x t) (exists (y z) (and (Object y) (Object z) (memberPartOfAt y x t) (memberPartOfAt z x t) (not (= y z)))))) (not (exists (w t_1) (and (memberPartOfAt w x t_1) (not (Object w)))))))) // axiom label in BFO2 CLIF: [025-004] BFO:0000028 3d-s-region ThreeDimensionalSpatialRegion a cube-shaped region of space a sphere-shaped region of space, A three-dimensional spatial region is a spatial region that is of three dimensions. (axiom label in BFO2 Reference: [040-001]) (forall (x) (if (ThreeDimensionalSpatialRegion x) (SpatialRegion x))) // axiom label in BFO2 CLIF: [040-001] three-dimensional spatial region A three-dimensional spatial region is a spatial region that is of three dimensions. (axiom label in BFO2 Reference: [040-001]) (forall (x) (if (ThreeDimensionalSpatialRegion x) (SpatialRegion x))) // axiom label in BFO2 CLIF: [040-001] BFO:0000029 site Site Manhattan Canyon) a hole in the interior of a portion of cheese a rabbit hole an air traffic control region defined in the airspace above an airport the Grand Canyon the Piazza San Marco the cockpit of an aircraft the hold of a ship the interior of a kangaroo pouch the interior of the trunk of your car the interior of your bedroom the interior of your office the interior of your refrigerator the lumen of your gut your left nostril (a fiat part – the opening – of your left nasal cavity) b is a site means: b is a three-dimensional immaterial entity that is (partially or wholly) bounded by a material entity or it is a three-dimensional immaterial part thereof. (axiom label in BFO2 Reference: [034-002]) (forall (x) (if (Site x) (ImmaterialEntity x))) // axiom label in BFO2 CLIF: [034-002] site b is a site means: b is a three-dimensional immaterial entity that is (partially or wholly) bounded by a material entity or it is a three-dimensional immaterial part thereof. (axiom label in BFO2 Reference: [034-002]) (forall (x) (if (Site x) (ImmaterialEntity x))) // axiom label in BFO2 CLIF: [034-002] BFO:0000030 object Object atom cell cells and organisms engineered artifacts grain of sand molecule organelle organism planet solid portions of matter star BFO 2 Reference: BFO rests on the presupposition that at multiple micro-, meso- and macroscopic scales reality exhibits certain stable, spatially separated or separable material units, combined or combinable into aggregates of various sorts (for example organisms into what are called ‘populations’). Such units play a central role in almost all domains of natural science from particle physics to cosmology. Many scientific laws govern the units in question, employing general terms (such as ‘molecule’ or ‘planet’) referring to the types and subtypes of units, and also to the types and subtypes of the processes through which such units develop and interact. The division of reality into such natural units is at the heart of biological science, as also is the fact that these units may form higher-level units (as cells form multicellular organisms) and that they may also form aggregates of units, for example as cells form portions of tissue and organs form families, herds, breeds, species, and so on. At the same time, the division of certain portions of reality into engineered units (manufactured artifacts) is the basis of modern industrial technology, which rests on the distributed mass production of engineered parts through division of labor and on their assembly into larger, compound units such as cars and laptops. The division of portions of reality into units is one starting point for the phenomenon of counting. BFO 2 Reference: Each object is such that there are entities of which we can assert unproblematically that they lie in its interior, and other entities of which we can assert unproblematically that they lie in its exterior. This may not be so for entities lying at or near the boundary between the interior and exterior. This means that two objects – for example the two cells depicted in Figure 3 – may be such that there are material entities crossing their boundaries which belong determinately to neither cell. Something similar obtains in certain cases of conjoined twins (see below). BFO 2 Reference: To say that b is causally unified means: b is a material entity which is such that its material parts are tied together in such a way that, in environments typical for entities of the type in question,if c, a continuant part of b that is in the interior of b at t, is larger than a certain threshold size (which will be determined differently from case to case, depending on factors such as porosity of external cover) and is moved in space to be at t at a location on the exterior of the spatial region that had been occupied by b at t, then either b’s other parts will be moved in coordinated fashion or b will be damaged (be affected, for example, by breakage or tearing) in the interval between t and t.causal changes in one part of b can have consequences for other parts of b without the mediation of any entity that lies on the exterior of b. Material entities with no proper material parts would satisfy these conditions trivially. Candidate examples of types of causal unity for material entities of more complex sorts are as follows (this is not intended to be an exhaustive list):CU1: Causal unity via physical coveringHere the parts in the interior of the unified entity are combined together causally through a common membrane or other physical covering\. The latter points outwards toward and may serve a protective function in relation to what lies on the exterior of the entity [13, 47 BFO 2 Reference: an object is a maximal causally unified material entity BFO 2 Reference: ‘objects’ are sometimes referred to as ‘grains’ [74 b is an object means: b is a material entity which manifests causal unity of one or other of the types CUn listed above & is of a type (a material universal) instances of which are maximal relative to this criterion of causal unity. (axiom label in BFO2 Reference: [024-001]) object b is an object means: b is a material entity which manifests causal unity of one or other of the types CUn listed above & is of a type (a material universal) instances of which are maximal relative to this criterion of causal unity. (axiom label in BFO2 Reference: [024-001]) BFO:0000031 gdc GenericallyDependentContinuant The entries in your database are patterns instantiated as quality instances in your hard drive. The database itself is an aggregate of such patterns. When you create the database you create a particular instance of the generically dependent continuant type database. Each entry in the database is an instance of the generically dependent continuant type IAO: information content entity. the pdf file on your laptop, the pdf file that is a copy thereof on my laptop the sequence of this protein molecule; the sequence that is a copy thereof in that protein molecule. b is a generically dependent continuant = Def. b is a continuant that g-depends_on one or more other entities. (axiom label in BFO2 Reference: [074-001]) (iff (GenericallyDependentContinuant a) (and (Continuant a) (exists (b t) (genericallyDependsOnAt a b t)))) // axiom label in BFO2 CLIF: [074-001] generically dependent continuant b is a generically dependent continuant = Def. b is a continuant that g-depends_on one or more other entities. (axiom label in BFO2 Reference: [074-001]) (iff (GenericallyDependentContinuant a) (and (Continuant a) (exists (b t) (genericallyDependsOnAt a b t)))) // axiom label in BFO2 CLIF: [074-001] BFO:0000034 function Function the function of a hammer to drive in nails the function of a heart pacemaker to regulate the beating of a heart through electricity the function of amylase in saliva to break down starch into sugar BFO 2 Reference: In the past, we have distinguished two varieties of function, artifactual function and biological function. These are not asserted subtypes of BFO:function however, since the same function – for example: to pump, to transport – can exist both in artifacts and in biological entities. The asserted subtypes of function that would be needed in order to yield a separate monoheirarchy are not artifactual function, biological function, etc., but rather transporting function, pumping function, etc. A function is a disposition that exists in virtue of the bearer’s physical make-up and this physical make-up is something the bearer possesses because it came into being, either through evolution (in the case of natural biological entities) or through intentional design (in the case of artifacts), in order to realize processes of a certain sort. (axiom label in BFO2 Reference: [064-001]) (forall (x) (if (Function x) (Disposition x))) // axiom label in BFO2 CLIF: [064-001] function A function is a disposition that exists in virtue of the bearer’s physical make-up and this physical make-up is something the bearer possesses because it came into being, either through evolution (in the case of natural biological entities) or through intentional design (in the case of artifacts), in order to realize processes of a certain sort. (axiom label in BFO2 Reference: [064-001]) (forall (x) (if (Function x) (Disposition x))) // axiom label in BFO2 CLIF: [064-001] BFO:0000035 p-boundary ProcessBoundary the boundary between the 2nd and 3rd year of your life. p is a process boundary =Def. p is a temporal part of a process & p has no proper temporal parts. (axiom label in BFO2 Reference: [084-001]) Every process boundary occupies_temporal_region a zero-dimensional temporal region. (axiom label in BFO2 Reference: [085-002]) (forall (x) (if (ProcessBoundary x) (exists (y) (and (ZeroDimensionalTemporalRegion y) (occupiesTemporalRegion x y))))) // axiom label in BFO2 CLIF: [085-002] (iff (ProcessBoundary a) (exists (p) (and (Process p) (temporalPartOf a p) (not (exists (b) (properTemporalPartOf b a)))))) // axiom label in BFO2 CLIF: [084-001] process boundary p is a process boundary =Def. p is a temporal part of a process & p has no proper temporal parts. (axiom label in BFO2 Reference: [084-001]) Every process boundary occupies_temporal_region a zero-dimensional temporal region. (axiom label in BFO2 Reference: [085-002]) (forall (x) (if (ProcessBoundary x) (exists (y) (and (ZeroDimensionalTemporalRegion y) (occupiesTemporalRegion x y))))) // axiom label in BFO2 CLIF: [085-002] (iff (ProcessBoundary a) (exists (p) (and (Process p) (temporalPartOf a p) (not (exists (b) (properTemporalPartOf b a)))))) // axiom label in BFO2 CLIF: [084-001] BFO:0000038 1d-t-region OneDimensionalTemporalRegion the temporal region during which a process occurs. BFO 2 Reference: A temporal interval is a special kind of one-dimensional temporal region, namely one that is self-connected (is without gaps or breaks). A one-dimensional temporal region is a temporal region that is extended. (axiom label in BFO2 Reference: [103-001]) (forall (x) (if (OneDimensionalTemporalRegion x) (TemporalRegion x))) // axiom label in BFO2 CLIF: [103-001] one-dimensional temporal region A one-dimensional temporal region is a temporal region that is extended. (axiom label in BFO2 Reference: [103-001]) (forall (x) (if (OneDimensionalTemporalRegion x) (TemporalRegion x))) // axiom label in BFO2 CLIF: [103-001] BFO:0000040 material MaterialEntity a flame a forest fire a human being a hurricane a photon a puff of smoke a sea wave a tornado an aggregate of human beings. an energy wave an epidemic the undetached arm of a human being BFO 2 Reference: Material entities (continuants) can preserve their identity even while gaining and losing material parts. Continuants are contrasted with occurrents, which unfold themselves in successive temporal parts or phases [60 BFO 2 Reference: Object, Fiat Object Part and Object Aggregate are not intended to be exhaustive of Material Entity. Users are invited to propose new subcategories of Material Entity. BFO 2 Reference: ‘Matter’ is intended to encompass both mass and energy (we will address the ontological treatment of portions of energy in a later version of BFO). A portion of matter is anything that includes elementary particles among its proper or improper parts: quarks and leptons, including electrons, as the smallest particles thus far discovered; baryons (including protons and neutrons) at a higher level of granularity; atoms and molecules at still higher levels, forming the cells, organs, organisms and other material entities studied by biologists, the portions of rock studied by geologists, the fossils studied by paleontologists, and so on.Material entities are three-dimensional entities (entities extended in three spatial dimensions), as contrasted with the processes in which they participate, which are four-dimensional entities (entities extended also along the dimension of time).According to the FMA, material entities may have immaterial entities as parts – including the entities identified below as sites; for example the interior (or ‘lumen’) of your small intestine is a part of your body. BFO 2.0 embodies a decision to follow the FMA here. A material entity is an independent continuant that has some portion of matter as proper or improper continuant part. (axiom label in BFO2 Reference: [019-002]) Every entity which has a material entity as continuant part is a material entity. (axiom label in BFO2 Reference: [020-002]) every entity of which a material entity is continuant part is also a material entity. (axiom label in BFO2 Reference: [021-002]) (forall (x) (if (MaterialEntity x) (IndependentContinuant x))) // axiom label in BFO2 CLIF: [019-002] (forall (x) (if (and (Entity x) (exists (y t) (and (MaterialEntity y) (continuantPartOfAt x y t)))) (MaterialEntity x))) // axiom label in BFO2 CLIF: [021-002] (forall (x) (if (and (Entity x) (exists (y t) (and (MaterialEntity y) (continuantPartOfAt y x t)))) (MaterialEntity x))) // axiom label in BFO2 CLIF: [020-002] material entity A material entity is an independent continuant that has some portion of matter as proper or improper continuant part. (axiom label in BFO2 Reference: [019-002]) Every entity which has a material entity as continuant part is a material entity. (axiom label in BFO2 Reference: [020-002]) every entity of which a material entity is continuant part is also a material entity. (axiom label in BFO2 Reference: [021-002]) (forall (x) (if (MaterialEntity x) (IndependentContinuant x))) // axiom label in BFO2 CLIF: [019-002] (forall (x) (if (and (Entity x) (exists (y t) (and (MaterialEntity y) (continuantPartOfAt x y t)))) (MaterialEntity x))) // axiom label in BFO2 CLIF: [021-002] (forall (x) (if (and (Entity x) (exists (y t) (and (MaterialEntity y) (continuantPartOfAt y x t)))) (MaterialEntity x))) // axiom label in BFO2 CLIF: [020-002] BFO:0000140 cf-boundary ContinuantFiatBoundary b is a continuant fiat boundary = Def. b is an immaterial entity that is of zero, one or two dimensions and does not include a spatial region as part. (axiom label in BFO2 Reference: [029-001]) BFO 2 Reference: In BFO 1.1 the assumption was made that the external surface of a material entity such as a cell could be treated as if it were a boundary in the mathematical sense. The new document propounds the view that when we talk about external surfaces of material objects in this way then we are talking about something fiat. To be dealt with in a future version: fiat boundaries at different levels of granularity.More generally, the focus in discussion of boundaries in BFO 2.0 is now on fiat boundaries, which means: boundaries for which there is no assumption that they coincide with physical discontinuities. The ontology of boundaries becomes more closely allied with the ontology of regions. BFO 2 Reference: a continuant fiat boundary is a boundary of some material entity (for example: the plane separating the Northern and Southern hemispheres; the North Pole), or it is a boundary of some immaterial entity (for example of some portion of airspace). Three basic kinds of continuant fiat boundary can be distinguished (together with various combination kinds [29 Continuant fiat boundary doesn't have a closure axiom because the subclasses don't necessarily exhaust all possibilites. An example would be the mereological sum of two-dimensional continuant fiat boundary and a one dimensional continuant fiat boundary that doesn't overlap it. The situation is analogous to temporal and spatial regions. Every continuant fiat boundary is located at some spatial region at every time at which it exists (iff (ContinuantFiatBoundary a) (and (ImmaterialEntity a) (exists (b) (and (or (ZeroDimensionalSpatialRegion b) (OneDimensionalSpatialRegion b) (TwoDimensionalSpatialRegion b)) (forall (t) (locatedInAt a b t)))) (not (exists (c t) (and (SpatialRegion c) (continuantPartOfAt c a t)))))) // axiom label in BFO2 CLIF: [029-001] continuant fiat boundary b is a continuant fiat boundary = Def. b is an immaterial entity that is of zero, one or two dimensions and does not include a spatial region as part. (axiom label in BFO2 Reference: [029-001]) Continuant fiat boundary doesn't have a closure axiom because the subclasses don't necessarily exhaust all possibilites. An example would be the mereological sum of two-dimensional continuant fiat boundary and a one dimensional continuant fiat boundary that doesn't overlap it. The situation is analogous to temporal and spatial regions. (iff (ContinuantFiatBoundary a) (and (ImmaterialEntity a) (exists (b) (and (or (ZeroDimensionalSpatialRegion b) (OneDimensionalSpatialRegion b) (TwoDimensionalSpatialRegion b)) (forall (t) (locatedInAt a b t)))) (not (exists (c t) (and (SpatialRegion c) (continuantPartOfAt c a t)))))) // axiom label in BFO2 CLIF: [029-001] BFO:0000141 immaterial ImmaterialEntity BFO 2 Reference: Immaterial entities are divided into two subgroups:boundaries and sites, which bound, or are demarcated in relation, to material entities, and which can thus change location, shape and size and as their material hosts move or change shape or size (for example: your nasal passage; the hold of a ship; the boundary of Wales (which moves with the rotation of the Earth) [38, 7, 10 immaterial entity BFO:0000142 1d-cf-boundary OneDimensionalContinuantFiatBoundary The Equator all geopolitical boundaries all lines of latitude and longitude the line separating the outer surface of the mucosa of the lower lip from the outer surface of the skin of the chin. the median sulcus of your tongue a one-dimensional continuant fiat boundary is a continuous fiat line whose location is defined in relation to some material entity. (axiom label in BFO2 Reference: [032-001]) (iff (OneDimensionalContinuantFiatBoundary a) (and (ContinuantFiatBoundary a) (exists (b) (and (OneDimensionalSpatialRegion b) (forall (t) (locatedInAt a b t)))))) // axiom label in BFO2 CLIF: [032-001] one-dimensional continuant fiat boundary a one-dimensional continuant fiat boundary is a continuous fiat line whose location is defined in relation to some material entity. (axiom label in BFO2 Reference: [032-001]) (iff (OneDimensionalContinuantFiatBoundary a) (and (ContinuantFiatBoundary a) (exists (b) (and (OneDimensionalSpatialRegion b) (forall (t) (locatedInAt a b t)))))) // axiom label in BFO2 CLIF: [032-001] BFO:0000144 process-profile ProcessProfile On a somewhat higher level of complexity are what we shall call rate process profiles, which are the targets of selective abstraction focused not on determinate quality magnitudes plotted over time, but rather on certain ratios between these magnitudes and elapsed times. A speed process profile, for example, is represented by a graph plotting against time the ratio of distance covered per unit of time. Since rates may change, and since such changes, too, may have rates of change, we have to deal here with a hierarchy of process profile universals at successive levels One important sub-family of rate process profiles is illustrated by the beat or frequency profiles of cyclical processes, illustrated by the 60 beats per minute beating process of John’s heart, or the 120 beats per minute drumming process involved in one of John’s performances in a rock band, and so on. Each such process includes what we shall call a beat process profile instance as part, a subtype of rate process profile in which the salient ratio is not distance covered but rather number of beat cycles per unit of time. Each beat process profile instance instantiates the determinable universal beat process profile. But it also instantiates multiple more specialized universals at lower levels of generality, selected from rate process profilebeat process profileregular beat process profile3 bpm beat process profile4 bpm beat process profileirregular beat process profileincreasing beat process profileand so on.In the case of a regular beat process profile, a rate can be assigned in the simplest possible fashion by dividing the number of cycles by the length of the temporal region occupied by the beating process profile as a whole. Irregular process profiles of this sort, for example as identified in the clinic, or in the readings on an aircraft instrument panel, are often of diagnostic significance. The simplest type of process profiles are what we shall call ‘quality process profiles’, which are the process profiles which serve as the foci of the sort of selective abstraction that is involved when measurements are made of changes in single qualities, as illustrated, for example, by process profiles of mass, temperature, aortic pressure, and so on. b is a process_profile =Def. there is some process c such that b process_profile_of c (axiom label in BFO2 Reference: [093-002]) b process_profile_of c holds when b proper_occurrent_part_of c& there is some proper_occurrent_part d of c which has no parts in common with b & is mutually dependent on b& is such that b, c and d occupy the same temporal region (axiom label in BFO2 Reference: [094-005]) (forall (x y) (if (processProfileOf x y) (and (properContinuantPartOf x y) (exists (z t) (and (properOccurrentPartOf z y) (TemporalRegion t) (occupiesSpatioTemporalRegion x t) (occupiesSpatioTemporalRegion y t) (occupiesSpatioTemporalRegion z t) (not (exists (w) (and (occurrentPartOf w x) (occurrentPartOf w z))))))))) // axiom label in BFO2 CLIF: [094-005] (iff (ProcessProfile a) (exists (b) (and (Process b) (processProfileOf a b)))) // axiom label in BFO2 CLIF: [093-002] process profile b is a process_profile =Def. there is some process c such that b process_profile_of c (axiom label in BFO2 Reference: [093-002]) b process_profile_of c holds when b proper_occurrent_part_of c& there is some proper_occurrent_part d of c which has no parts in common with b & is mutually dependent on b& is such that b, c and d occupy the same temporal region (axiom label in BFO2 Reference: [094-005]) (forall (x y) (if (processProfileOf x y) (and (properContinuantPartOf x y) (exists (z t) (and (properOccurrentPartOf z y) (TemporalRegion t) (occupiesSpatioTemporalRegion x t) (occupiesSpatioTemporalRegion y t) (occupiesSpatioTemporalRegion z t) (not (exists (w) (and (occurrentPartOf w x) (occurrentPartOf w z))))))))) // axiom label in BFO2 CLIF: [094-005] (iff (ProcessProfile a) (exists (b) (and (Process b) (processProfileOf a b)))) // axiom label in BFO2 CLIF: [093-002] BFO:0000145 r-quality RelationalQuality John’s role of husband to Mary is dependent on Mary’s role of wife to John, and both are dependent on the object aggregate comprising John and Mary as member parts joined together through the relational quality of being married. a marriage bond, an instance of love, an obligation between one person and another. a marriage bond, an instance of requited love, an obligation between one person and another. b is a relational quality = Def. for some independent continuants c, d and for some time t: b quality_of c at t & b quality_of d at t. (axiom label in BFO2 Reference: [057-001]) (iff (RelationalQuality a) (exists (b c t) (and (IndependentContinuant b) (IndependentContinuant c) (qualityOfAt a b t) (qualityOfAt a c t)))) // axiom label in BFO2 CLIF: [057-001] relational quality b is a relational quality = Def. for some independent continuants c, d and for some time t: b quality_of c at t & b quality_of d at t. (axiom label in BFO2 Reference: [057-001]) (iff (RelationalQuality a) (exists (b c t) (and (IndependentContinuant b) (IndependentContinuant c) (qualityOfAt a b t) (qualityOfAt a c t)))) // axiom label in BFO2 CLIF: [057-001] BFO:0000146 2d-cf-boundary TwoDimensionalContinuantFiatBoundary a two-dimensional continuant fiat boundary (surface) is a self-connected fiat surface whose location is defined in relation to some material entity. (axiom label in BFO2 Reference: [033-001]) (iff (TwoDimensionalContinuantFiatBoundary a) (and (ContinuantFiatBoundary a) (exists (b) (and (TwoDimensionalSpatialRegion b) (forall (t) (locatedInAt a b t)))))) // axiom label in BFO2 CLIF: [033-001] two-dimensional continuant fiat boundary a two-dimensional continuant fiat boundary (surface) is a self-connected fiat surface whose location is defined in relation to some material entity. (axiom label in BFO2 Reference: [033-001]) (iff (TwoDimensionalContinuantFiatBoundary a) (and (ContinuantFiatBoundary a) (exists (b) (and (TwoDimensionalSpatialRegion b) (forall (t) (locatedInAt a b t)))))) // axiom label in BFO2 CLIF: [033-001] BFO:0000147 0d-cf-boundary ZeroDimensionalContinuantFiatBoundary the geographic North Pole the point of origin of some spatial coordinate system. the quadripoint where the boundaries of Colorado, Utah, New Mexico, and Arizona meet zero dimension continuant fiat boundaries are not spatial points. Considering the example 'the quadripoint where the boundaries of Colorado, Utah, New Mexico, and Arizona meet' : There are many frames in which that point is zooming through many points in space. Whereas, no matter what the frame, the quadripoint is always in the same relation to the boundaries of Colorado, Utah, New Mexico, and Arizona. a zero-dimensional continuant fiat boundary is a fiat point whose location is defined in relation to some material entity. (axiom label in BFO2 Reference: [031-001]) (iff (ZeroDimensionalContinuantFiatBoundary a) (and (ContinuantFiatBoundary a) (exists (b) (and (ZeroDimensionalSpatialRegion b) (forall (t) (locatedInAt a b t)))))) // axiom label in BFO2 CLIF: [031-001] zero-dimensional continuant fiat boundary zero dimension continuant fiat boundaries are not spatial points. Considering the example 'the quadripoint where the boundaries of Colorado, Utah, New Mexico, and Arizona meet' : There are many frames in which that point is zooming through many points in space. Whereas, no matter what the frame, the quadripoint is always in the same relation to the boundaries of Colorado, Utah, New Mexico, and Arizona. requested by Melanie Courtot a zero-dimensional continuant fiat boundary is a fiat point whose location is defined in relation to some material entity. (axiom label in BFO2 Reference: [031-001]) (iff (ZeroDimensionalContinuantFiatBoundary a) (and (ContinuantFiatBoundary a) (exists (b) (and (ZeroDimensionalSpatialRegion b) (forall (t) (locatedInAt a b t)))))) // axiom label in BFO2 CLIF: [031-001] BFO:0000148 0d-t-region ZeroDimensionalTemporalRegion a temporal region that is occupied by a process boundary right now the moment at which a child is born the moment at which a finger is detached in an industrial accident the moment of death. temporal instant. A zero-dimensional temporal region is a temporal region that is without extent. (axiom label in BFO2 Reference: [102-001]) (forall (x) (if (ZeroDimensionalTemporalRegion x) (TemporalRegion x))) // axiom label in BFO2 CLIF: [102-001] zero-dimensional temporal region A zero-dimensional temporal region is a temporal region that is without extent. (axiom label in BFO2 Reference: [102-001]) (forall (x) (if (ZeroDimensionalTemporalRegion x) (TemporalRegion x))) // axiom label in BFO2 CLIF: [102-001] BFO:0000182 history History A history is a process that is the sum of the totality of processes taking place in the spatiotemporal region occupied by a material entity or site, including processes on the surface of the entity or within the cavities to which it serves as host. (axiom label in BFO2 Reference: [138-001]) history A history is a process that is the sum of the totality of processes taking place in the spatiotemporal region occupied by a material entity or site, including processes on the surface of the entity or within the cavities to which it serves as host. (axiom label in BFO2 Reference: [138-001]) CHEBI:17843 A single-stranded RNA molecule containing about 70-90 nucleotides, folded by intrastrand base pairing into a characteristic secondary ('cloverleaf') structure that carries a specific amino acid and matches it to its corresponding codon on an mRNA during protein synthesis. tRNA transfer RNA transfer RNA ChemIDplus:9014-25-9 KEGG COMPOUND:C00066 CHEBI:18111 RNA molecules which are essential structural and functional components of ribosomes, the subcellular units responsible for protein synthesis. Ribosomal RNA rRNA ribosomal RNA ribosomal RNA KEGG COMPOUND:C00240 CHEBI:23367 Any constitutionally or isotopically distinct atom, molecule, ion, ion pair, radical, radical ion, complex, conformer etc., identifiable as a separately distinguishable entity. molecular entity molecular entity CHEBI:33247 Any substituent group or skeleton containing carbon. organic group CHEBI:33697 High molecular weight, linear polymers, composed of nucleotides containing ribose and linked by phosphodiester bonds; RNA is central to the synthesis of proteins. RNA ribonucleic acid ribonucleic acids ribonucleic acid ChemIDplus:63231-63-0 CHEBI:33708 When two or more amino acids combine to form a peptide, the elements of water are removed, and what remains of each amino acid is called an amino-acid residue. amino-acid residue amino-acid residue CHEBI:74035 A class of small RNA molecules which are comprised of approximately 150 nucleotides and which are found within the nucleus of eukaryotic cells. snRNA small nuclear RNA CiteXplore:22907602 CiteXplore:23070852 CiteXplore:23190533 CiteXplore:23348838 CiteXplore:23394998 CiteXplore:23426875 CiteXplore:23727230 CiteXplore:23740936 Wikipedia:Small_nuclear_RNA CHEBI:8762 RNA(circular) circRNA RNA(circular) KEGG COMPOUND:C02073 CLO:0000031 MB, SS, JZ, MAH, BP, CS, YH cell line DOID:14566 A disease that is characterized by abnormally rapid cell division. cell process disease disease of cellular proliferation DOID:162 A disease of cellular proliferation that is malignant and primary, characterized by uncontrolled cellular proliferation, local cell invasion and metastasis. malignant neoplasm malignant tumor primary cancer cancer ICD10CM:C80 ICD10CM:C80.1 ICD9CM:199 MSH:D009369 NCI:C9305 SNOMEDCT_US_2015_03_01:154432008 SNOMEDCT_US_2015_03_01:154433003 SNOMEDCT_US_2015_03_01:154577008 SNOMEDCT_US_2015_03_01:187597000 SNOMEDCT_US_2015_03_01:188475001 SNOMEDCT_US_2015_03_01:188482002 SNOMEDCT_US_2015_03_01:190150006 SNOMEDCT_US_2015_03_01:269513004 SNOMEDCT_US_2015_03_01:269623003 SNOMEDCT_US_2015_03_01:269626006 SNOMEDCT_US_2015_03_01:269634000 SNOMEDCT_US_2015_03_01:363346000 SNOMEDCT_US_2015_03_01:38807002 UMLS_CUI:C0006826 DOID:4 A disease is a disposition (i) to undergo pathological processes that (ii) exists in an organism because of one or more disorders in that organism. disease MSH:D004194 NCI:C2991 SNOMEDCT_US_2015_03_01:64572001 UMLS_CUI:C0012634 GO:0000122 Any process that stops, prevents, or reduces the frequency, rate or extent of transcription from an RNA polymerase II promoter. down regulation of transcription from RNA polymerase II promoter down-regulation of transcription from RNA polymerase II promoter downregulation of transcription from RNA polymerase II promoter inhibition of transcription from RNA polymerase II promoter negative regulation of transcription from Pol II promoter negative regulation of transcription from RNA polymerase II promoter GO:0000175 Catalysis of the sequential cleavage of mononucleotides from a free 3' terminus of an RNA molecule. 3'-5' exoribonuclease activity 3'-5'-exoribonuclease activity EC:3.1.13.- Reactome:REACT_102966 Reactome:REACT_108214 Reactome:REACT_20588 Reactome:REACT_33991 Reactome:REACT_34078 Reactome:REACT_78363 Reactome:REACT_82118 Reactome:REACT_88115 Reactome:REACT_89880 Reactome:REACT_92153 Reactome:REACT_93499 Reactome:REACT_95913 Reactome:REACT_95921 Reactome:REACT_96267 Reactome:REACT_99422 GO:0003674 Elemental activities, such as catalysis or binding, describing the actions of a gene product at the molecular level. A given gene product may exhibit one or more molecular functions. molecular function molecular_function GO:0003723 Interacting selectively and non-covalently with an RNA molecule or a portion thereof. RNA binding Reactome:REACT_101703 Reactome:REACT_103323 Reactome:REACT_106430 Reactome:REACT_107757 Reactome:REACT_108232 Reactome:REACT_108368 Reactome:REACT_109723 Reactome:REACT_12458 Reactome:REACT_29965 Reactome:REACT_77167 Reactome:REACT_78197 Reactome:REACT_87164 Reactome:REACT_89329 Reactome:REACT_90531 Reactome:REACT_98683 GO:0003824 Catalysis of a biochemical reaction at physiological temperatures. In biologically catalyzed reactions, the reactants are known as substrates, and the catalysts are naturally occurring macromolecular substances known as enzymes. Enzymes possess specific binding sites for substrates, and are usually composed wholly or largely of protein, but RNA that has catalytic activity (ribozyme) is often also regarded as enzymatic. enzyme activity catalytic activity Wikipedia:Enzyme GO:0004518 Catalysis of the hydrolysis of ester linkages within nucleic acids. nuclease activity EC:3.1.-.- GO:0004519 Catalysis of the hydrolysis of ester linkages within nucleic acids by creating internal breaks. endonuclease activity Reactome:REACT_100654 Reactome:REACT_101397 Reactome:REACT_103600 Reactome:REACT_106502 Reactome:REACT_108614 Reactome:REACT_110731 Reactome:REACT_112366 Reactome:REACT_1124 Reactome:REACT_112509 Reactome:REACT_112615 Reactome:REACT_112782 Reactome:REACT_113127 Reactome:REACT_113480 Reactome:REACT_113819 Reactome:REACT_114931 Reactome:REACT_115221 Reactome:REACT_115226 Reactome:REACT_115382 Reactome:REACT_115937 Reactome:REACT_116011 Reactome:REACT_1914 Reactome:REACT_34610 Reactome:REACT_6746 Reactome:REACT_6774 Reactome:REACT_77706 Reactome:REACT_78624 Reactome:REACT_79198 Reactome:REACT_80387 Reactome:REACT_80628 Reactome:REACT_80681 Reactome:REACT_80797 Reactome:REACT_81714 Reactome:REACT_87541 Reactome:REACT_89800 Reactome:REACT_90034 Reactome:REACT_90935 Reactome:REACT_92894 GO:0004521 Catalysis of the hydrolysis of ester linkages within ribonucleic acid by creating internal breaks. endoribonuclease activity Reactome:REACT_22313 Reactome:REACT_75787 GO:0004527 Catalysis of the hydrolysis of ester linkages within nucleic acids by removing nucleotide residues from the 3' or 5' end. exonuclease activity GO:0004532 Catalysis of the sequential cleavage of mononucleotides from a free 5' or 3' terminus of an RNA molecule. exoribonuclease activity Reactome:REACT_109605 Reactome:REACT_109680 Reactome:REACT_20556 Reactome:REACT_29104 Reactome:REACT_32104 Reactome:REACT_78260 Reactome:REACT_79364 Reactome:REACT_79874 Reactome:REACT_87278 Reactome:REACT_88925 Reactome:REACT_90233 Reactome:REACT_94168 Reactome:REACT_99687 Reactome:REACT_99790 GO:0004540 Catalysis of the hydrolysis of phosphodiester bonds in chains of RNA. ribonuclease activity GO:0005215 Enables the directed movement of substances (such as macromolecules, small molecules, ions) into, out of or within a cell, or between cells. transporter activity Reactome:REACT_6315 GO:0005488 The selective, non-covalent, often stoichiometric, interaction of a molecule with one or more specific sites on another molecule. binding Wikipedia:Binding_(molecular) GO:0005575 The part of a cell or its extracellular environment in which a gene product is located. A gene product may be located in one or more parts of a cell and its location may be as specific as a particular macromolecular complex, that is, a stable, persistent association of macromolecules that function together. cell or subcellular entity cellular component cellular_component NIF_Subcellular:sao-1337158144 NIF_Subcellular:sao1337158144 GO:0005622 The living contents of a cell; the matter contained within (but not including) the plasma membrane, usually taken to exclude large vacuoles and masses of secretory or ingested material. In eukaryotes it includes the nucleus and cytoplasm. internal to cell protoplasm intracellular Wikipedia:Intracellular GO:0005623 The basic structural and functional unit of all organisms. Includes the plasma membrane and any external encapsulating structures such as the cell wall and cell envelope. cell NIF_Subcellular:sao1813327414 Wikipedia:Cell_(biology) GO:0005634 A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent. cell nucleus nucleus NIF_Subcellular:sao1702920020 Wikipedia:Cell_nucleus GO:0005654 That part of the nuclear content other than the chromosomes or the nucleolus. nucleoplasm NIF_Subcellular:sao661522542 Wikipedia:Nucleoplasm GO:0005737 All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures. cytoplasm Wikipedia:Cytoplasm GO:0006139 Any cellular metabolic process involving nucleobases, nucleosides, nucleotides and nucleic acids. cellular nucleobase, nucleoside, nucleotide and nucleic acid metabolic process cellular nucleobase, nucleoside, nucleotide and nucleic acid metabolism nucleobase, nucleoside, nucleotide and nucleic acid metabolism nucleobase-containing compound metabolic process GO:0006351 The cellular synthesis of RNA on a template of DNA. DNA-dependent transcription cellular transcription, DNA-dependent transcription, DNA-dependent transcription, DNA-templated Wikipedia:Transcription_(genetics) GO:0006355 Any process that modulates the frequency, rate or extent of cellular DNA-templated transcription. regulation of cellular transcription, DNA-dependent regulation of transcription, DNA-dependent regulation of transcription, DNA-templated GO:0006357 Any process that modulates the frequency, rate or extent of transcription from an RNA polymerase II promoter. regulation of transcription from Pol II promoter regulation of transcription from RNA polymerase II promoter GO:0006379 Any process in which a pre-mRNA or mRNA molecule is cleaved at specific sites or in a regulated manner. mRNA cleavage GO:0006396 Any process involved in the conversion of one or more primary RNA transcripts into one or more mature RNA molecules. RNA processing Wikipedia:Post-transcriptional_modification GO:0006397 Any process involved in the conversion of a primary mRNA transcript into one or more mature mRNA(s) prior to translation into polypeptide. mRNA processing Reactome:REACT_100203 Reactome:REACT_107308 Reactome:REACT_109953 Reactome:REACT_113864 Reactome:REACT_114358 Reactome:REACT_115262 Reactome:REACT_1768 Reactome:REACT_32742 Reactome:REACT_33642 Reactome:REACT_82691 Reactome:REACT_90366 Reactome:REACT_91511 Reactome:REACT_93186 Reactome:REACT_94083 Reactome:REACT_96661 Reactome:REACT_97412 Reactome:REACT_97436 GO:0006401 The chemical reactions and pathways resulting in the breakdown of RNA, ribonucleic acid, one of the two main type of nucleic acid, consisting of a long, unbranched macromolecule formed from ribonucleotides joined in 3',5'-phosphodiester linkage. RNA breakdown RNA catabolism RNA degradation RNA catabolic process GO:0006403 A process in which RNA is transported to, or maintained in, a specific location. RNA localisation establishment and maintenance of RNA localization RNA localization GO:0006405 The directed movement of RNA from the nucleus to the cytoplasm. RNA export from cell nucleus RNA export out of nucleus RNA transport from nucleus to cytoplasm RNA-nucleus export RNA export from nucleus Reactome:REACT_1004 Reactome:REACT_104043 Reactome:REACT_108003 Reactome:REACT_114184 Reactome:REACT_1334 Reactome:REACT_29222 Reactome:REACT_30837 Reactome:REACT_30884 Reactome:REACT_53 Reactome:REACT_78063 Reactome:REACT_80132 Reactome:REACT_80198 Reactome:REACT_80579 Reactome:REACT_81658 Reactome:REACT_82156 Reactome:REACT_82661 Reactome:REACT_84373 Reactome:REACT_84418 Reactome:REACT_85495 Reactome:REACT_86488 Reactome:REACT_87758 Reactome:REACT_89603 Reactome:REACT_904 Reactome:REACT_90560 Reactome:REACT_91473 Reactome:REACT_92226 Reactome:REACT_95332 Reactome:REACT_98342 Reactome:REACT_99708 GO:0006412 The cellular metabolic process in which a protein is formed, using the sequence of a mature mRNA molecule to specify the sequence of amino acids in a polypeptide chain. Translation is mediated by the ribosome, and begins with the formation of a ternary complex between aminoacylated initiator methionine tRNA, GTP, and initiation factor 2, which subsequently associates with the small subunit of the ribosome and an mRNA. Translation ends with the release of a polypeptide chain from the ribosome. protein anabolism protein biosynthesis protein biosynthetic process protein formation protein synthesis protein translation translation Reactome:REACT_100338 Reactome:REACT_100851 Reactome:REACT_101045 Reactome:REACT_101324 Reactome:REACT_1014 Reactome:REACT_103420 Reactome:REACT_105544 Reactome:REACT_29980 Reactome:REACT_33559 Reactome:REACT_77710 Reactome:REACT_79784 Reactome:REACT_81734 Reactome:REACT_81833 Reactome:REACT_82171 Reactome:REACT_83429 Reactome:REACT_83530 Reactome:REACT_86996 Reactome:REACT_95535 Reactome:REACT_96394 Wikipedia:Translation_(genetics) GO:0006414 The successive addition of amino acid residues to a nascent polypeptide chain during protein biosynthesis. translation elongation translational elongation Reactome:REACT_100207 Reactome:REACT_100561 Reactome:REACT_101290 Reactome:REACT_101737 Reactome:REACT_102082 Reactome:REACT_103580 Reactome:REACT_108124 Reactome:REACT_108677 Reactome:REACT_108858 Reactome:REACT_1477 Reactome:REACT_30678 Reactome:REACT_31079 Reactome:REACT_80015 Reactome:REACT_80831 Reactome:REACT_81624 Reactome:REACT_82124 Reactome:REACT_88049 Reactome:REACT_93503 Reactome:REACT_96070 GO:0006417 Any process that modulates the frequency, rate or extent of the chemical reactions and pathways resulting in the formation of proteins by the translation of mRNA. regulation of protein anabolism regulation of protein biosynthesis regulation of protein formation regulation of protein synthesis regulation of translation GO:0006725 The chemical reactions and pathways involving aromatic compounds, any organic compound characterized by one or more planar rings, each of which contains conjugated double bonds and delocalized pi electrons, as carried out by individual cells. aromatic compound metabolism cellular aromatic compound metabolic process GO:0006810 The directed movement of substances (such as macromolecules, small molecules, ions) into, out of or within a cell, or between cells, or within a multicellular organism by means of some agent such as a transporter or pore. transport GO:0008150 Any process specifically pertinent to the functioning of integrated living units: cells, tissues, organs, and organisms. A process is a collection of molecular events with a defined beginning and end. biological process physiological process biological_process Wikipedia:Biological_process GO:0008152 The chemical reactions and pathways, including anabolism and catabolism, by which living organisms transform chemical substances. Metabolic processes typically transform small molecules, but also include macromolecular processes such as DNA repair and replication, and protein synthesis and degradation. metabolism metabolic process Wikipedia:Metabolism GO:0009056 The chemical reactions and pathways resulting in the breakdown of substances, including the breakdown of carbon compounds with the liberation of energy for use by the cell or organism. breakdown catabolism degradation catabolic process Wikipedia:Catabolism GO:0009057 The chemical reactions and pathways resulting in the breakdown of a macromolecule, any molecule of high relative molecular mass, the structure of which essentially comprises the multiple repetition of units derived, actually or conceptually, from molecules of low relative molecular mass. biopolymer catabolic process macromolecule breakdown macromolecule catabolism macromolecule degradation macromolecule catabolic process GO:0009058 The chemical reactions and pathways resulting in the formation of substances; typically the energy-requiring part of metabolism in which simpler substances are transformed into more complex ones. anabolism biosynthesis formation synthesis biosynthetic process Wikipedia:Anabolism GO:0009059 The chemical reactions and pathways resulting in the formation of a macromolecule, any molecule of high relative molecular mass, the structure of which essentially comprises the multiple repetition of units derived, actually or conceptually, from molecules of low relative molecular mass. biopolymer biosynthetic process macromolecule anabolism macromolecule biosynthesis macromolecule formation macromolecule synthesis macromolecule biosynthetic process GO:0009451 The covalent alteration of one or more nucleotides within an RNA molecule to produce an RNA molecule with a sequence that differs from that coded genetically. RNA modification Wikipedia:RNA_editing GO:0009889 Any process that modulates the frequency, rate or extent of the chemical reactions and pathways resulting in the formation of substances. regulation of anabolism regulation of biosynthesis regulation of formation regulation of synthesis regulation of biosynthetic process GO:0009890 Any process that stops, prevents, or reduces the rate of the chemical reactions and pathways resulting in the formation of substances. down regulation of biosynthetic process down-regulation of biosynthetic process downregulation of biosynthetic process negative regulation of anabolism negative regulation of biosynthesis negative regulation of formation negative regulation of synthesis negative regulation of biosynthetic process GO:0009891 Any process that activates or increases the frequency, rate or extent of the chemical reactions and pathways resulting in the formation of substances. positive regulation of anabolism positive regulation of biosynthesis positive regulation of formation positive regulation of synthesis up regulation of biosynthetic process up-regulation of biosynthetic process upregulation of biosynthetic process positive regulation of biosynthetic process GO:0009892 Any process that stops, prevents, or reduces the frequency, rate or extent of the chemical reactions and pathways within a cell or an organism. down regulation of metabolic process down-regulation of metabolic process downregulation of metabolic process negative regulation of metabolism negative regulation of metabolic process GO:0009893 Any process that activates or increases the frequency, rate or extent of the chemical reactions and pathways within a cell or an organism. positive regulation of metabolism up regulation of metabolic process up-regulation of metabolic process upregulation of metabolic process positive regulation of metabolic process GO:0009894 Any process that modulates the frequency, rate, or extent of the chemical reactions and pathways resulting in the breakdown of substances. regulation of breakdown regulation of catabolism regulation of degradation regulation of catabolic process GO:0009895 Any process that stops, prevents, or reduces the frequency, rate or extent of the chemical reactions and pathways resulting in the breakdown of substances. down regulation of catabolic process down-regulation of catabolic process downregulation of catabolic process negative regulation of breakdown negative regulation of catabolism negative regulation of degradation negative regulation of catabolic process GO:0009896 Any process that activates or increases the frequency, rate or extent of the chemical reactions and pathways resulting in the breakdown of substances. positive regulation of breakdown positive regulation of catabolism positive regulation of degradation up regulation of catabolic process up-regulation of catabolic process upregulation of catabolic process positive regulation of catabolic process GO:0009987 Any process that is carried out at the cellular level, but not necessarily restricted to a single cell. For example, cell communication occurs among more than one cell, but occurs at the cellular level. cell physiology cellular physiological process cellular process GO:0010033 Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of an organic substance stimulus. response to organic substance GO:0010267 Cleavage of double-stranded RNA to form trans-acting small interfering RNA molecules (siRNAs) of 21-23 nucleotides. ta-siRNAs arise from PolII genes and function like miRNAs to guide cleavage of target mRNAs. RNA interference, production of ta-siRNAs production of ta-siRNAs involved in RNA interference GO:0010445 A small round nuclear body, measuring 0.2-0.8 microns in diameter that is diffusely distributed throughout the nucleoplasm. Several proteins known to be involved in miRNA processing have been localized to these structures. D-bodies are thought to be involved in primary-miRNA processing and/or storage/assembly of miRNA processing complexes. D body nuclear dicing body GO:0010467 The process in which a gene's sequence is converted into a mature gene product or products (proteins or RNA). This includes the production of an RNA transcript as well as any processing to produce a mature RNA product or an mRNA (for protein-coding genes) and the translation of that mRNA into protein. Protein maturation is included when required to form an active form of a product from an inactive precursor form. gene expression Reactome:REACT_100537 Reactome:REACT_101147 Reactome:REACT_101952 Reactome:REACT_105649 Reactome:REACT_108313 Reactome:REACT_29068 Reactome:REACT_34240 Reactome:REACT_71 Reactome:REACT_78136 Reactome:REACT_78959 Reactome:REACT_79662 Reactome:REACT_85241 Reactome:REACT_85359 Reactome:REACT_86357 Reactome:REACT_89816 Reactome:REACT_91657 Reactome:REACT_91965 Reactome:REACT_93586 Reactome:REACT_93968 Reactome:REACT_94814 Reactome:REACT_98256 Wikipedia:Gene_expression GO:0010468 Any process that modulates the frequency, rate or extent of gene expression. Gene expression is the process in which a gene's coding sequence is converted into a mature gene product or products (proteins or RNA). This includes the production of an RNA transcript as well as any processing to produce a mature RNA product or an mRNA (for protein-coding genes) and the translation of that mRNA into protein. Protein maturation is included when required to form an active form of a product from an inactive precursor form. regulation of gene expression Wikipedia:Regulation_of_gene_expression GO:0010556 Any process that modulates the rate, frequency or extent of the chemical reactions and pathways resulting in the formation of a macromolecule, any molecule of high relative molecular mass, the structure of which essentially comprises the multiple repetition of units derived, actually or conceptually, from molecules of low relative molecular mass. regulation of macromolecule biosynthetic process GO:0010557 Any process that increases the rate, frequency or extent of the chemical reactions and pathways resulting in the formation of a macromolecule, any molecule of high relative molecular mass, the structure of which essentially comprises the multiple repetition of units derived, actually or conceptually, from molecules of low relative molecular mass. positive regulation of macromolecule biosynthetic process GO:0010558 Any process that decreases the rate, frequency or extent of the chemical reactions and pathways resulting in the formation of a macromolecule, any molecule of high relative molecular mass, the structure of which essentially comprises the multiple repetition of units derived, actually or conceptually, from molecules of low relative molecular mass. negative regulation of macromolecule biosynthetic process GO:0010586 The chemical reactions and pathways involving miRNA, microRNA, a class of single-stranded RNA molecules of about 21-23 nucleotides in length, which regulates gene expression. microRNA metabolic process miRNA metabolic process GO:0010587 The chemical reactions and pathways resulting in the breakdown of miRNA, microRNA, a class of single-stranded RNA molecules of about 21-23 nucleotides in length, which regulates gene expression. microRNA catabolic process miRNA catabolic process GO:0010604 Any process that increases the frequency, rate or extent of the chemical reactions and pathways involving macromolecules, any molecule of high relative molecular mass, the structure of which essentially comprises the multiple repetition of units derived, actually or conceptually, from molecules of low relative molecular mass. positive regulation of macromolecule metabolic process GO:0010605 Any process that decreases the frequency, rate or extent of the chemical reactions and pathways involving macromolecules, any molecule of high relative molecular mass, the structure of which essentially comprises the multiple repetition of units derived, actually or conceptually, from molecules of low relative molecular mass. negative regulation of macromolecule metabolic process GO:0010608 Any process that modulates the frequency, rate or extent of gene expression after the production of an RNA transcript. posttranscriptional regulation of gene expression GO:0010628 Any process that increases the frequency, rate or extent of gene expression. Gene expression is the process in which a gene's coding sequence is converted into a mature gene product or products (proteins or RNA). This includes the production of an RNA transcript as well as any processing to produce a mature RNA product or an mRNA (for protein-coding genes) and the translation of that mRNA into protein. Protein maturation is included when required to form an active form of a product from an inactive precursor form. positive regulation of gene expression GO:0010629 Any process that decreases the frequency, rate or extent of gene expression. Gene expression is the process in which a gene's coding sequence is converted into a mature gene product or products (proteins or RNA). This includes the production of an RNA transcript as well as any processing to produce a mature RNA product or an mRNA (for protein-coding genes) and the translation of that mRNA into protein. Protein maturation is included when required to form an active form of a product from an inactive precursor form. negative regulation of gene expression GO:0014070 Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of an organic cyclic compound stimulus. response to organic cyclic substance response to organic cyclic compound GO:0016043 A process that results in the assembly, arrangement of constituent parts, or disassembly of a cellular component. cell organisation cellular component organisation at cellular level cellular component organisation in other organism cellular component organization at cellular level cellular component organization in other organism cellular component organization GO:0016070 The cellular chemical reactions and pathways involving RNA, ribonucleic acid, one of the two main type of nucleic acid, consisting of a long, unbranched macromolecule formed from ribonucleotides joined in 3',5'-phosphodiester linkage. RNA metabolism RNA metabolic process Reactome:REACT_107259 Reactome:REACT_107652 Reactome:REACT_110289 Reactome:REACT_21257 Reactome:REACT_30579 Reactome:REACT_31367 Reactome:REACT_33720 Reactome:REACT_80071 Reactome:REACT_83630 Reactome:REACT_84169 Reactome:REACT_85788 Reactome:REACT_88316 Reactome:REACT_89992 Reactome:REACT_91556 Reactome:REACT_92152 Reactome:REACT_94876 Reactome:REACT_99403 Reactome:REACT_99885 GO:0016246 The process in which double-stranded RNAs silence cognate genes. Involves posttranscriptional gene inactivation ('silencing') both of transgenes or dsRNA introduced into a germline, and of the host gene(s) homologous to the transgenes or dsRNA. This silencing is triggered by the introduction of transgenes or double-stranded RNA (dsRNA), and can occur through a specific decrease in the level of mRNA, or by negative regulation of translation, of both host genes and transgenes. RNAi posttranscriptional gene silencing by siRNA RNA interference Wikipedia:RNA_interference GO:0016441 The inactivation of gene expression by a posttranscriptional mechanism. PTGS post-transcriptional gene silencing quelling posttranscriptional gene silencing Wikipedia:Post_transcriptional_gene_silencing GO:0016442 A ribonucleoprotein complex that contains members of the Argonaute family of proteins, small interfering RNAs (siRNAs) or microRNAs (miRNAs), and miRNA or siRNA-complementary mRNAs, in addition to a number of accessory factors. The RISC complex is involved in posttranscriptional repression of gene expression through downregulation of translation or induction of mRNA degradation. RNA-induced silencing complex RISC complex Wikipedia:RNA-induced_silencing_complex GO:0016458 Any process carried out at the cellular level that results in either long-term transcriptional repression via action on chromatin structure or RNA mediated, postranscriptional repression of gene expression. gene silencing Wikipedia:Gene_silencing GO:0016891 Catalysis of the hydrolysis of ester linkages within ribonucleic acids by creating internal breaks to yield 5'-phosphomonoesters. endoribonuclease activity, producing 5'-phosphomonoesters EC:3.1.26 GO:0016896 Catalysis of the hydrolysis of ester linkages within ribonucleic acids by removing nucleotide residues from the 3' or 5' end to yield 5' phosphomonoesters. exoribonuclease activity, producing 5' phosphomonoesters exoribonuclease activity, producing 5'-phosphomonoesters EC:3.1.13 Reactome:REACT_109371 Reactome:REACT_20560 Reactome:REACT_81094 Reactome:REACT_89209 Reactome:REACT_90720 Reactome:REACT_92855 Reactome:REACT_93863 Reactome:REACT_97640 Reactome:REACT_98936 GO:0017148 Any process that stops, prevents, or reduces the frequency, rate or extent of the chemical reactions and pathways resulting in the formation of proteins by the translation of mRNA. down regulation of protein biosynthetic process down-regulation of protein biosynthetic process downregulation of protein biosynthetic process negative regulation of protein anabolism negative regulation of protein biosynthesis negative regulation of protein biosynthetic process negative regulation of protein formation negative regulation of protein synthesis negative regulation of translation GO:0018130 The chemical reactions and pathways resulting in the formation of heterocyclic compounds, those with a cyclic molecular structure and at least two different atoms in the ring (or rings). heterocycle anabolism heterocycle biosynthesis heterocycle formation heterocycle synthesis heterocycle biosynthetic process GO:0019219 Any cellular process that modulates the frequency, rate or extent of the chemical reactions and pathways involving nucleobases, nucleosides, nucleotides and nucleic acids. regulation of nucleobase, nucleoside, nucleotide and nucleic acid metabolism regulation of nucleobase-containing compound metabolic process GO:0019222 Any process that modulates the frequency, rate or extent of the chemical reactions and pathways within a cell or an organism. regulation of metabolism regulation of metabolic process GO:0019438 The chemical reactions and pathways resulting in the formation of aromatic compounds, any substance containing an aromatic carbon ring. aromatic compound anabolism aromatic compound biosynthesis aromatic compound formation aromatic compound synthesis aromatic compound biosynthetic process GO:0019439 The chemical reactions and pathways resulting in the breakdown of aromatic compounds, any substance containing an aromatic carbon ring. aromatic compound breakdown aromatic compound catabolism aromatic compound degradation aromatic compound catabolic process GO:0019538 The chemical reactions and pathways involving a specific protein, rather than of proteins in general. Includes protein modification. protein metabolic process and modification protein metabolism protein metabolism and modification protein metabolic process Wikipedia:Protein_metabolism GO:0022613 A cellular process that results in the biosynthesis of constituent macromolecules, assembly, and arrangement of constituent parts of a complex containing RNA and proteins. Includes the biosynthesis of the constituent RNA and protein molecules, and those macromolecular modifications that are involved in synthesis or assembly of the ribonucleoprotein complex. RNA-protein complex biogenesis ribonucleoprotein complex biogenesis and assembly ribonucleoprotein complex biogenesis GO:0022618 The aggregation, arrangement and bonding together of proteins and RNA molecules to form a ribonucleoprotein complex. RNA-protein complex assembly RNP complex assembly protein-RNA complex assembly ribonucleoprotein complex assembly GO:0030422 Cleavage of double-stranded RNA to form small interfering RNA molecules (siRNAs) of 21-23 nucleotides, in the context of RNA interference. RNA interference, production of guide RNAs RNA interference, production of siRNA production of guide RNAs involved in RNA interference production of siRNA involved in RNA interference GO:0030529 A macromolecular complex containing both protein and RNA molecules. RNA-protein complex RNP protein-RNA complex ribonucleoprotein ribonucleoprotein complex Wikipedia:Ribonucleoprotein GO:0031050 Cleavage of double-stranded RNA molecules by an RNaseIII-family enzyme to produce small RNAs (generally 20-30 nucleotides, depending on species) with biological function. double-stranded RNA fragmentation dsRNA fragmentation GO:0031053 Any process involved in the conversion of a primary microRNA transcript into a pre-microRNA molecule. pri-miRNA processing primary microRNA processing primary miRNA processing GO:0031054 Any process involved in the conversion of a pre-microRNA transcript into a mature microRNA molecule. pre-microRNA processing pre-miRNA processing GO:0031323 Any process that modulates the frequency, rate or extent of the chemical reactions and pathways by which individual cells transform chemical substances. regulation of cellular metabolism regulation of cellular metabolic process GO:0031324 Any process that stops, prevents, or reduces the frequency, rate or extent of the chemical reactions and pathways by which individual cells transform chemical substances. down regulation of cellular metabolic process down-regulation of cellular metabolic process downregulation of cellular metabolic process negative regulation of cellular metabolism negative regulation of cellular metabolic process GO:0031325 Any process that activates or increases the frequency, rate or extent of the chemical reactions and pathways by which individual cells transform chemical substances. positive regulation of cellular metabolism up regulation of cellular metabolic process up-regulation of cellular metabolic process upregulation of cellular metabolic process positive regulation of cellular metabolic process Reactome:REACT_101225 Reactome:REACT_102187 Reactome:REACT_102331 Reactome:REACT_105293 Reactome:REACT_108571 Reactome:REACT_109170 Reactome:REACT_2122 Reactome:REACT_28360 Reactome:REACT_31270 Reactome:REACT_79603 Reactome:REACT_80902 Reactome:REACT_83058 Reactome:REACT_84314 Reactome:REACT_86633 Reactome:REACT_87840 Reactome:REACT_88060 Reactome:REACT_91293 Reactome:REACT_91429 Reactome:REACT_91906 Reactome:REACT_92487 Reactome:REACT_99393 GO:0031326 Any process that modulates the frequency, rate or extent of the chemical reactions and pathways resulting in the formation of substances, carried out by individual cells. regulation of cellular anabolism regulation of cellular biosynthesis regulation of cellular formation regulation of cellular synthesis regulation of cellular biosynthetic process GO:0031327 Any process that stops, prevents, or reduces the frequency, rate or extent of the chemical reactions and pathways resulting in the formation of substances, carried out by individual cells. down regulation of cellular biosynthetic process down-regulation of cellular biosynthetic process downregulation of cellular biosynthetic process negative regulation of cellular anabolism negative regulation of cellular biosynthesis negative regulation of cellular formation negative regulation of cellular synthesis negative regulation of cellular biosynthetic process GO:0031328 Any process that activates or increases the frequency, rate or extent of the chemical reactions and pathways resulting in the formation of substances, carried out by individual cells. positive regulation of cellular anabolism positive regulation of cellular biosynthesis positive regulation of cellular formation positive regulation of cellular synthesis up regulation of cellular biosynthetic process up-regulation of cellular biosynthetic process upregulation of cellular biosynthetic process positive regulation of cellular biosynthetic process GO:0031329 Any process that modulates the frequency, rate or extent of the chemical reactions and pathways resulting in the breakdown of substances, carried out by individual cells. regulation of cellular breakdown regulation of cellular catabolism regulation of cellular degradation regulation of cellular catabolic process GO:0031330 Any process that stops, prevents, or reduces the frequency, rate or extent of the chemical reactions and pathways resulting in the breakdown of substances, carried out by individual cells. down regulation of cellular catabolic process down-regulation of cellular catabolic process downregulation of cellular catabolic process negative regulation of cellular breakdown negative regulation of cellular catabolism negative regulation of cellular degradation negative regulation of cellular catabolic process GO:0031331 Any process that activates or increases the frequency, rate or extent of the chemical reactions and pathways resulting in the breakdown of substances, carried out by individual cells. positive regulation of cellular breakdown positive regulation of cellular catabolism positive regulation of cellular degradation up regulation of cellular catabolic process up-regulation of cellular catabolic process upregulation of cellular catabolic process positive regulation of cellular catabolic process GO:0031981 The volume enclosed by the nuclear inner membrane. nuclear lumen GO:0032268 Any process that modulates the frequency, rate or extent of the chemical reactions and pathways involving a protein, occurring at the level of an individual cell. regulation of cellular protein metabolism regulation of cellular protein metabolic process GO:0032269 Any process that stops, prevents, or reduces the frequency, rate or extent of the chemical reactions and pathways involving a protein, occurring at the level of an individual cell. down regulation of cellular protein metabolic process down-regulation of cellular protein metabolic process downregulation of cellular protein metabolic process negative regulation of cellular protein metabolism negative regulation of cellular protein metabolic process GO:0032774 The chemical reactions and pathways resulting in the formation of RNA, ribonucleic acid, one of the two main type of nucleic acid, consisting of a long, unbranched macromolecule formed from ribonucleotides joined in 3',5'-phosphodiester linkage. Includes polymerization of ribonucleotide monomers. Refers not only to transcription but also to e.g. viral RNA replication. RNA anabolism RNA biosynthesis RNA formation RNA synthesis RNA biosynthetic process GO:0032991 A stable assembly of two or more macromolecules, i.e. proteins, nucleic acids, carbohydrates or lipids, in which the constituent parts function together. macromolecule complex macromolecular complex GO:0033391 A ribonucleoprotein complex found in the cytoplasm of male germ cells, composed of exceedingly thin filaments that are consolidated into a compact mass or into dense strands of varying thickness that branch to form an irregular network. Contains mRNAs, miRNAs, and protein components involved in miRNA processing (such as Argonaute proteins and the endonuclease Dicer) and in RNA decay (such as the decapping enzyme DCP1a and GW182). chromatoid body GO:0034470 Any process that results in the conversion of one or more primary non-coding RNA (ncRNA) transcripts into one or more mature ncRNA molecules. ncRNA processing GO:0034641 The chemical reactions and pathways involving various organic and inorganic nitrogenous compounds, as carried out by individual cells. cellular nitrogen compound metabolism cellular nitrogen compound metabolic process Reactome:REACT_102000 Reactome:REACT_103710 Reactome:REACT_107293 Reactome:REACT_108179 Reactome:REACT_109042 Reactome:REACT_13 Reactome:REACT_28699 Reactome:REACT_29108 Reactome:REACT_32429 Reactome:REACT_33347 Reactome:REACT_34326 Reactome:REACT_55564 Reactome:REACT_77741 Reactome:REACT_82379 Reactome:REACT_86268 Reactome:REACT_90299 Reactome:REACT_91959 Reactome:REACT_93580 Reactome:REACT_95666 Reactome:REACT_98086 Reactome:REACT_99241 GO:0034645 The chemical reactions and pathways resulting in the formation of a macromolecule, any molecule of high relative molecular mass, the structure of which essentially comprises the multiple repetition of units derived, actually or conceptually, from molecules of low relative molecular mass, carried out by individual cells. cellular biopolymer biosynthetic process cellular macromolecule anabolism cellular macromolecule biosynthesis cellular macromolecule formation cellular macromolecule synthesis cellular macromolecule biosynthetic process GO:0034654 The chemical reactions and pathways resulting in the formation of nucleobases, nucleosides, nucleotides and nucleic acids. nucleobase, nucleoside, nucleotide and nucleic acid anabolism nucleobase, nucleoside, nucleotide and nucleic acid biosynthesis nucleobase, nucleoside, nucleotide and nucleic acid formation nucleobase-containing compound biosynthetic process GO:0034655 The chemical reactions and pathways resulting in the breakdown of nucleobases, nucleosides, nucleotides and nucleic acids. nucleobase, nucleoside, nucleotide and nucleic acid breakdown nucleobase, nucleoside, nucleotide and nucleic acid catabolism nucleobase, nucleoside, nucleotide and nucleic acid degradation nucleobase-containing compound catabolic process GO:0034660 The chemical reactions and pathways involving non-coding RNA transcripts (ncRNAs). ncRNA metabolism ncRNA metabolic process Reactome:REACT_104424 Reactome:REACT_107260 Reactome:REACT_11052 Reactome:REACT_31743 Reactome:REACT_34395 Reactome:REACT_77416 Reactome:REACT_82057 Reactome:REACT_87487 Reactome:REACT_91823 Reactome:REACT_92649 Reactome:REACT_94145 GO:0034661 The chemical reactions and pathways resulting in the breakdown of non-coding RNA transcripts (ncRNAs). Includes the breakdown of cryptic unstable transcripts (CUTs). ncRNA breakdown ncRNA catabolism ncRNA degradation ncRNA catabolic process GO:0035068 A complex containing both protein and micro-RNA (miRNA) molecules. miRNAs are approximately 22 nucleotide noncoding RNAs derived from endogenous genes; they are processed from the stem of a longer hairpin like structure termed a pre-miRNA. miRNP complex micro-ribonucleoprotein complex GO:0035194 Any process of posttranscriptional gene inactivation (silencing) mediated by small RNA molecules that may trigger mRNA degradation or negatively regulate translation. RNA-mediated posttranscriptional gene silencing posttranscriptional gene silencing by RNA GO:0035195 Downregulation of gene expression through the action of microRNAs (miRNAs), endogenous 21-24 nucleotide small RNAs processed from stem-loop RNA precursors (pre-miRNAs). Once incorporated into a RNA-induced silencing complex (RISC), miRNAs can downregulate gene expression by either of two posttranscriptional mechanisms: endolytic cleavage of mRNA cleavage or translational repression, usually accompanied by poly-A tail shortgening and subsequent degredation of the mRNA. gene silencing by microRNA miRNA-mediated gene silencing microRNA-mediated gene silencing gene silencing by miRNA GO:0035196 Cleavage of stem-loop RNA precursors into microRNAs (miRNAs), a class of small RNAs that primarily silence genes by blocking the translation of mRNA transcripts into protein. gene silencing by miRNA, production of miRNAs miRNA processing miRNA-mediated gene silencing, production of miRNAs microRNA-mediated gene silencing, production of microRNAs production of microRNAs involved in gene silencing by microRNA production of miRNAs involved in gene silencing by miRNA GO:0035198 Interacting selectively and non-covalently with a microRNA, a 21-23 nucleotide RNA that is processed from a stem-loop RNA precursor (pre-miRNA) that is encoded within plant and animal genomes. microRNA binding miRNA binding GO:0035278 The process in which microRNAs (miRNAs) block the translation of target mRNAs into proteins. Once incorporated into a RNA-induced silencing complex (RISC), a miRNA will typically repress translation if the miRNA imperfectly base-pairs with the 3' untranslated regions of target mRNAs. down regulation of translation involved in gene silencing by miRNA down-regulation of translation involved in gene silencing by miRNA downregulation of translation involved in gene silencing by miRNA gene silencing by miRNA, negative regulation of translation negative regulation of translation involved in gene silencing by microRNA negative regulation of translation involved in gene silencing by miRNA GO:0035279 The process in which microRNAs (miRNAs) direct the cleavage of target mRNAs. Once incorporated into a RNA-induced silencing complex (RISC), a miRNA base pairing with near-perfect complementarity to the target mRNA will typically direct targeted endonucleolytic cleavage of the mRNA. Many plant miRNAs downregulate gene expression through this mechanism. gene silencing by miRNA, mRNA cleavage mRNA cleavage involved in gene silencing by microRNA miRNA-mediated gene silencing, mRNA cleavage mRNA cleavage involved in gene silencing by miRNA GO:0035280 The transfer of a microRNA (miRNA) strand from a miRNA:miRNA duplex onto the RNA-initiated silencing complex (RISC). gene silencing by miRNA, miRNA loading onto RISC miRNA-mediated gene silencing, miRNA loading onto RISC microRNA loading onto RISC involved in gene silencing by microRNA miRNA loading onto RISC involved in gene silencing by miRNA GO:0035281 Transport of pre-microRNAs (pre-miRNAs) from the nucleus to the cytoplasm. Pre-miRNAs are a ~60-70 nucleotide stem loop intermediate in miRNA production, produced by the nuclear cleavage of a primary miRNA (pri-mRNA) transcript. Pre-miRNAs are transported from the nucleus to the cytoplasm where further cleavage occurs to produce a mature miRNA product. pre-microRNA export from cell nucleus pre-microRNA export out of nucleus pre-microRNA transport from nucleus to cytoplasm pre-microRNA-nucleus export pre-miRNA export from nucleus GO:0035770 A non-membranous macromolecular complex containing proteins and translationally silenced mRNAs. RNA granules contain proteins that control the localization, stability, and translation of their RNA cargo. Different types of RNA granules (RGs) exist, depending on the cell type and cellular conditions. RNP granule mRNP granule ribonucleoprotein granule GO:0036464 A ribonucleoprotein granule located in the cytoplasm. cytoplasmic ribonucleoprotein granule GO:0040033 Any process, mediated by small non-coding RNAs, that stops, prevents or reduces the rate that mRNAs are effectively translated into protein. down regulation of mRNA translation, ncRNA-mediated down-regulation of mRNA translation, ncRNA-mediated downregulation of mRNA translation, ncRNA-mediated negative regulation of translation, ncRNA-mediated GO:0042221 Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a chemical stimulus. response to chemical stimulus response to chemical substance response to chemical GO:0043170 The chemical reactions and pathways involving macromolecules, any molecule of high relative molecular mass, the structure of which essentially comprises the multiple repetition of units derived, actually or conceptually, from molecules of low relative molecular mass. biopolymer metabolic process macromolecule metabolism macromolecule metabolic process GO:0043226 Organized structure of distinctive morphology and function. Includes the nucleus, mitochondria, plastids, vacuoles, vesicles, ribosomes and the cytoskeleton, and prokaryotic structures such as anammoxosomes and pirellulosomes. Excludes the plasma membrane. organelle NIF_Subcellular:sao1539965131 Wikipedia:Organelle GO:0043229 Organized structure of distinctive morphology and function, occurring within the cell. Includes the nucleus, mitochondria, plastids, vacuoles, vesicles, ribosomes and the cytoskeleton. Excludes the plasma membrane. intracellular organelle GO:0043231 Organized structure of distinctive morphology and function, bounded by a single or double lipid bilayer membrane and occurring within the cell. Includes the nucleus, mitochondria, plastids, vacuoles, and vesicles. Excludes the plasma membrane. intracellular membrane-enclosed organelle intracellular membrane-bounded organelle GO:0043232 Organized structure of distinctive morphology and function, not bounded by a lipid bilayer membrane and occurring within the cell. Includes ribosomes, the cytoskeleton and chromosomes. intracellular non-membrane-enclosed organelle intracellular non-membrane-bounded organelle GO:0043233 The internal volume enclosed by the membranes of a particular organelle; includes the volume enclosed by a single organelle membrane, e.g. endoplasmic reticulum lumen, or the volume enclosed by the innermost of the two lipid bilayers of an organelle envelope, e.g. nuclear lumen. organelle lumen GO:0043331 Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a double-stranded RNA stimulus. response to double-stranded RNA response to dsRNA GO:0043628 Any process involved in forming the mature 3' end of a non-coding RNA molecule. ncRNA 3' end processing ncRNA 3'-end processing GO:0043933 Any process in which macromolecules aggregate, disaggregate, or are modified, resulting in the formation, disassembly, or alteration of a macromolecular complex. cellular macromolecular complex organization cellular macromolecular complex subunit organisation cellular macromolecular complex subunit organization macromolecular complex organization macromolecular complex subunit organisation macromolecular complex subunit organization GO:0044237 The chemical reactions and pathways by which individual cells transform chemical substances. cellular metabolism cellular metabolic process GO:0044238 The chemical reactions and pathways involving those compounds which are formed as a part of the normal anabolic and catabolic processes. These processes take place in most, if not all, cells of the organism. primary metabolism primary metabolic process GO:0044248 The chemical reactions and pathways resulting in the breakdown of substances, carried out by individual cells. cellular breakdown cellular catabolism cellular degradation cellular catabolic process GO:0044249 The chemical reactions and pathways resulting in the formation of substances, carried out by individual cells. cellular anabolism cellular biosynthesis cellular formation cellular synthesis cellular biosynthetic process GO:0044260 The chemical reactions and pathways involving macromolecules, any molecule of high relative molecular mass, the structure of which essentially comprises the multiple repetition of units derived, actually or conceptually, from molecules of low relative molecular mass, as carried out by individual cells. cellular biopolymer metabolic process cellular macromolecule metabolism cellular macromolecule metabolic process GO:0044265 The chemical reactions and pathways resulting in the breakdown of a macromolecule, any large molecule including proteins, nucleic acids and carbohydrates, as carried out by individual cells. cellular biopolymer catabolic process cellular macromolecule breakdown cellular macromolecule catabolism cellular macromolecule degradation cellular macromolecule catabolic process GO:0044267 The chemical reactions and pathways involving a specific protein, rather than of proteins in general, occurring at the level of an individual cell. Includes cellular protein modification. cellular protein metabolism cellular protein metabolic process Reactome:REACT_101554 Reactome:REACT_102155 Reactome:REACT_105825 Reactome:REACT_106151 Reactome:REACT_108005 Reactome:REACT_109022 Reactome:REACT_17015 Reactome:REACT_32904 Reactome:REACT_34473 Reactome:REACT_80561 Reactome:REACT_81994 Reactome:REACT_82523 Reactome:REACT_85873 Reactome:REACT_86658 Reactome:REACT_89852 Reactome:REACT_91052 Reactome:REACT_93132 Reactome:REACT_96466 Reactome:REACT_99179 GO:0044270 The chemical reactions and pathways resulting in the breakdown of organic and inorganic nitrogenous compounds. cellular nitrogen compound catabolic process GO:0044271 The chemical reactions and pathways resulting in the formation of organic and inorganic nitrogenous compounds. cellular nitrogen compound biosynthetic process GO:0044422 Any constituent part of an organelle, an organized structure of distinctive morphology and function. Includes constituent parts of the nucleus, mitochondria, plastids, vacuoles, vesicles, ribosomes and the cytoskeleton, but excludes the plasma membrane. organelle part GO:0044424 Any constituent part of the living contents of a cell; the matter contained within (but not including) the plasma membrane, usually taken to exclude large vacuoles and masses of secretory or ingested material. In eukaryotes it includes the nucleus and cytoplasm. intracellular part GO:0044428 Any constituent part of the nucleus, a membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. nuclear subcomponent nucleus component nuclear part NIF_Subcellular:sao1499850686 GO:0044444 Any constituent part of the cytoplasm, all of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures. cytoplasm component cytoplasmic part GO:0044446 A constituent part of an intracellular organelle, an organized structure of distinctive morphology and function, occurring within the cell. Includes constituent parts of the nucleus, mitochondria, plastids, vacuoles, vesicles, ribosomes and the cytoskeleton but excludes the plasma membrane. intracellular organelle part GO:0044451 Any constituent part of the nucleoplasm, that part of the nuclear content other than the chromosomes or the nucleolus. nucleoplasm part GO:0044464 Any constituent part of a cell, the basic structural and functional unit of all organisms. cellular subcomponent cell part NIF_Subcellular:sao628508602 GO:0044699 A biological process that involves only one organism. single organism process single-organism process GO:0044710 A metabolic process - chemical reactions and pathways, including anabolism and catabolism, by which living organisms transform chemical substances - which involves a single organism. single-organism metabolic process GO:0044747 Any process involved in forming distinct miRNA isoforms from a mature miRNA that differ at their 3'-ends. mature miRNA 3'-end processing GO:0044748 Catalysis of the sequential cleavage of mononucleotides from a free 3' terminus of an RNA molecule that contributes to forming distinct miRNA isoforms from a mature miRNA. 3'-5'-exoribonuclease activity involved in mature miRNA 3'-end processing GO:0044763 Any process that is carried out at the cellular level, occurring within a single organism. single-organism cellular process GO:0044765 The directed movement of substances (such as macromolecules, small molecules, ions) into, out of or within a cell, or between cells, or within a multicellular organism by means of some agent such as a transporter or pore, involving a single organism. single-organism transport GO:0045892 Any process that stops, prevents, or reduces the frequency, rate or extent of cellular DNA-templated transcription. down regulation of transcription, DNA-dependent down-regulation of transcription, DNA-dependent downregulation of transcription, DNA-dependent negative regulation of cellular transcription, DNA-dependent negative regulation of transcription, DNA-dependent negative regulation of transcription, DNA-templated GO:0045893 Any process that activates or increases the frequency, rate or extent of cellular DNA-templated transcription. positive regulation of cellular transcription, DNA-dependent positive regulation of transcription, DNA-dependent up regulation of transcription, DNA-dependent up-regulation of transcription, DNA-dependent upregulation of transcription, DNA-dependent positive regulation of transcription, DNA-templated GO:0045934 Any cellular process that stops, prevents, or reduces the frequency, rate or extent of the chemical reactions and pathways involving nucleobases, nucleosides, nucleotides and nucleic acids. down regulation of nucleobase, nucleoside, nucleotide and nucleic acid metabolic process down-regulation of nucleobase, nucleoside, nucleotide and nucleic acid metabolic process downregulation of nucleobase, nucleoside, nucleotide and nucleic acid metabolic process negative regulation of nucleobase, nucleoside, nucleotide and nucleic acid metabolism negative regulation of nucleobase-containing compound metabolic process GO:0045935 Any cellular process that activates or increases the frequency, rate or extent of the chemical reactions and pathways involving nucleobases, nucleosides, nucleotides and nucleic acids. positive regulation of nucleobase, nucleoside, nucleotide and nucleic acid metabolism up regulation of nucleobase, nucleoside, nucleotide and nucleic acid metabolic process up-regulation of nucleobase, nucleoside, nucleotide and nucleic acid metabolic process upregulation of nucleobase, nucleoside, nucleotide and nucleic acid metabolic process positive regulation of nucleobase-containing compound metabolic process GO:0045944 Any process that activates or increases the frequency, rate or extent of transcription from an RNA polymerase II promoter. activation of transcription from RNA polymerase II promoter positive regulation of transcription from Pol II promoter stimulation of transcription from RNA polymerase II promoter up regulation of transcription from RNA polymerase II promoter up-regulation of transcription from RNA polymerase II promoter upregulation of transcription from RNA polymerase II promoter positive regulation of transcription from RNA polymerase II promoter GO:0046483 The chemical reactions and pathways involving heterocyclic compounds, those with a cyclic molecular structure and at least two different atoms in the ring (or rings). heterocycle metabolism heterocycle metabolic process GO:0046700 The chemical reactions and pathways resulting in the breakdown of heterocyclic compounds, those with a cyclic molecular structure and at least two different atoms in the ring (or rings). heterocycle breakdown heterocycle catabolism heterocycle degradation heterocycle catabolic process GO:0046907 The directed movement of substances within a cell. intracellular transport GO:0048518 Any process that activates or increases the frequency, rate or extent of a biological process. Biological processes are regulated by many means; examples include the control of gene expression, protein modification or interaction with a protein or substrate molecule. positive regulation of physiological process up regulation of biological process up-regulation of biological process upregulation of biological process positive regulation of biological process GO:0048519 Any process that stops, prevents, or reduces the frequency, rate or extent of a biological process. Biological processes are regulated by many means; examples include the control of gene expression, protein modification or interaction with a protein or substrate molecule. down regulation of biological process down-regulation of biological process downregulation of biological process negative regulation of physiological process negative regulation of biological process GO:0048522 Any process that activates or increases the frequency, rate or extent of a cellular process, any of those that are carried out at the cellular level, but are not necessarily restricted to a single cell. For example, cell communication occurs among more than one cell, but occurs at the cellular level. positive regulation of cellular physiological process up regulation of cellular process up-regulation of cellular process upregulation of cellular process positive regulation of cellular process GO:0048523 Any process that stops, prevents, or reduces the frequency, rate or extent of a cellular process, any of those that are carried out at the cellular level, but are not necessarily restricted to a single cell. For example, cell communication occurs among more than one cell, but occurs at the cellular level. down regulation of cellular process down-regulation of cellular process downregulation of cellular process negative regulation of cellular physiological process negative regulation of cellular process GO:0048583 Any process that modulates the frequency, rate or extent of a response to a stimulus. Response to stimulus is a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus. regulation of response to stimulus GO:0048584 Any process that activates, maintains or increases the rate of a response to a stimulus. Response to stimulus is a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus. up regulation of response to stimulus up-regulation of response to stimulus upregulation of response to stimulus positive regulation of response to stimulus GO:0048585 Any process that stops, prevents, or reduces the frequency, rate or extent of a response to a stimulus. Response to stimulus is a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus. down regulation of response to stimulus down-regulation of response to stimulus downregulation of response to stimulus negative regulation of response to stimulus GO:0050658 The directed movement of RNA, ribonucleic acids, into, out of or within a cell, or between cells, by means of some agent such as a transporter or pore. RNA transport GO:0050789 Any process that modulates the frequency, rate or extent of a biological process. Biological processes are regulated by many means; examples include the control of gene expression, protein modification or interaction with a protein or substrate molecule. regulation of physiological process regulation of biological process GO:0050794 Any process that modulates the frequency, rate or extent of a cellular process, any of those that are carried out at the cellular level, but are not necessarily restricted to a single cell. For example, cell communication occurs among more than one cell, but occurs at the cellular level. regulation of cellular physiological process regulation of cellular process GO:0050896 Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus. The process begins with detection of the stimulus and ends with a change in state or activity or the cell or organism. physiological response to stimulus response to stimulus GO:0051168 The directed movement of substances out of the nucleus. export from nucleus nucleus export substance nuclear export nuclear export Reactome:REACT_10069 Reactome:REACT_103510 Reactome:REACT_112801 Reactome:REACT_113944 Reactome:REACT_31254 Reactome:REACT_83378 Reactome:REACT_89070 Reactome:REACT_92337 Reactome:REACT_92521 Reactome:REACT_92868 Reactome:REACT_96465 GO:0051171 Any process that modulates the frequency, rate or extent of the chemical reactions and pathways involving nitrogen or nitrogenous compounds. regulation of nitrogen metabolic process regulation of nitrogen metabolism regulation of nitrogen compound metabolic process GO:0051172 Any process that stops, prevents, or reduces the frequency, rate or extent of the chemical reactions and pathways involving nitrogen or nitrogenous compounds. down regulation of nitrogen metabolic process down-regulation of nitrogen metabolic process downregulation of nitrogen metabolic process negative regulation of nitrogen metabolic process negative regulation of nitrogen metabolism negative regulation of nitrogen compound metabolic process GO:0051173 Any process that activates or increases the frequency, rate or extent of the chemical reactions and pathways involving nitrogen or nitrogenous compounds. positive regulation of nitrogen metabolic process positive regulation of nitrogen metabolism up regulation of nitrogen metabolic process up-regulation of nitrogen metabolic process upregulation of nitrogen metabolic process positive regulation of nitrogen compound metabolic process GO:0051179 Any process in which a cell, a substance, or a cellular entity, such as a protein complex or organelle, is transported to or maintained in a specific location. establishment and maintenance of localization establishment and maintenance of position localisation localization GO:0051234 The directed movement of a cell, substance or cellular entity, such as a protein complex or organelle, to a specific location. establishment of localisation establishment of localization GO:0051236 The directed movement of RNA to a specific location. RNA positioning RNA recruitment establishment of RNA localisation establishment of RNA localization GO:0051246 Any process that modulates the frequency, rate or extent of the chemical reactions and pathways involving a protein. regulation of protein metabolism regulation of protein metabolic process GO:0051248 Any process that stops, prevents, or reduces the frequency, rate or extent of chemical reactions and pathways involving a protein. down regulation of protein metabolic process down-regulation of protein metabolic process downregulation of protein metabolic process negative regulation of protein metabolism negative regulation of protein metabolic process GO:0051252 Any process that modulates the frequency, rate or extent of the chemical reactions and pathways involving RNA. regulation of RNA metabolism regulation of RNA metabolic process GO:0051253 Any process that stops, prevents, or reduces the frequency, rate or extent of the chemical reactions and pathways involving RNA. down regulation of RNA metabolic process down-regulation of RNA metabolic process downregulation of RNA metabolic process negative regulation of RNA metabolism negative regulation of RNA metabolic process GO:0051254 Any process that activates or increases the frequency, rate or extent of the chemical reactions and pathways involving RNA. positive regulation of RNA metabolism up regulation of RNA metabolic process up-regulation of RNA metabolic process upregulation of RNA metabolic process positive regulation of RNA metabolic process GO:0051716 Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus. The process begins with detection of the stimulus by a cell and ends with a change in state or activity or the cell. cellular response to stimulus GO:0060147 Any process that modulates the frequency, rate or extent of the inactivation of gene expression by a posttranscriptional mechanism. regulation of posttranscriptional gene silencing GO:0060148 Any process that increases the frequency, rate or extent of the inactivation of gene expression by a posttranscriptional mechanism. positive regulation of posttranscriptional gene silencing GO:0060149 Any process that decreases the frequency, rate or extent of the inactivation of gene expression by a posttranscriptional mechanism. negative regulation of posttranscriptional gene silencing GO:0060255 Any process that modulates the frequency, rate or extent of the chemical reactions and pathways involving macromolecules, any molecule of high relative molecular mass, the structure of which essentially comprises the multiple repetition of units derived, actually or conceptually, from molecules of low relative molecular mass. regulation of macromolecule metabolic process GO:0060964 Any process that modulates the rate, frequency, or extent of the downregulation of gene expression through the action of microRNAs (miRNAs), endogenous 21-24 nucleotide small RNAs processed from stem-loop RNA precursors (pre-miRNAs). Once incorporated into a RNA-induced silencing complex (RISC), miRNAs can downregulate gene expression by either of two posttranscriptional mechanisms: mRNA cleavage or translational repression. regulation of gene silencing by microRNA regulation of gene silencing by miRNA GO:0060965 Any process that decreases the rate, frequency, or extent of the downregulation of gene expression through the action of microRNAs (miRNAs), endogenous 21-24 nucleotide small RNAs processed from stem-loop RNA precursors (pre-miRNAs). Once incorporated into a RNA-induced silencing complex (RISC), miRNAs can downregulate gene expression by either of two posttranscriptional mechanisms: mRNA cleavage or translational repression. negative regulation of gene silencing by microRNA negative regulation of gene silencing by miRNA GO:0060966 Any process that regulates the rate, frequency, or extent of gene silencing by RNA. Gene silencing by RNA is the process in which RNA molecules inactivate expression of target genes. regulation of gene silencing by RNA GO:0060967 Any process that decreases the rate, frequency, or extent of gene silencing by RNA. Gene silencing by RNA is the process in which RNA molecules inactivate expression of target genes. negative regulation of gene silencing by RNA GO:0060968 Any process that modulates the rate, frequency, or extent of gene silencing, the transcriptional or post-transcriptional process carried out at the cellular level that results in long-term gene inactivation. regulation of gene silencing GO:0060969 Any process that decreases the rate, frequency, or extent of gene silencing, the transcriptional or post-transcriptional process carried out at the cellular level that results in long-term gene inactivation. negative regulation of gene silencing GO:0061614 The cellular synthesis of primary microRNA (pri-miRNA) transcripts from a DNA template by RNA polymerase II, originating at an RNA polymerase II promoter. pri-miRNA transcripts are subsequently processed to produce the ~22nt miRNAs that function in gene regulation. pri-miRNA transcription from RNA polymerase II promoter GO:0065003 The aggregation, arrangement and bonding together of a set of macromolecules to form a complex. macromolecule complex assembly macromolecular complex assembly GO:0070013 An organelle lumen that is part of an intracellular organelle. intracellular organelle lumen GO:0070578 A trimeric ribonucleoprotein complex that and is required for the formation of a mature RNA induced silencing complex (RISC). In humans the complex is composed of the endonuclease Dicer (DICER1) and TRBP (TARBP2) in association with the Argonaute protein Ago2 (EIF2C2/AGO2). Within the complex, Dicer and TRBP are required to process precursor miRNAs (pre-miRNAs) to mature miRNAs and then load them onto Ago2. Ago2 bound to the mature miRNA constitutes the minimal RISC and may subsequently dissociate from Dicer and TRBP. This complex has endorobonuclease activity. miRLC microRNA loading complex RISC-loading complex GO:0070877 A protein complex that binds to heme and to pri-miRNAs, and is required for the formation of a pre-microRNA (pre-miRNA), the initial step of microRNA (miRNA) biogenesis. The complex is composed of the double-stranded-RNA-specific RNase Drosha (also called RNASEN) and the RNA-binding protein DGCR8 (heme-free or heme-bound forms). Within the complex, DGCR8 function as a molecular anchor necessary for the recognition of pri-miRNA at dsRNA-ssRNA junction and directs RNASEN/Drosha to cleave the 3' and 5' strands of a stem-loop to release hairpin-shaped pre-miRNAs. microprocessor complex IntAct:EBI-9519039 IntAct:EBI-9519056 GO:0070878 Interacting selectively and non-covalently with a primary microRNA (pri-miRNA) transcript, an RNA molecule that is processed into a short hairpin-shaped structure called a pre-miRNA and finally into a functional miRNA. Both double-stranded and single-stranded regions of a pri-miRNA are required for binding. pri-miRNA binding primary microRNA binding primary miRNA binding GO:0070883 Interacting selectively and non-covalently with a precursor microRNA (pre-miRNA) transcript, a stem-loop-containing precursor of microRNA. pre-microRNA binding precursor microRNA binding pre-miRNA binding GO:0070887 Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a chemical stimulus. cellular response to chemical stimulus GO:0070918 The process in which a double-stranded RNA precursor is processed into short (20-30 nt) fragments. RNA cleavage is catalyzed by a Dicer endonuclease. gene silencing by RNA, production of guide RNA gene silencing by RNA, production of small RNA production of small RNA involved in gene silencing by RNA GO:0070920 Any process that modulates the frequency, rate or extent of the production of small RNA involved in gene silencing by RNA. regulation of gene silencing by RNA, production of guide RNA regulation of gene silencing by RNA, production of small RNA regulation of production of small RNA involved in gene silencing by RNA GO:0071166 Any process in which a ribonucleoprotein complex is transported to, or maintained in, a specific location within a cell. RNP localization cellular ribonucleoprotein complex localization establishment and maintenance of ribonucleoprotein complex localization ribonucleoprotein complex localisation ribonucleoprotein complex localization GO:0071310 Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of an organic substance stimulus. cellular response to organic substance GO:0071359 Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a double-stranded RNA stimulus. cellular response to double-stranded RNA cellular response to dsRNA GO:0071407 Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of an organic cyclic compound stimulus. cellular response to organic cyclic substance cellular response to organic cyclic compound GO:0071426 The directed movement of a ribonucleoprotein complex from the nucleus to the cytoplasm. RNP export from nucleus ribonucleoprotein complex export from cell nucleus ribonucleoprotein complex nucleus export ribonucleoprotein complex transport from nucleus to cytoplasm ribonucleoprotein complex export from nucleus GO:0071430 The directed movement of a ribonucleoprotein complex that contains pre-microRNA from the nucleus to the cytoplasm. pre-microRNA-containing RNP export from nucleus pre-microRNA-containing ribonucleoprotein complex export from cell nucleus pre-microRNA-containing ribonucleoprotein complex export from nucleus pre-microRNA-containing ribonucleoprotein complex nucleus export pre-microRNA-containing ribonucleoprotein complex transport from nucleus to cytoplasm pre-miRNA-containing ribonucleoprotein complex export from nucleus GO:0071704 The chemical reactions and pathways involving an organic substance, any molecular entity containing carbon. organic molecular entity metabolic process organic molecular entity metabolism organic substance metabolism organic substance metabolic process GO:0071840 A process that results in the biosynthesis of constituent macromolecules, assembly, arrangement of constituent parts, or disassembly of a cellular component. cellular component organisation or biogenesis cellular component organisation or biogenesis at cellular level cellular component organization or biogenesis at cellular level cellular component organization or biogenesis GO:0080090 Any process that modulates the frequency, rate or extent of the chemical reactions and pathways within a cell or an organism involving those compounds formed as a part of the normal anabolic and catabolic processes. These processes take place in most, if not all, cells of the organism. regulation of primary metabolic process GO:0090304 Any cellular metabolic process involving nucleic acids. nucleic acid metabolic process GO:0090305 The nucleic acid metabolic process in which the phosphodiester bonds between nucleotides are cleaved by hydrolysis. nucleic acid cleavage nucleic acid phosphodiester bond hydrolysis GO:0090501 The RNA metabolic process in which the phosphodiester bonds between ribonucleotides are cleaved by hydrolysis. RNA phosphodiester bond hydrolysis GO:0090502 The chemical reactions and pathways involving the hydrolysis of internal 3',5'-phosphodiester bonds in one or two strands of ribonucleotides. RNA phosphodiester bond hydrolysis, endonucleolytic GO:0090503 The chemical reactions and pathways involving the hydrolysis of terminal 3',5'-phosphodiester bonds in one or two strands of ribonucleotides. RNA phosphodiester bond hydrolysis, exonucleolytic GO:0090624 Catalysis of the endonucleolytic cleavage of the mRNA in a double-stranded RNA molecule formed by the base pairing of an mRNA with an miRNA. endoribonuclease activity, cleaving miRNA-paired mRNA GO:0090631 Enables the directed movement of pre-miRNAs between the nucleus and the cytoplasm of a cell. pre-miRNA transporter activity GO:1901360 The chemical reactions and pathways involving organic cyclic compound. organic cyclic compound metabolism organic cyclic compound metabolic process GO:1901361 The chemical reactions and pathways resulting in the breakdown of organic cyclic compound. organic cyclic compound breakdown organic cyclic compound catabolism organic cyclic compound degradation organic cyclic compound catabolic process GO:1901362 The chemical reactions and pathways resulting in the formation of organic cyclic compound. organic cyclic compound anabolism organic cyclic compound biosynthesis organic cyclic compound formation organic cyclic compound synthesis organic cyclic compound biosynthetic process GO:1901575 The chemical reactions and pathways resulting in the breakdown of an organic substance, any molecular entity containing carbon. organic molecular entity breakdown organic molecular entity catabolic process organic molecular entity catabolism organic molecular entity degradation organic substance breakdown organic substance catabolism organic substance degradation organic substance catabolic process GO:1901576 The chemical reactions and pathways resulting in the formation of an organic substance, any molecular entity containing carbon. organic molecular entity anabolism organic molecular entity biosynthesis organic molecular entity biosynthetic process organic molecular entity formation organic molecular entity synthesis organic substance anabolism organic substance biosynthesis organic substance formation organic substance synthesis organic substance biosynthetic process GO:1901698 Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a nitrogen compound stimulus. response to nitrogen molecular entity response to nitrogen compound GO:1901699 Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a nitrogen compound stimulus. cellular response to nitrogen molecular entity cellular response to nitrogen compound GO:1902369 Any process that stops, prevents or reduces the frequency, rate or extent of RNA catabolic process. down regulation of RNA breakdown down regulation of RNA catabolic process down regulation of RNA catabolism down regulation of RNA degradation down-regulation of RNA breakdown down-regulation of RNA catabolic process down-regulation of RNA catabolism down-regulation of RNA degradation downregulation of RNA breakdown downregulation of RNA catabolic process downregulation of RNA catabolism downregulation of RNA degradation negative regulation of RNA breakdown negative regulation of RNA catabolism negative regulation of RNA degradation negative regulation of RNA catabolic process GO:1902578 A localization which involves only one organism. single organism localization single-organism localization GO:1902582 An intracellular transport which involves only one organism. single organism intracellular transport single-organism intracellular transport GO:1902679 Any process that stops, prevents or reduces the frequency, rate or extent of RNA biosynthetic process. down regulation of RNA anabolism down regulation of RNA biosynthesis down regulation of RNA biosynthetic process down regulation of RNA formation down regulation of RNA synthesis down-regulation of RNA anabolism down-regulation of RNA biosynthesis down-regulation of RNA biosynthetic process down-regulation of RNA formation down-regulation of RNA synthesis downregulation of RNA anabolism downregulation of RNA biosynthesis downregulation of RNA biosynthetic process downregulation of RNA formation downregulation of RNA synthesis negative regulation of RNA anabolism negative regulation of RNA biosynthesis negative regulation of RNA formation negative regulation of RNA synthesis negative regulation of RNA biosynthetic process GO:1902680 Any process that activates or increases the frequency, rate or extent of RNA biosynthetic process. positive regulation of RNA anabolism positive regulation of RNA biosynthesis positive regulation of RNA formation positive regulation of RNA synthesis up regulation of RNA anabolism up regulation of RNA biosynthesis up regulation of RNA biosynthetic process up regulation of RNA formation up regulation of RNA synthesis up-regulation of RNA anabolism up-regulation of RNA biosynthesis up-regulation of RNA biosynthetic process up-regulation of RNA formation up-regulation of RNA synthesis upregulation of RNA anabolism upregulation of RNA biosynthesis upregulation of RNA biosynthetic process upregulation of RNA formation upregulation of RNA synthesis positive regulation of RNA biosynthetic process GO:1902893 Any process that modulates the frequency, rate or extent of pri-miRNA transcription from RNA polymerase II promoter. regulation of pri-miRNA transcription from RNA polymerase II promoter GO:1902894 Any process that stops, prevents or reduces the frequency, rate or extent of pri-miRNA transcription from RNA polymerase II promoter. down regulation of pri-miRNA transcription from RNA polymerase II promoter down-regulation of pri-miRNA transcription from RNA polymerase II promoter downregulation of pri-miRNA transcription from RNA polymerase II promoter negative regulation of pri-miRNA transcription from RNA polymerase II promoter GO:1902895 Any process that activates or increases the frequency, rate or extent of pri-miRNA transcription from RNA polymerase II promoter. up regulation of pri-miRNA transcription from RNA polymerase II promoter up-regulation of pri-miRNA transcription from RNA polymerase II promoter upregulation of pri-miRNA transcription from RNA polymerase II promoter positive regulation of pri-miRNA transcription from RNA polymerase II promoter GO:1903506 Any process that modulates the frequency, rate or extent of nucleic acid-templated transcription. regulation of nucleic acid-templated transcription GO:1903507 Any process that stops, prevents or reduces the frequency, rate or extent of nucleic acid-templated transcription. down regulation of nucleic acid-templated transcription down-regulation of nucleic acid-templated transcription downregulation of nucleic acid-templated transcription negative regulation of nucleic acid-templated transcription GO:1903508 Any process that activates or increases the frequency, rate or extent of nucleic acid-templated transcription. up regulation of nucleic acid-templated transcription up-regulation of nucleic acid-templated transcription upregulation of nucleic acid-templated transcription positive regulation of nucleic acid-templated transcription GO:1903798 Any process that modulates the frequency, rate or extent of production of miRNAs involved in gene silencing by miRNA. regulation of gene silencing by miRNA, production of miRNAs regulation of miRNA processing regulation of miRNA-mediated gene silencing, production of miRNAs regulation of microRNA-mediated gene silencing, production of microRNAs regulation of production of microRNAs involved in gene silencing by microRNA regulation of production of miRNAs involved in gene silencing by miRNA GO:1903799 Any process that stops, prevents or reduces the frequency, rate or extent of production of miRNAs involved in gene silencing by miRNA. down regulation of gene silencing by miRNA, production of miRNAs down regulation of miRNA processing down regulation of miRNA-mediated gene silencing, production of miRNAs down regulation of microRNA-mediated gene silencing, production of microRNAs down regulation of production of miRNAs involved in gene silencing by miRNA down regulation of production of microRNAs involved in gene silencing by microRNA down-regulation of gene silencing by miRNA, production of miRNAs down-regulation of miRNA processing down-regulation of miRNA-mediated gene silencing, production of miRNAs down-regulation of microRNA-mediated gene silencing, production of microRNAs down-regulation of production of miRNAs involved in gene silencing by miRNA down-regulation of production of microRNAs involved in gene silencing by microRNA downregulation of gene silencing by miRNA, production of miRNAs downregulation of miRNA processing downregulation of miRNA-mediated gene silencing, production of miRNAs downregulation of microRNA-mediated gene silencing, production of microRNAs downregulation of production of miRNAs involved in gene silencing by miRNA downregulation of production of microRNAs involved in gene silencing by microRNA negative regulation of gene silencing by miRNA, production of miRNAs negative regulation of miRNA processing negative regulation of miRNA-mediated gene silencing, production of miRNAs negative regulation of microRNA-mediated gene silencing, production of microRNAs negative regulation of production of microRNAs involved in gene silencing by microRNA negative regulation of production of miRNAs involved in gene silencing by miRNA GO:1903800 Any process that activates or increases the frequency, rate or extent of production of miRNAs involved in gene silencing by miRNA. positive regulation of gene silencing by miRNA, production of miRNAs positive regulation of miRNA processing positive regulation of miRNA-mediated gene silencing, production of miRNAs positive regulation of microRNA-mediated gene silencing, production of microRNAs positive regulation of production of microRNAs involved in gene silencing by microRNA up regulation of gene silencing by miRNA, production of miRNAs up regulation of miRNA processing up regulation of miRNA-mediated gene silencing, production of miRNAs up regulation of microRNA-mediated gene silencing, production of microRNAs up regulation of production of miRNAs involved in gene silencing by miRNA up regulation of production of microRNAs involved in gene silencing by microRNA up-regulation of gene silencing by miRNA, production of miRNAs up-regulation of miRNA processing up-regulation of miRNA-mediated gene silencing, production of miRNAs up-regulation of microRNA-mediated gene silencing, production of microRNAs up-regulation of production of miRNAs involved in gene silencing by miRNA up-regulation of production of microRNAs involved in gene silencing by microRNA upregulation of gene silencing by miRNA, production of miRNAs upregulation of miRNA processing upregulation of miRNA-mediated gene silencing, production of miRNAs upregulation of microRNA-mediated gene silencing, production of microRNAs upregulation of production of miRNAs involved in gene silencing by miRNA upregulation of production of microRNAs involved in gene silencing by microRNA positive regulation of production of miRNAs involved in gene silencing by miRNA GO:1990428 The directed movement of microRNA (miRNA) into, out of or within a cell, or between cells, or within a multicellular organism by means of some agent such as a transporter or pore. microRNA transport miRNA transport GO:1990684 A macromolecular complex containing separate protein, lipid and RNA molecules. Separate in this context means not covalently bound to each other. protein-lipid-RNA complex GO:1990685 A protein-lipid-RNA complex containing separate high-density lipoprotein (HDL), lipid and RNA molecules. Separate in this context means not covalently bound to each other. HDL-containing protein-lipid-RNA complex GO:1990686 A protein-lipid-RNA complex containing separate low-density lipoprotein (LDL), lipid and RNA molecules. Separate in this context means not covalently bound to each other. LDL-containing protein-lipid-RNA complex GO:1990729 The covalent alteration of one or more nucleotides within a primary miRNA molecule to produce a primary miRNA molecule with a sequence that differs from that coded genetically. primary miRNA modification GO:2000112 Any process that modulates the frequency, rate or extent of cellular macromolecule biosynthetic process. regulation of cellular biopolymer biosynthetic process regulation of cellular macromolecule anabolism regulation of cellular macromolecule biosynthesis regulation of cellular macromolecule formation regulation of cellular macromolecule synthesis regulation of cellular macromolecule biosynthetic process GO:2000113 Any process that stops, prevents, or reduces the frequency, rate or extent of cellular macromolecule biosynthetic process. negative regulation of cellular biopolymer biosynthetic process negative regulation of cellular macromolecule anabolism negative regulation of cellular macromolecule biosynthesis negative regulation of cellular macromolecule formation negative regulation of cellular macromolecule synthesis negative regulation of cellular macromolecule biosynthetic process GO:2000625 Any process that modulates the frequency, rate or extent of miRNA catabolic process. regulation of microRNA catabolic process regulation of miRNA catabolic process GO:2000626 Any process that stops, prevents or reduces the frequency, rate or extent of miRNA catabolic process. negative regulation of microRNA catabolic process negative regulation of miRNA catabolic process GO:2000627 Any process that activates or increases the frequency, rate or extent of miRNA catabolic process. positive regulation of microRNA catabolic process positive regulation of miRNA catabolic process GO:2000628 Any process that modulates the frequency, rate or extent of miRNA metabolic process. regulation of microRNA metabolic process regulation of miRNA metabolic process GO:2000629 Any process that stops, prevents or reduces the frequency, rate or extent of miRNA metabolic process. negative regulation of microRNA metabolic process negative regulation of miRNA metabolic process GO:2000630 Any process that activates or increases the frequency, rate or extent of miRNA metabolic process. positive regulation of microRNA metabolic process positive regulation of miRNA metabolic process GO:2000631 Any process that modulates the frequency, rate or extent of pre-microRNA processing. regulation of pre-microRNA processing regulation of pre-miRNA processing GO:2000632 Any process that stops, prevents or reduces the frequency, rate or extent of pre-microRNA processing. negative regulation of pre-microRNA processing negative regulation of pre-miRNA processing GO:2000633 Any process that activates or increases the frequency, rate or extent of pre-microRNA processing. positive regulation of pre-microRNA processing positive regulation of pre-miRNA processing GO:2000634 Any process that modulates the frequency, rate or extent of primary microRNA processing. regulation of pri-miRNA processing regulation of primary microRNA processing regulation of primary miRNA processing GO:2000635 Any process that stops, prevents or reduces the frequency, rate or extent of primary microRNA processing. negative regulation of pri-miRNA processing negative regulation of primary microRNA processing negative regulation of primary miRNA processing GO:2000636 Any process that activates or increases the frequency, rate or extent of primary microRNA processing. positive regulation of pri-miRNA processing positive regulation of primary microRNA processing positive regulation of primary miRNA processing GO:2000637 Any process that activates or increases the frequency, rate or extent of gene silencing by miRNA. positive regulation of miRNA-mediated gene silencing positive regulation of microRNA-mediated gene silencing positive regulation of gene silencing by miRNA GO:2001141 Any process that modulates the frequency, rate or extent of RNA biosynthetic process. regulation of RNA anabolism regulation of RNA biosynthesis regulation of RNA formation regulation of RNA synthesis regulation of RNA biosynthetic process IAO:0000027 data item IAO:0000030 Examples of information content entites include journal articles, data, graphical layouts, and graphs. A generically dependent continuant that is about some thing. 2014-03-10: The use of "thing" is intended to be general enough to include universals and configurations (see https://groups.google.com/d/msg/information-ontology/GBxvYZCk1oc/-L6B5fSBBTQJ). PERSON: Chris Stoeckert OBI_0000142 information content entity IAO:0000078 curation status specification The curation status of the term. The allowed values come from an enumerated list of predefined terms. See the specification of these instances for more detailed definitions of each enumerated value. Better to represent curation as a process with parts and then relate labels to that process (in IAO meeting) PERSON:Bill Bug GROUP:OBI:<http://purl.obolibrary.org/obo/obi> OBI_0000266 curation status specification IAO:0000102 data about an ontology part is a data item about a part of an ontology, for example a term Person:Alan Ruttenberg data about an ontology part IAO:0000225 obsolescence reason specification The reason for which a term has been deprecated. The allowed values come from an enumerated list of predefined terms. See the specification of these instances for more detailed definitions of each enumerated value. The creation of this class has been inspired in part by Werner Ceusters' paper, Applying evolutionary terminology auditing to the Gene Ontology. PERSON: Alan Ruttenberg PERSON: Melanie Courtot obsolescence reason specification IAO:0000409 The Basic Formal Ontology ontology makes a distinction between Universals and defined classes, where the formal are "natural kinds" and the latter arbitrary collections of entities. A denotator type indicates how a term should be interpreted from an ontological perspective. Alan Ruttenberg Barry Smith, Werner Ceusters denotator type IAO:8000000 I have placed this under 'data about an ontology part', but this can be discussed. I think this is OK if 'part' is interpreted reflexively, as an ontology module is the whole ontology rather than part of it. ontology file This class and it's subclasses are applied to OWL ontologies. Using an rdf:type triple will result in problems with OWL-DL. I propose that dcterms:type is instead used to connect an ontology URI with a class from this hierarchy. The class hierarchy is not disjoint, so multiple assertions can be made about a single ontology. cjm 2018-05-20T20:55:03Z ontology module IAO:8000001 An ontology module that comprises only of asserted axioms local to the ontology, excludes import directives, and excludes axioms or declarations from external ontologies. cjm 2018-05-20T20:55:30Z base ontology module IAO:8000002 An ontology module that is intended to be directly edited, typically managed in source control, and typically not intended for direct consumption by end-users. source ontology module cjm 2018-05-20T20:55:47Z editors ontology module IAO:8000003 An ontology module that is intended to be the primary release product and the one consumed by the majority of tools. TODO: Add logical axioms that state that a main release ontology module is derived from (directly or indirectly) an editors module cjm 2018-05-20T20:56:13Z main release ontology module IAO:8000004 An ontology module that consists entirely of axioms that connect or bridge two distinct ontology modules. For example, the Uberon-to-ZFA bridge module. cjm 2018-05-20T20:56:23Z bridge ontology module IAO:8000005 A subset ontology module that is intended to be imported from another ontology. TODO: add axioms that indicate this is the output of a module extraction process. import file cjm 2018-05-20T20:56:47Z import ontology module IAO:8000006 An ontology module that is extracted from a main ontology module and includes only a subset of entities or axioms. ontology slim subset ontology cjm 2018-05-20T20:58:11Z subset ontology module IAO:8000007 A subset ontology that is intended as a whitelist for curators using the ontology. Such a subset will exclude classes that curators should not use for curation. cjm 2018-05-20T20:58:38Z curation subset ontology module IAO:8000008 An ontology module that is intended for usage in analysis or discovery applications. cjm 2018-05-20T20:58:49Z analysis subset ontology module IAO:8000009 A subset ontology that is largely comprised of a single layer or strata in an ontology class hierarchy. The purpose is typically for rolling up for visualization. The classes in the layer need not be disjoint. ribbon subset cjm 2018-05-20T20:59:19Z single layer subset ontology module IAO:8000010 A subset of an ontology that is intended to be excluded for some purpose. For example, a blacklist of classes. antislim cjm 2018-05-20T20:59:57Z exclusion subset ontology module IAO:8000011 An imported ontology module that is derived from an external ontology. Derivation methods include the OWLAPI SLME approach. external import cjm 2018-05-20T21:00:14Z external import ontology module IAO:8000012 A subset ontology that is crafted to either include or exclude a taxonomic grouping of species. taxon subset cjm 2018-05-20T21:14:16Z species subset ontology module IAO:8000013 An ontology module that contains axioms generated by a reasoner. The generated axioms are typically direct SubClassOf axioms, but other possibilities are available. cjm 2018-05-20T21:20:33Z reasoned ontology module IAO:8000014 An ontology module that is automatically generated, for example via a SPARQL query or via template and a CSV. TODO: Add axioms (using PROV-O?) that indicate this is the output-of some reasoning process cjm 2018-05-20T21:21:12Z generated ontology module IAO:8000015 An ontology module that is automatically generated from a template specification and fillers for slots in that template. cjm 2018-05-20T21:21:21Z template generated ontology module IAO:8000016 cjm 2018-05-20T21:28:15Z taxonomic bridge ontology module IAO:8000017 cjm 2018-05-22T04:15:54Z ontology module subsetted by expressivity IAO:8000018 A subset ontology that is designed for basic applications to continue to make certain simplifying assumptions; many of these simplifying assumptions were based on the initial version of the Gene Ontology, and have become enshrined in many popular and useful tools such as term enrichment tools. Examples of such assumptions include: traversing the ontology graph ignoring relationship types using a naive algorithm will not lead to cycles (i.e. the ontology is a DAG); every referenced term is declared in the ontology (i.e. there are no dangling clauses). An ontology is OBO Basic if and only if it has the following characteristics: DAG Unidirectional No Dangling Clauses Fully Asserted Fully Labeled No equivalence axioms Singly labeled edges No qualifier lists No disjointness axioms No owl-axioms header No imports cjm 2018-05-22T04:16:10Z obo basic subset ontology module IAO:8000019 cjm 2018-05-22T04:16:28Z ontology module subsetted by OWL profile IAO:8000020 cjm 2018-05-22T04:16:48Z EL++ ontology module NCBITaxon:10090 house mouse mouse Mus musculus NCBITaxon:10116 Norway rat Rattus sp. strain Wistar brown rat rat rats Rattus norvegicus NCBITaxon:10239 Viruses NCBITaxon:2 Bacteria eubacteria Bacteria <prokaryote> PMID:10425795 PMID:10425796 PMID:10425797 PMID:10490293 PMID:10843050 PMID:10939651 PMID:10939673 PMID:10939677 PMID:11211268 PMID:11321083 PMID:11321113 PMID:11411719 PMID:11540071 PMID:11542017 PMID:11542087 PMID:11760965 PMID:12054223 PMID:2112744 PMID:270744 PMID:8123559 PMID:8590690 PMID:9103655 PMID:9336922 NCBITaxon:40674 mammals Mammalia NCBITaxon:6239 roundworm Caenorhabditis elegans NCBITaxon:7215 Drosophila fruit flies fruit fly Drosophila <fruit fly, genus> NCBITaxon:7217 Drosophila ananassae NCBITaxon:7220 Drosophila erecta NCBITaxon:7222 Drosophila grimshawi NCBITaxon:7227 fruit fly Drosophila melanogaster NCBITaxon:7230 Drosophila mojavensis NCBITaxon:7234 Drosophila persimilis NCBITaxon:7237 Drosophila pseudoobscura NCBITaxon:7238 Drosophila sechellia NCBITaxon:7240 Drosophila simulans NCBITaxon:7244 Drosophila virilis NCBITaxon:7245 Drosophila yakuba NCBITaxon:7260 Drosophila willistoni NCBITaxon:7955 leopard danio zebra danio zebra fish zebrafish Danio rerio NCBITaxon:9031 bantam chicken chickens Gallus gallus NCBITaxon:9606 human man Homo sapiens NCBITaxon:9615 dog dogs Canis lupus familiaris NCRO:0000001 miRNA_target_gene_primary_transcript NCRO:0000002 miRNA_target_gene_mRNA NCRO:0000003 miRNA_and_target_gene_binding NCRO:0000004 fly_miRNA NCRO:0000005 c_elegans_miRNA NCRO:0000006 bacterial_miRNA NCRO:0000007 virus_miRNA NCRO:0000008 miRBase:MI0003592 non_mammalian_miRNA NCRO:0000009 mammalian_miRNA NCRO:0000010 miRNA_expression NCRO:0000011 protein_miRNA_promoter_binding NCRO:0000012 promoter_of_miRNA NCRO:0000013 miRNA_transcription_initiation NCRO:0000014 transcription_of_miRNA NCRO:0000015 animal_study_model NCRO:0000025 2015-05-25T15:37:18Z miRNA_target_gene NCRO:0000026 An experimental variable is the variable that is used in an experiment and is known as the dependent variable that can be manipulated and is being studied HeZhang 2013-09-28T19:15:26Z environmental_variable NCRO:0000027 HeZhang 2013-09-28T19:15:26Z gene_sequence NCRO:0000028 The ratio of force to the area over which that force is distributed HeZhang 2013-09-28T19:16:26Z pressure NCRO:0000029 Numerical measure of hot or cold HeZhang 2013-09-28T19:16:26Z temperature NCRO:0000030 HeZhang 2013-09-28T19:17:41Z high_pressure NCRO:0000031 HeZhang 2013-09-28T19:17:41Z low_pressure NCRO:0000032 HeZhang 2013-09-28T19:17:41Z normal_pressure NCRO:0000033 HeZhang 2013-09-28T19:18:33Z high_temperature NCRO:0000034 HeZhang 2013-09-28T19:18:33Z low_temperature NCRO:0000035 HeZhang 2013-09-28T19:18:33Z normal_temperature NCRO:0000040 HeZhang 2013-09-29T18:27:09Z "A harmful role or activity realizeable by some agent in the human body" harmful_role NCRO:0000041 HeZhang 2013-09-29T18:29:20Z "Harmful physical agents" harmful_environmental_effect NCRO:0000042 The potential capacity of certain species of microbes to cause a disease HeZhang 2013-09-29T18:29:20Z ""Germs" -- foreign microorganisms capable of causing disease" pathogenicity NCRO:0000043 HeZhang 2013-09-29T18:29:20Z "Harmful chemical agents" toxic_activity NCRO:0000044 The ability or tendency to produce cancer. HeZhang 2013-09-29T18:30:22Z carcinogenicity NCRO:0000091 Small infectious agent that replicates only inside the living cells of other organisms HeZhang 2013-10-01T23:27:46Z virus NCRO:0000098 HeZhang 2013-10-01T23:32:05Z adult_tissue NCRO:0000099 Tissue in an embryo HeZhang 2013-10-01T23:32:05Z "Tissues existing in the early embryonic stages of development" embryonic_tissue NCRO:0000100 Tissue that connects, supports, binds, or separates other tissues or organs, typically having relatively few cells embedded in an amorphous matrix, often with collagen or other fibers, and including cartilaginous, fatty, and elastic tissues. HeZhang 2013-10-01T23:33:33Z "Tissues originating from mesoderm and performing a structural or connective function between other tissues" connective_tissue NCRO:0000101 Membranous tissue covering internal organs and other internal surfaces of the body. HeZhang 2013-10-01T23:33:33Z "Tissue lining body structures and forming glands" epithelia_tissue NCRO:0000102 Muscle tissue is one of four basic biological tissues present in animals. It is a soft tissue that composes muscles. It is formed during embryo development in a process known as myogenesis. HeZhang 2013-10-01T23:33:33Z "Tissue forming muscles - capable of generating movement of body structures" muscle_tissue NCRO:0000103 Tissue composed of neurons. HeZhang 2013-10-01T23:33:33Z "Tissue forming nerves and neural structures like the brain and spinal cord, used for coordinating bodily functions." nerve_tissue NCRO:0000104 A kind of body tissue containing stored fat that serves as a source of energy; it also cushions and insulates vital organs. HeZhang 2013-10-01T23:34:55Z "Fat tissue" adipose_tissue NCRO:0000105 Bodily fluid in animals that delivers necessary substances such as nutrients and oxygen to the cells and transports metabolic waste products away. HeZhang 2013-10-01T23:34:55Z "Blood tissue, including red and white blood cells" blood NCRO:0000106 Rigid organs that constitute part of the endoskeleton of vertebrates. HeZhang 2013-10-01T23:34:55Z "Bone tissue - provides structural framework for body with high compressive strength" bone NCRO:0000107 A tough, elastic, fibrous connective tissue found in various parts of the body, such as the joints, outer ear, and larynx. HeZhang 2013-10-01T23:34:55Z "Tough tissue that connects bones and gives form to many of the soft structures of the body" cartilage NCRO:0000108 Type of involuntary striated muscle found in the walls and histological foundation of the heart. HeZhang 2013-10-01T23:36:04Z "Muscle cells of the heart" cardiac_muscle NCRO:0000109 Form of striated muscle tissue which is under the control of the somatic nervous system. HeZhang 2013-10-01T23:36:04Z "Muscle cells of skeletal muscle - those that execute voluntary movement of the skeleton" skeletal_muscle NCRO:0000110 Responsible for the contractility of hollow organs, such as blood vessels, the gastrointestinal tract, the bladder, or the uterus. HeZhang 2013-10-01T23:36:04Z "Muscle cells of smooth muscle - found in digestive tract and blood vessels, execute involuntary movement" smooth_muscle NCRO:0000111 Outermost of the three primary germ layers of an embryo, from which the epidermis, nervous tissue, and, in vertebrates, sense organs develop. HeZhang 2013-10-03T23:21:30Z "The outer layer of cells in the early embryo" ectoderm NCRO:0000112 Innermost of the three primary germ layers of an animal embryo, developing into the gastrointestinal tract, the lungs, and associated structures. HeZhang 2013-10-03T23:21:30Z "The inner layer of cells in the early embryo" endoderm NCRO:0000113 Middle embryonic germ layer, lying between the ectoderm and the endoderm, from which connective tissue, muscle, bone, and the urogenital and circulatory systems develop. HeZhang 2013-10-03T23:21:30Z "The middle layer of cells in the early embryo" mesoderm NCRO:0000123 HeZhang 2013-10-03T23:37:16Z treatment NCRO:0000225 2013-10-04T20:10:02Z pharmaceutical_treatment NCRO:0000226 A health care profession primarily concerned with the remediation of impairments and disabilities and the promotion of mobility, functional ability, quality of life and movement potential through examination, evaluation, diagnosis and physical intervention. 2013-10-04T20:10:02Z physical_therapy NCRO:0000227 2013-10-04T20:10:02Z psychological_treatment NCRO:0000228 Branch of medicine that deals with the diagnosis and treatment of injury, deformity, and disease by manual and instrumental means. 2013-10-04T20:10:02Z surgery NCRO:0000229 2013-10-04T20:19:18Z analgesic_treatment NCRO:0000230 2013-10-04T20:19:18Z antibiotic_treatment NCRO:0000231 2013-10-04T20:19:18Z antihyperlipidemic_treatment NCRO:0000232 2013-10-04T20:19:18Z antihypertensive_treatment NCRO:0000233 Treatment of cancer with one or more cytotoxic antineoplastic drugs. 2013-10-04T20:19:18Z chemotherapy NCRO:0000234 Immunosuppression involves an act that reduces the activation or efficacy of the immune system. 2013-10-04T20:19:18Z immunosuppressive_therapy NCRO:0000235 The treatment of disease, esp. cancer, using X-rays or similar forms of radiation. 2013-10-04T20:24:14Z radiation_release NCRO:0000481 An organism of microscopic or submicroscopic size, especially a bacterium or protozoan 2013-10-07T00:19:58Z cellular_organism NCRO:0000482 microorganisms that are similar to bacteria in size and simplicity of structure but radically different in molecular organization. They are now believed to constitute an ancient intermediate group between the bacteria and eukaryotes HeZhang 2013-10-07T00:31:14Z archaea NCRO:0000483 a member of a large group of unicellular microorganisms that have cell walls but lack organelles and an organized nucleus, including some that can cause diseas HeZhang 2013-10-07T00:31:14Z bacteria NCRO:0000701 mouse_miRNA NCRO:0000801 HeZhang 2013-10-25T16:05:06Z TE_juxtaposition NCRO:0000803 2013-10-25T16:03:19Z TE_insertion NCRO:0000807 HeZhang 2013-10-25T16:17:26Z positive_strand_insertion NCRO:0000809 HeZhang 2013-10-25T16:17:26Z negative_strand_insertion NCRO:0000810 He_Zhang 2015-05-16T19:26:04Z human_miRNA NCRO:0000811 miRBase:MI0003592 hsa-mir-585 NCRO:0000812 miRBase:MI0003634 hsa-mir-620 NCRO:0000813 miRBase:MI0003683 hsa-mir-659 NCRO:0000814 miRBase:MI0003939 hsa-mir-2113 NCRO:0000815 miRBase:MI0006319 hsa-mir-1229 NCRO:0000816 miRBase:MI0006324 hsa-mir-1234 NCRO:0000817 miRBase:MI0006402 hsa-mir-548o NCRO:0000818 miRBase:MI0006426 hsa-mir-1279 NCRO:0000819 miRBase:MI0006652 hsa-mir-1321 NCRO:0000820 miRBase:MI0007075 hsa-mir-1470 NCRO:0000821 miRBase:MI0007260 hsa-mir-1539 NCRO:0000822 miRBase:MI0009983 hsa-mir-1973 NCRO:0000823 miRBase:MI0010486 hsa-mir-2052 NCRO:0000824 miRBase:MI0010487 hsa-mir-2053 NCRO:0000825 miRBase:MI0010488 hsa-mir-2054 NCRO:0000826 miRBase:MI0010634 hsa-mir-2115 NCRO:0000827 miRBase:MI0010635 hsa-mir-2116 NCRO:0000828 miRBase:MI0010636 hsa-mir-2117 NCRO:0000829 miRBase:MI0011282 hsa-mir-2276 NCRO:0000830 miRBase:MI0011284 hsa-mir-2277 NCRO:0000831 miRBase:MI0012062 hsa-mir-2681 NCRO:0000832 miRBase:MI0012063 hsa-mir-2682 NCRO:0000833 miRBase:MI0013083 hsa-mir-2909 NCRO:0000834 miRBase:MI0014127 hsa-mir-3115 NCRO:0000835 miRBase:MI0014139 hsa-mir-3123 NCRO:0000836 miRBase:MI0014140 hsa-mir-3124 NCRO:0000837 miRBase:MI0014142 hsa-mir-3125 NCRO:0000838 miRBase:MI0014145 hsa-mir-3128 NCRO:0000839 miRBase:MI0014151 hsa-mir-3131 NCRO:0000840 miRBase:MI0014153 hsa-mir-3133 NCRO:0000841 miRBase:MI0014155 hsa-mir-3134 NCRO:0000842 miRBase:MI0014160 hsa-mir-3137 NCRO:0000843 miRBase:MI0014162 hsa-mir-3139 NCRO:0000844 miRBase:MI0014165 hsa-mir-3141 NCRO:0000845 miRBase:MI0014166 hsa-mir-3142 NCRO:0000846 miRBase:MI0014167 hsa-mir-3143 NCRO:0000847 miRBase:MI0014169 hsa-mir-3144 NCRO:0000848 miRBase:MI0014173 hsa-mir-3147 NCRO:0000849 miRBase:MI0014175 hsa-mir-3148 NCRO:0000850 miRBase:MI0014179 hsa-mir-3152 NCRO:0000851 miRBase:MI0014180 hsa-mir-3153 NCRO:0000852 miRBase:MI0014185 hsa-mir-3157 NCRO:0000853 miRBase:MI0014188 hsa-mir-3159 NCRO:0000854 miRBase:MI0014191 hsa-mir-3161 NCRO:0000855 miRBase:MI0014192 hsa-mir-3162 NCRO:0000856 miRBase:MI0014193 hsa-mir-3163 NCRO:0000857 miRBase:MI0014194 hsa-mir-3164 NCRO:0000858 miRBase:MI0014196 hsa-mir-3166 NCRO:0000859 miRBase:MI0014199 hsa-mir-3168 NCRO:0000860 miRBase:MI0014200 hsa-mir-3169 NCRO:0000861 miRBase:MI0014202 hsa-mir-3171 NCRO:0000862 miRBase:MI0014207 hsa-mir-3118-4 NCRO:0000863 miRBase:MI0014209 hsa-mir-3175 NCRO:0000864 miRBase:MI0014210 hsa-mir-3176 NCRO:0000865 miRBase:MI0014211 hsa-mir-3177 NCRO:0000866 miRBase:MI0014212 hsa-mir-3178 NCRO:0000867 miRBase:MI0014223 hsa-mir-3181 NCRO:0000868 miRBase:MI0014224 hsa-mir-3182 NCRO:0000869 miRBase:MI0014225 hsa-mir-3183 NCRO:0000870 miRBase:MI0014226 hsa-mir-3184 NCRO:0000871 miRBase:MI0014227 hsa-mir-3185 NCRO:0000872 miRBase:MI0014229 hsa-mir-3186 NCRO:0000873 miRBase:MI0014231 hsa-mir-3187 NCRO:0000874 miRBase:MI0014233 hsa-mir-3189 NCRO:0000875 miRBase:MI0014239 hsa-mir-3194 NCRO:0000876 miRBase:MI0014240 hsa-mir-3195 NCRO:0000877 miRBase:MI0014241 hsa-mir-3196 NCRO:0000878 miRBase:MI0014245 hsa-mir-3197 NCRO:0000879 miRBase:MI0014250 hsa-mir-3201 NCRO:0000880 miRBase:MI0015822 hsa-mir-4295 NCRO:0000881 miRBase:MI0015823 hsa-mir-4296 NCRO:0000882 miRBase:MI0015824 hsa-mir-4297 NCRO:0000883 miRBase:MI0015825 hsa-mir-378c NCRO:0000884 miRBase:MI0015826 hsa-mir-4293 NCRO:0000885 miRBase:MI0015827 hsa-mir-4294 NCRO:0000886 miRBase:MI0015828 hsa-mir-4301 NCRO:0000887 miRBase:MI0015829 hsa-mir-4299 NCRO:0000888 miRBase:MI0015830 hsa-mir-4298 NCRO:0000889 miRBase:MI0015831 hsa-mir-4300 NCRO:0000890 miRBase:MI0015832 hsa-mir-4304 NCRO:0000891 miRBase:MI0015833 hsa-mir-4302 NCRO:0000892 miRBase:MI0015834 hsa-mir-4303 NCRO:0000893 miRBase:MI0015835 hsa-mir-4305 NCRO:0000894 miRBase:MI0015836 hsa-mir-4306 NCRO:0000895 miRBase:MI0015837 hsa-mir-4309 NCRO:0000896 miRBase:MI0015838 hsa-mir-4307 NCRO:0000897 miRBase:MI0015839 hsa-mir-4308 NCRO:0000898 miRBase:MI0015840 hsa-mir-4310 NCRO:0000899 miRBase:MI0015841 hsa-mir-4311 NCRO:0000900 miRBase:MI0015842 hsa-mir-4312 NCRO:0000901 miRBase:MI0015843 hsa-mir-4313 NCRO:0000902 miRBase:MI0015845 hsa-mir-4316 NCRO:0000903 miRBase:MI0015846 hsa-mir-4314 NCRO:0000904 miRBase:MI0015847 hsa-mir-4318 NCRO:0000905 miRBase:MI0015848 hsa-mir-4319 NCRO:0000906 miRBase:MI0015849 hsa-mir-4320 NCRO:0000907 miRBase:MI0015850 hsa-mir-4317 NCRO:0000908 miRBase:MI0015851 hsa-mir-4322 NCRO:0000909 miRBase:MI0015852 hsa-mir-4321 NCRO:0000910 miRBase:MI0015853 hsa-mir-4323 NCRO:0000911 miRBase:MI0015854 hsa-mir-4324 NCRO:0000912 miRBase:MI0015855 hsa-mir-4256 NCRO:0000913 miRBase:MI0015856 hsa-mir-4257 NCRO:0000914 miRBase:MI0015857 hsa-mir-4258 NCRO:0000915 miRBase:MI0015858 hsa-mir-4259 NCRO:0000916 miRBase:MI0015859 hsa-mir-4260 NCRO:0000917 miRBase:MI0015860 hsa-mir-4253 NCRO:0000918 miRBase:MI0015861 hsa-mir-4251 NCRO:0000919 miRBase:MI0015862 hsa-mir-4254 NCRO:0000920 miRBase:MI0015863 hsa-mir-4255 NCRO:0000921 miRBase:MI0015864 hsa-mir-4252 NCRO:0000922 miRBase:MI0015865 hsa-mir-4325 NCRO:0000923 miRBase:MI0015866 hsa-mir-4326 NCRO:0000924 miRBase:MI0015867 hsa-mir-4327 NCRO:0000925 miRBase:MI0015868 hsa-mir-4261 NCRO:0000926 miRBase:MI0015869 hsa-mir-4265 NCRO:0000927 miRBase:MI0015870 hsa-mir-4266 NCRO:0000928 miRBase:MI0015871 hsa-mir-4267 NCRO:0000929 miRBase:MI0015872 hsa-mir-4262 NCRO:0000930 miRBase:MI0015874 hsa-mir-4268 NCRO:0000931 miRBase:MI0015875 hsa-mir-4269 NCRO:0000932 miRBase:MI0015876 hsa-mir-4263 NCRO:0000933 miRBase:MI0015877 hsa-mir-4264 NCRO:0000934 miRBase:MI0015878 hsa-mir-4270 NCRO:0000935 miRBase:MI0015879 hsa-mir-4271 NCRO:0000936 miRBase:MI0015880 hsa-mir-4272 NCRO:0000937 miRBase:MI0015881 hsa-mir-4273 NCRO:0000938 miRBase:MI0015882 hsa-mir-4276 NCRO:0000939 miRBase:MI0015883 hsa-mir-4275 NCRO:0000940 miRBase:MI0015884 hsa-mir-4274 NCRO:0000941 miRBase:MI0015885 hsa-mir-4281 NCRO:0000942 miRBase:MI0015886 hsa-mir-4277 NCRO:0000943 miRBase:MI0015887 hsa-mir-4279 NCRO:0000944 miRBase:MI0015888 hsa-mir-4278 NCRO:0000945 miRBase:MI0015889 hsa-mir-4280 NCRO:0000946 miRBase:MI0015890 hsa-mir-4282 NCRO:0000947 miRBase:MI0015891 hsa-mir-4285 NCRO:0000948 miRBase:MI0015893 hsa-mir-4284 NCRO:0000949 miRBase:MI0015894 hsa-mir-4286 NCRO:0000950 miRBase:MI0015895 hsa-mir-4287 NCRO:0000951 miRBase:MI0015896 hsa-mir-4288 NCRO:0000952 miRBase:MI0015897 hsa-mir-4292 NCRO:0000953 miRBase:MI0015898 hsa-mir-4289 NCRO:0000954 miRBase:MI0015899 hsa-mir-4290 NCRO:0000955 miRBase:MI0015900 hsa-mir-4291 NCRO:0000956 miRBase:MI0015901 hsa-mir-4329 NCRO:0000957 miRBase:MI0015902 hsa-mir-4330 NCRO:0000958 miRBase:MI0015904 hsa-mir-4328 NCRO:0000959 miRBase:MI0015996 hsa-mir-3606 NCRO:0000960 miRBase:MI0015999 hsa-mir-3609 NCRO:0000961 miRBase:MI0016000 hsa-mir-3610 NCRO:0000962 miRBase:MI0016001 hsa-mir-3611 NCRO:0000963 miRBase:MI0016004 hsa-mir-3614 NCRO:0000964 miRBase:MI0016006 hsa-mir-3616 NCRO:0000965 miRBase:MI0016009 hsa-mir-3619 NCRO:0000966 miRBase:MI0016011 hsa-mir-3620 NCRO:0000967 miRBase:MI0016012 hsa-mir-3621 NCRO:0000968 miRBase:MI0016046 hsa-mir-3646 NCRO:0000969 miRBase:MI0016049 hsa-mir-3649 NCRO:0000970 miRBase:MI0016050 hsa-mir-3650 NCRO:0000971 miRBase:MI0016051 hsa-mir-3651 NCRO:0000972 miRBase:MI0016052 hsa-mir-3652 NCRO:0000973 miRBase:MI0016053 hsa-mir-3653 NCRO:0000974 miRBase:MI0016054 hsa-mir-3654 NCRO:0000975 miRBase:MI0016055 hsa-mir-3655 NCRO:0000976 miRBase:MI0016056 hsa-mir-3656 NCRO:0000977 miRBase:MI0016057 hsa-mir-3657 NCRO:0000978 miRBase:MI0016058 hsa-mir-3658 NCRO:0000979 miRBase:MI0016060 hsa-mir-3659 NCRO:0000980 miRBase:MI0016063 hsa-mir-3662 NCRO:0000981 miRBase:MI0016064 hsa-mir-3663 NCRO:0000982 miRBase:MI0016066 hsa-mir-3665 NCRO:0000983 miRBase:MI0016067 hsa-mir-3666 NCRO:0000984 miRBase:MI0016068 hsa-mir-3667 NCRO:0000985 miRBase:MI0016069 hsa-mir-3668 NCRO:0000986 miRBase:MI0016072 hsa-mir-3671 NCRO:0000987 miRBase:MI0016073 hsa-mir-3672 NCRO:0000988 miRBase:MI0016075 hsa-mir-3674 NCRO:0000989 miRBase:MI0016076 hsa-mir-3675 NCRO:0000990 miRBase:MI0016078 hsa-mir-3677 NCRO:0000991 miRBase:MI0016079 hsa-mir-3678 NCRO:0000992 miRBase:MI0016080 hsa-mir-3679 NCRO:0000993 miRBase:MI0016082 hsa-mir-3681 NCRO:0000994 miRBase:MI0016083 hsa-mir-3682 NCRO:0000995 miRBase:MI0016084 hsa-mir-3683 NCRO:0000996 miRBase:MI0016085 hsa-mir-3684 NCRO:0000997 miRBase:MI0016086 hsa-mir-3685 NCRO:0000998 miRBase:MI0016087 hsa-mir-3686 NCRO:0000999 miRBase:MI0016092 hsa-mir-3691 NCRO:0001000 miRBase:MI0016093 hsa-mir-3692 NCRO:0001001 miRBase:MI0016134 hsa-mir-3713 NCRO:0001002 miRBase:MI0016135 hsa-mir-3714 NCRO:0001003 miRBase:MI0016410 hsa-mir-3907 NCRO:0001004 miRBase:MI0016412 hsa-mir-3908 NCRO:0001005 miRBase:MI0016413 hsa-mir-3909 NCRO:0001006 miRBase:MI0016415 hsa-mir-3911 NCRO:0001007 miRBase:MI0016420 hsa-mir-3915 NCRO:0001008 miRBase:MI0016422 hsa-mir-3916 NCRO:0001009 miRBase:MI0016423 hsa-mir-3917 NCRO:0001010 miRBase:MI0016424 hsa-mir-3918 NCRO:0001011 miRBase:MI0016425 hsa-mir-3919 NCRO:0001012 miRBase:MI0016427 hsa-mir-3920 NCRO:0001013 miRBase:MI0016428 hsa-mir-3921 NCRO:0001014 miRBase:MI0016429 hsa-mir-3922 NCRO:0001015 miRBase:MI0016432 hsa-mir-3924 NCRO:0001016 miRBase:MI0016433 hsa-mir-3925 NCRO:0001017 miRBase:MI0016438 hsa-mir-3928 NCRO:0001018 miRBase:MI0016439 hsa-mir-3929 NCRO:0001019 miRBase:MI0016591 hsa-mir-3935 NCRO:0001020 miRBase:MI0016592 hsa-mir-3936 NCRO:0001021 miRBase:MI0016596 hsa-mir-3939 NCRO:0001022 miRBase:MI0016598 hsa-mir-3941 NCRO:0001023 miRBase:MI0016599 hsa-mir-3942 NCRO:0001024 miRBase:MI0016601 hsa-mir-3944 NCRO:0001025 miRBase:MI0016602 hsa-mir-3945 NCRO:0001026 miRBase:MI0016748 hsa-mir-1268b NCRO:0001027 miRBase:MI0016753 hsa-mir-4417 NCRO:0001028 miRBase:MI0016754 hsa-mir-4418 NCRO:0001029 miRBase:MI0016755 hsa-mir-4419a NCRO:0001030 miRBase:MI0016756 hsa-mir-378f NCRO:0001031 miRBase:MI0016757 hsa-mir-4420 NCRO:0001032 miRBase:MI0016759 hsa-mir-4422 NCRO:0001033 miRBase:MI0016761 hsa-mir-378g NCRO:0001034 miRBase:MI0016763 hsa-mir-4424 NCRO:0001035 miRBase:MI0016764 hsa-mir-4425 NCRO:0001036 miRBase:MI0016765 hsa-mir-4426 NCRO:0001037 miRBase:MI0016769 hsa-mir-4430 NCRO:0001038 miRBase:MI0016771 hsa-mir-4431 NCRO:0001039 miRBase:MI0016772 hsa-mir-4432 NCRO:0001040 miRBase:MI0016774 hsa-mir-4434 NCRO:0001041 miRBase:MI0016778 hsa-mir-4437 NCRO:0001042 miRBase:MI0016781 hsa-mir-4438 NCRO:0001043 miRBase:MI0016782 hsa-mir-4439 NCRO:0001044 miRBase:MI0016783 hsa-mir-4440 NCRO:0001045 miRBase:MI0016784 hsa-mir-4441 NCRO:0001046 miRBase:MI0016785 hsa-mir-4442 NCRO:0001047 miRBase:MI0016786 hsa-mir-4443 NCRO:0001048 miRBase:MI0016788 hsa-mir-4445 NCRO:0001049 miRBase:MI0016790 hsa-mir-4447 NCRO:0001050 miRBase:MI0016791 hsa-mir-4448 NCRO:0001051 miRBase:MI0016795 hsa-mir-4450 NCRO:0001052 miRBase:MI0016798 hsa-mir-4452 NCRO:0001053 miRBase:MI0016799 hsa-mir-4453 NCRO:0001054 miRBase:MI0016800 hsa-mir-4454 NCRO:0001055 miRBase:MI0016801 hsa-mir-4455 NCRO:0001056 miRBase:MI0016802 hsa-mir-4456 NCRO:0001057 miRBase:MI0016803 hsa-mir-4457 NCRO:0001058 miRBase:MI0016804 hsa-mir-4458 NCRO:0001059 miRBase:MI0016805 hsa-mir-4459 NCRO:0001060 miRBase:MI0016806 hsa-mir-4460 NCRO:0001061 miRBase:MI0016807 hsa-mir-4461 NCRO:0001062 miRBase:MI0016808 hsa-mir-378h NCRO:0001063 miRBase:MI0016810 hsa-mir-4462 NCRO:0001064 miRBase:MI0016811 hsa-mir-4463 NCRO:0001065 miRBase:MI0016812 hsa-mir-4464 NCRO:0001066 miRBase:MI0016816 hsa-mir-4465 NCRO:0001067 miRBase:MI0016817 hsa-mir-4466 NCRO:0001068 miRBase:MI0016818 hsa-mir-4467 NCRO:0001069 miRBase:MI0016819 hsa-mir-4468 NCRO:0001070 miRBase:MI0016820 hsa-mir-4469 NCRO:0001071 miRBase:MI0016821 hsa-mir-4470 NCRO:0001072 miRBase:MI0016822 hsa-mir-4471 NCRO:0001073 miRBase:MI0016823 hsa-mir-4472-1 NCRO:0001074 miRBase:MI0016824 hsa-mir-4472-2 NCRO:0001075 miRBase:MI0016825 hsa-mir-4473 NCRO:0001076 miRBase:MI0016826 hsa-mir-4474 NCRO:0001077 miRBase:MI0016827 hsa-mir-4475 NCRO:0001078 miRBase:MI0016828 hsa-mir-4476 NCRO:0001079 miRBase:MI0016831 hsa-mir-4478 NCRO:0001080 miRBase:MI0016838 hsa-mir-4479 NCRO:0001081 miRBase:MI0016841 hsa-mir-4480 NCRO:0001082 miRBase:MI0016842 hsa-mir-4481 NCRO:0001083 miRBase:MI0016843 hsa-mir-4482 NCRO:0001084 miRBase:MI0016844 hsa-mir-4483 NCRO:0001085 miRBase:MI0016846 hsa-mir-4485 NCRO:0001086 miRBase:MI0016847 hsa-mir-4486 NCRO:0001087 miRBase:MI0016848 hsa-mir-4487 NCRO:0001088 miRBase:MI0016850 hsa-mir-4489 NCRO:0001089 miRBase:MI0016852 hsa-mir-4490 NCRO:0001090 miRBase:MI0016853 hsa-mir-4491 NCRO:0001091 miRBase:MI0016854 hsa-mir-4492 NCRO:0001092 miRBase:MI0016855 hsa-mir-4493 NCRO:0001093 miRBase:MI0016856 hsa-mir-4494 NCRO:0001094 miRBase:MI0016857 hsa-mir-4495 NCRO:0001095 miRBase:MI0016858 hsa-mir-4496 NCRO:0001096 miRBase:MI0016859 hsa-mir-4497 NCRO:0001097 miRBase:MI0016860 hsa-mir-4498 NCRO:0001098 miRBase:MI0016861 hsa-mir-4419b NCRO:0001099 miRBase:MI0016862 hsa-mir-4499 NCRO:0001100 miRBase:MI0016863 hsa-mir-4500 NCRO:0001101 miRBase:MI0016864 hsa-mir-4501 NCRO:0001102 miRBase:MI0016865 hsa-mir-4502 NCRO:0001103 miRBase:MI0016866 hsa-mir-4503 NCRO:0001104 miRBase:MI0016868 hsa-mir-4505 NCRO:0001105 miRBase:MI0016869 hsa-mir-4506 NCRO:0001106 miRBase:MI0016871 hsa-mir-4507 NCRO:0001107 miRBase:MI0016872 hsa-mir-4508 NCRO:0001108 miRBase:MI0016877 hsa-mir-4511 NCRO:0001109 miRBase:MI0016878 hsa-mir-4512 NCRO:0001110 miRBase:MI0016879 hsa-mir-4513 NCRO:0001111 miRBase:MI0016880 hsa-mir-4514 NCRO:0001112 miRBase:MI0016882 hsa-mir-4516 NCRO:0001113 miRBase:MI0016883 hsa-mir-4517 NCRO:0001114 miRBase:MI0016884 hsa-mir-4518 NCRO:0001115 miRBase:MI0016885 hsa-mir-4519 NCRO:0001116 miRBase:MI0016887 hsa-mir-4521 NCRO:0001117 miRBase:MI0016888 hsa-mir-1269b NCRO:0001118 miRBase:MI0016889 hsa-mir-4522 NCRO:0001119 miRBase:MI0016892 hsa-mir-4525 NCRO:0001120 miRBase:MI0016894 hsa-mir-4527 NCRO:0001121 miRBase:MI0016895 hsa-mir-4528 NCRO:0001122 miRBase:MI0016897 hsa-mir-4530 NCRO:0001123 miRBase:MI0016898 hsa-mir-4531 NCRO:0001124 miRBase:MI0016899 hsa-mir-4532 NCRO:0001125 miRBase:MI0016900 hsa-mir-4533 NCRO:0001126 miRBase:MI0016901 hsa-mir-4534 NCRO:0001127 miRBase:MI0016902 hsa-mir-378i NCRO:0001128 miRBase:MI0016903 hsa-mir-4535 NCRO:0001129 miRBase:MI0016905 hsa-mir-1587 NCRO:0001130 miRBase:MI0016908 hsa-mir-4537 NCRO:0001131 miRBase:MI0016909 hsa-mir-4538 NCRO:0001132 miRBase:MI0016910 hsa-mir-4539 NCRO:0001133 miRBase:MI0016911 hsa-mir-4540 NCRO:0001134 miRBase:MI0016990 hsa-mir-3972 NCRO:0001135 miRBase:MI0016991 hsa-mir-3973 NCRO:0001136 miRBase:MI0016992 hsa-mir-3974 NCRO:0001137 miRBase:MI0016993 hsa-mir-3975 NCRO:0001138 miRBase:MI0016994 hsa-mir-3976 NCRO:0001139 miRBase:MI0016995 hsa-mir-3977 NCRO:0001140 miRBase:MI0016996 hsa-mir-3978 NCRO:0001141 miRBase:MI0017259 hsa-mir-4632 NCRO:0001142 miRBase:MI0017260 hsa-mir-4633 NCRO:0001143 miRBase:MI0017261 hsa-mir-4634 NCRO:0001144 miRBase:MI0017262 hsa-mir-4635 NCRO:0001145 miRBase:MI0017263 hsa-mir-4636 NCRO:0001146 miRBase:MI0017265 hsa-mir-4638 NCRO:0001147 miRBase:MI0017266 hsa-mir-4639 NCRO:0001148 miRBase:MI0017267 hsa-mir-4640 NCRO:0001149 miRBase:MI0017268 hsa-mir-4641 NCRO:0001150 miRBase:MI0017269 hsa-mir-4642 NCRO:0001151 miRBase:MI0017270 hsa-mir-4643 NCRO:0001152 miRBase:MI0017271 hsa-mir-4644 NCRO:0001153 miRBase:MI0017272 hsa-mir-4645 NCRO:0001154 miRBase:MI0017273 hsa-mir-4646 NCRO:0001155 miRBase:MI0017274 hsa-mir-4647 NCRO:0001156 miRBase:MI0017275 hsa-mir-4648 NCRO:0001157 miRBase:MI0017276 hsa-mir-4649 NCRO:0001158 miRBase:MI0017279 hsa-mir-4651 NCRO:0001159 miRBase:MI0017280 hsa-mir-4652 NCRO:0001160 miRBase:MI0017281 hsa-mir-4653 NCRO:0001161 miRBase:MI0017283 hsa-mir-4655 NCRO:0001162 miRBase:MI0017284 hsa-mir-4656 NCRO:0001163 miRBase:MI0017286 hsa-mir-4658 NCRO:0001164 miRBase:MI0017289 hsa-mir-4661 NCRO:0001165 miRBase:MI0017292 hsa-mir-4663 NCRO:0001166 miRBase:MI0017294 hsa-mir-4664 NCRO:0001167 miRBase:MI0017295 hsa-mir-4665 NCRO:0001168 miRBase:MI0017296 hsa-mir-4666a NCRO:0001169 miRBase:MI0017298 hsa-mir-4668 NCRO:0001170 miRBase:MI0017300 hsa-mir-4669 NCRO:0001171 miRBase:MI0017301 hsa-mir-4670 NCRO:0001172 miRBase:MI0017302 hsa-mir-4671 NCRO:0001173 miRBase:MI0017304 hsa-mir-4673 NCRO:0001174 miRBase:MI0017305 hsa-mir-4674 NCRO:0001175 miRBase:MI0017306 hsa-mir-4675 NCRO:0001176 miRBase:MI0017307 hsa-mir-4676 NCRO:0001177 miRBase:MI0017309 hsa-mir-4678 NCRO:0001178 miRBase:MI0017313 hsa-mir-4681 NCRO:0001179 miRBase:MI0017314 hsa-mir-4682 NCRO:0001180 miRBase:MI0017315 hsa-mir-4683 NCRO:0001181 miRBase:MI0017316 hsa-mir-4684 NCRO:0001182 miRBase:MI0017317 hsa-mir-4685 NCRO:0001183 miRBase:MI0017318 hsa-mir-4686 NCRO:0001184 miRBase:MI0017319 hsa-mir-4687 NCRO:0001185 miRBase:MI0017321 hsa-mir-4688 NCRO:0001186 miRBase:MI0017322 hsa-mir-4689 NCRO:0001187 miRBase:MI0017323 hsa-mir-4690 NCRO:0001188 miRBase:MI0017324 hsa-mir-4691 NCRO:0001189 miRBase:MI0017325 hsa-mir-4692 NCRO:0001190 miRBase:MI0017326 hsa-mir-4693 NCRO:0001191 miRBase:MI0017327 hsa-mir-4694 NCRO:0001192 miRBase:MI0017328 hsa-mir-4695 NCRO:0001193 miRBase:MI0017329 hsa-mir-4696 NCRO:0001194 miRBase:MI0017330 hsa-mir-4697 NCRO:0001195 miRBase:MI0017331 hsa-mir-4698 NCRO:0001196 miRBase:MI0017332 hsa-mir-4699 NCRO:0001197 miRBase:MI0017333 hsa-mir-4700 NCRO:0001198 miRBase:MI0017334 hsa-mir-4701 NCRO:0001199 miRBase:MI0017337 hsa-mir-4704 NCRO:0001200 miRBase:MI0017338 hsa-mir-4705 NCRO:0001201 miRBase:MI0017339 hsa-mir-4706 NCRO:0001202 miRBase:MI0017340 hsa-mir-4707 NCRO:0001203 miRBase:MI0017341 hsa-mir-4708 NCRO:0001204 miRBase:MI0017342 hsa-mir-4709 NCRO:0001205 miRBase:MI0017344 hsa-mir-4710 NCRO:0001206 miRBase:MI0017345 hsa-mir-4711 NCRO:0001207 miRBase:MI0017346 hsa-mir-4712 NCRO:0001208 miRBase:MI0017347 hsa-mir-4713 NCRO:0001209 miRBase:MI0017348 hsa-mir-4714 NCRO:0001210 miRBase:MI0017349 hsa-mir-4715 NCRO:0001211 miRBase:MI0017352 hsa-mir-4717 NCRO:0001212 miRBase:MI0017353 hsa-mir-4718 NCRO:0001213 miRBase:MI0017354 hsa-mir-4719 NCRO:0001214 miRBase:MI0017355 hsa-mir-4720 NCRO:0001215 miRBase:MI0017356 hsa-mir-4721 NCRO:0001216 miRBase:MI0017357 hsa-mir-4722 NCRO:0001217 miRBase:MI0017359 hsa-mir-4723 NCRO:0001218 miRBase:MI0017361 hsa-mir-4724 NCRO:0001219 miRBase:MI0017362 hsa-mir-4725 NCRO:0001220 miRBase:MI0017363 hsa-mir-4726 NCRO:0001221 miRBase:MI0017364 hsa-mir-4727 NCRO:0001222 miRBase:MI0017365 hsa-mir-4728 NCRO:0001223 miRBase:MI0017366 hsa-mir-4729 NCRO:0001224 miRBase:MI0017367 hsa-mir-4730 NCRO:0001225 miRBase:MI0017368 hsa-mir-4731 NCRO:0001226 miRBase:MI0017369 hsa-mir-4732 NCRO:0001227 miRBase:MI0017370 hsa-mir-4733 NCRO:0001228 miRBase:MI0017371 hsa-mir-4734 NCRO:0001229 miRBase:MI0017372 hsa-mir-4735 NCRO:0001230 miRBase:MI0017373 hsa-mir-4736 NCRO:0001231 miRBase:MI0017374 hsa-mir-4737 NCRO:0001232 miRBase:MI0017377 hsa-mir-4739 NCRO:0001233 miRBase:MI0017378 hsa-mir-4740 NCRO:0001234 miRBase:MI0017379 hsa-mir-4741 NCRO:0001235 miRBase:MI0017382 hsa-mir-4744 NCRO:0001236 miRBase:MI0017384 hsa-mir-4745 NCRO:0001237 miRBase:MI0017385 hsa-mir-4746 NCRO:0001238 miRBase:MI0017386 hsa-mir-4747 NCRO:0001239 miRBase:MI0017387 hsa-mir-4748 NCRO:0001240 miRBase:MI0017388 hsa-mir-4749 NCRO:0001241 miRBase:MI0017389 hsa-mir-4750 NCRO:0001242 miRBase:MI0017390 hsa-mir-4751 NCRO:0001243 miRBase:MI0017391 hsa-mir-4752 NCRO:0001244 miRBase:MI0017392 hsa-mir-4753 NCRO:0001245 miRBase:MI0017394 hsa-mir-4754 NCRO:0001246 miRBase:MI0017395 hsa-mir-4755 NCRO:0001247 miRBase:MI0017396 hsa-mir-499b NCRO:0001248 miRBase:MI0017397 hsa-mir-4756 NCRO:0001249 miRBase:MI0017398 hsa-mir-4757 NCRO:0001250 miRBase:MI0017399 hsa-mir-4758 NCRO:0001251 miRBase:MI0017400 hsa-mir-4759 NCRO:0001252 miRBase:MI0017401 hsa-mir-4760 NCRO:0001253 miRBase:MI0017402 hsa-mir-4761 NCRO:0001254 miRBase:MI0017403 hsa-mir-4762 NCRO:0001255 miRBase:MI0017404 hsa-mir-4763 NCRO:0001256 miRBase:MI0017405 hsa-mir-4764 NCRO:0001257 miRBase:MI0017406 hsa-mir-4765 NCRO:0001258 miRBase:MI0017408 hsa-mir-4767 NCRO:0001259 miRBase:MI0017409 hsa-mir-4768 NCRO:0001260 miRBase:MI0017410 hsa-mir-4769 NCRO:0001261 miRBase:MI0017411 hsa-mir-4770 NCRO:0001262 miRBase:MI0017414 hsa-mir-4772 NCRO:0001263 miRBase:MI0017418 hsa-mir-4775 NCRO:0001264 miRBase:MI0017421 hsa-mir-4777 NCRO:0001265 miRBase:MI0017422 hsa-mir-4778 NCRO:0001266 miRBase:MI0017423 hsa-mir-4779 NCRO:0001267 miRBase:MI0017424 hsa-mir-4780 NCRO:0001268 miRBase:MI0017426 hsa-mir-4781 NCRO:0001269 miRBase:MI0017428 hsa-mir-4783 NCRO:0001270 miRBase:MI0017429 hsa-mir-4784 NCRO:0001271 miRBase:MI0017430 hsa-mir-4785 NCRO:0001272 miRBase:MI0017432 hsa-mir-2467 NCRO:0001273 miRBase:MI0017433 hsa-mir-4786 NCRO:0001274 miRBase:MI0017434 hsa-mir-4787 NCRO:0001275 miRBase:MI0017436 hsa-mir-4789 NCRO:0001276 miRBase:MI0017437 hsa-mir-4790 NCRO:0001277 miRBase:MI0017439 hsa-mir-4792 NCRO:0001278 miRBase:MI0017440 hsa-mir-4793 NCRO:0001279 miRBase:MI0017441 hsa-mir-4794 NCRO:0001280 miRBase:MI0017442 hsa-mir-4795 NCRO:0001281 miRBase:MI0017444 hsa-mir-4797 NCRO:0001282 miRBase:MI0017446 hsa-mir-4799 NCRO:0001283 miRBase:MI0017448 hsa-mir-4800 NCRO:0001284 miRBase:MI0017449 hsa-mir-4801 NCRO:0001285 miRBase:MI0017450 hsa-mir-4802 NCRO:0001286 miRBase:MI0017452 hsa-mir-4804 NCRO:0001287 miRBase:MI0017865 hsa-mir-4999 NCRO:0001288 miRBase:MI0017866 hsa-mir-5000 NCRO:0001289 miRBase:MI0017867 hsa-mir-5001 NCRO:0001290 miRBase:MI0017868 hsa-mir-5002 NCRO:0001291 miRBase:MI0017869 hsa-mir-5003 NCRO:0001292 miRBase:MI0017870 hsa-mir-5004 NCRO:0001293 miRBase:MI0017873 hsa-mir-5006 NCRO:0001294 miRBase:MI0017874 hsa-mir-5007 NCRO:0001295 miRBase:MI0017876 hsa-mir-5008 NCRO:0001296 miRBase:MI0017877 hsa-mir-5009 NCRO:0001297 miRBase:MI0017878 hsa-mir-5010 NCRO:0001298 miRBase:MI0017879 hsa-mir-5011 NCRO:0001299 miRBase:MI0017932 hsa-mir-5047 NCRO:0001300 miRBase:MI0017976 hsa-mir-5087 NCRO:0001301 miRBase:MI0017977 hsa-mir-5088 NCRO:0001302 miRBase:MI0017978 hsa-mir-5089 NCRO:0001303 miRBase:MI0017979 hsa-mir-5090 NCRO:0001304 miRBase:MI0017980 hsa-mir-5091 NCRO:0001305 miRBase:MI0017981 hsa-mir-5092 NCRO:0001306 miRBase:MI0017982 hsa-mir-5093 NCRO:0001307 miRBase:MI0017983 hsa-mir-5094 NCRO:0001308 miRBase:MI0018001 hsa-mir-5095 NCRO:0001309 miRBase:MI0018004 hsa-mir-5096 NCRO:0001310 miRBase:MI0018165 hsa-mir-5186 NCRO:0001311 miRBase:MI0018166 hsa-mir-5187 NCRO:0001312 miRBase:MI0018167 hsa-mir-5188 NCRO:0001313 miRBase:MI0018168 hsa-mir-5189 NCRO:0001314 miRBase:MI0018169 hsa-mir-5190 NCRO:0001315 miRBase:MI0018170 hsa-mir-5191 NCRO:0001316 miRBase:MI0018171 hsa-mir-5192 NCRO:0001317 miRBase:MI0018172 hsa-mir-5193 NCRO:0001318 miRBase:MI0018173 hsa-mir-5194 NCRO:0001319 miRBase:MI0018174 hsa-mir-5195 NCRO:0001320 miRBase:MI0018175 hsa-mir-5196 NCRO:0001321 miRBase:MI0018176 hsa-mir-5197 NCRO:0001322 miRBase:MI0019115 hsa-mir-5571 NCRO:0001323 miRBase:MI0019116 hsa-mir-5100 NCRO:0001324 miRBase:MI0019117 hsa-mir-5572 NCRO:0001325 miRBase:MI0019133 hsa-mir-5579 NCRO:0001326 miRBase:MI0019135 hsa-mir-5580 NCRO:0001327 miRBase:MI0019136 hsa-mir-5581 NCRO:0001328 miRBase:MI0019138 hsa-mir-5582 NCRO:0001329 miRBase:MI0019141 hsa-mir-5584 NCRO:0001330 miRBase:MI0019142 hsa-mir-5585 NCRO:0001331 miRBase:MI0019143 hsa-mir-5586 NCRO:0001332 miRBase:MI0019144 hsa-mir-5587 NCRO:0001333 miRBase:MI0019146 hsa-mir-1295b NCRO:0001334 miRBase:MI0019147 hsa-mir-5588 NCRO:0001335 miRBase:MI0019148 hsa-mir-5589 NCRO:0001336 miRBase:MI0019150 hsa-mir-5590 NCRO:0001337 miRBase:MI0019151 hsa-mir-5591 NCRO:0001338 miRBase:MI0019280 hsa-mir-5680 NCRO:0001339 miRBase:MI0019282 hsa-mir-5682 NCRO:0001340 miRBase:MI0019284 hsa-mir-5683 NCRO:0001341 miRBase:MI0019285 hsa-mir-5684 NCRO:0001342 miRBase:MI0019287 hsa-mir-5685 NCRO:0001343 miRBase:MI0019291 hsa-mir-5687 NCRO:0001344 miRBase:MI0019292 hsa-mir-5688 NCRO:0001345 miRBase:MI0019294 hsa-mir-5689 NCRO:0001346 miRBase:MI0019295 hsa-mir-5690 NCRO:0001347 miRBase:MI0019296 hsa-mir-5691 NCRO:0001348 miRBase:MI0019299 hsa-mir-4666b NCRO:0001349 miRBase:MI0019300 hsa-mir-5693 NCRO:0001350 miRBase:MI0019301 hsa-mir-5694 NCRO:0001351 miRBase:MI0019302 hsa-mir-5695 NCRO:0001352 miRBase:MI0019303 hsa-mir-5696 NCRO:0001353 miRBase:MI0019305 hsa-mir-5698 NCRO:0001354 miRBase:MI0019306 hsa-mir-5699 NCRO:0001355 miRBase:MI0019307 hsa-mir-5700 NCRO:0001356 miRBase:MI0019309 hsa-mir-5702 NCRO:0001357 miRBase:MI0019310 hsa-mir-5703 NCRO:0001358 miRBase:MI0019311 hsa-mir-5692b NCRO:0001359 miRBase:MI0019312 hsa-mir-5704 NCRO:0001360 miRBase:MI0019313 hsa-mir-5705 NCRO:0001361 miRBase:MI0019314 hsa-mir-5706 NCRO:0001362 miRBase:MI0019315 hsa-mir-5707 NCRO:0001363 miRBase:MI0019412 hsa-mir-5739 NCRO:0001364 miRBase:MI0019797 hsa-mir-5787 NCRO:0001365 miRBase:MI0020345 hsa-mir-6068 NCRO:0001366 miRBase:MI0020346 hsa-mir-6069 NCRO:0001367 miRBase:MI0020347 hsa-mir-6070 NCRO:0001368 miRBase:MI0020348 hsa-mir-6071 NCRO:0001369 miRBase:MI0020349 hsa-mir-6072 NCRO:0001370 miRBase:MI0020350 hsa-mir-6073 NCRO:0001371 miRBase:MI0020351 hsa-mir-6074 NCRO:0001372 miRBase:MI0020352 hsa-mir-6075 NCRO:0001373 miRBase:MI0020353 hsa-mir-6076 NCRO:0001374 miRBase:MI0020354 hsa-mir-6077 NCRO:0001375 miRBase:MI0020355 hsa-mir-6078 NCRO:0001376 miRBase:MI0020356 hsa-mir-6079 NCRO:0001377 miRBase:MI0020357 hsa-mir-6080 NCRO:0001378 miRBase:MI0020358 hsa-mir-6081 NCRO:0001379 miRBase:MI0020359 hsa-mir-6082 NCRO:0001380 miRBase:MI0020360 hsa-mir-6083 NCRO:0001381 miRBase:MI0020361 hsa-mir-6084 NCRO:0001382 miRBase:MI0020362 hsa-mir-6085 NCRO:0001383 miRBase:MI0020363 hsa-mir-6086 NCRO:0001384 miRBase:MI0020364 hsa-mir-6087 NCRO:0001385 miRBase:MI0020365 hsa-mir-6088 NCRO:0001386 miRBase:MI0020367 hsa-mir-6090 NCRO:0001387 miRBase:MI0021258 hsa-mir-6124 NCRO:0001388 miRBase:MI0021259 hsa-mir-6125 NCRO:0001389 miRBase:MI0021260 hsa-mir-6126 NCRO:0001390 miRBase:MI0021472 hsa-mir-6165 NCRO:0001391 miRBase:MI0022209 hsa-mir-6499 NCRO:0001392 miRBase:MI0022213 hsa-mir-6501 NCRO:0001393 miRBase:MI0022214 hsa-mir-6502 NCRO:0001394 miRBase:MI0022215 hsa-mir-6503 NCRO:0001395 miRBase:MI0022216 hsa-mir-6504 NCRO:0001396 miRBase:MI0022218 hsa-mir-6506 NCRO:0001397 miRBase:MI0022219 hsa-mir-6507 NCRO:0001398 miRBase:MI0022220 hsa-mir-6508 NCRO:0001399 miRBase:MI0022221 hsa-mir-6509 NCRO:0001400 miRBase:MI0022222 hsa-mir-6510 NCRO:0001401 miRBase:MI0022224 hsa-mir-6512 NCRO:0001402 miRBase:MI0022225 hsa-mir-6513 NCRO:0001403 miRBase:MI0022226 hsa-mir-6514 NCRO:0001404 miRBase:MI0022227 hsa-mir-6515 NCRO:0001405 miRBase:MI0022549 hsa-mir-6715b NCRO:0001406 miRBase:MI0022550 hsa-mir-6716 NCRO:0001407 miRBase:MI0022551 hsa-mir-6717 NCRO:0001408 miRBase:MI0022553 hsa-mir-6718 NCRO:0001409 miRBase:MI0022554 hsa-mir-6719 NCRO:0001410 miRBase:MI0022555 hsa-mir-6720 NCRO:0001411 miRBase:MI0022556 hsa-mir-6721 NCRO:0001412 miRBase:MI0022557 hsa-mir-6722 NCRO:0001413 miRBase:MI0022558 hsa-mir-6723 NCRO:0001414 miRBase:MI0022571 hsa-mir-6726 NCRO:0001415 miRBase:MI0022572 hsa-mir-6727 NCRO:0001416 miRBase:MI0022573 hsa-mir-6728 NCRO:0001417 miRBase:MI0022574 hsa-mir-6729 NCRO:0001418 miRBase:MI0022575 hsa-mir-6730 NCRO:0001419 miRBase:MI0022576 hsa-mir-6731 NCRO:0001420 miRBase:MI0022577 hsa-mir-6732 NCRO:0001421 miRBase:MI0022578 hsa-mir-6733 NCRO:0001422 miRBase:MI0022579 hsa-mir-6734 NCRO:0001423 miRBase:MI0022580 hsa-mir-6735 NCRO:0001424 miRBase:MI0022581 hsa-mir-6736 NCRO:0001425 miRBase:MI0022582 hsa-mir-6737 NCRO:0001426 miRBase:MI0022583 hsa-mir-6738 NCRO:0001427 miRBase:MI0022584 hsa-mir-6739 NCRO:0001428 miRBase:MI0022585 hsa-mir-6740 NCRO:0001429 miRBase:MI0022586 hsa-mir-6741 NCRO:0001430 miRBase:MI0022587 hsa-mir-6742 NCRO:0001431 miRBase:MI0022588 hsa-mir-6743 NCRO:0001432 miRBase:MI0022589 hsa-mir-6744 NCRO:0001433 miRBase:MI0022590 hsa-mir-6745 NCRO:0001434 miRBase:MI0022591 hsa-mir-6746 NCRO:0001435 miRBase:MI0022592 hsa-mir-6747 NCRO:0001436 miRBase:MI0022593 hsa-mir-6748 NCRO:0001437 miRBase:MI0022594 hsa-mir-6749 NCRO:0001438 miRBase:MI0022595 hsa-mir-6750 NCRO:0001439 miRBase:MI0022596 hsa-mir-6751 NCRO:0001440 miRBase:MI0022597 hsa-mir-6752 NCRO:0001441 miRBase:MI0022598 hsa-mir-6753 NCRO:0001442 miRBase:MI0022599 hsa-mir-6754 NCRO:0001443 miRBase:MI0022600 hsa-mir-6755 NCRO:0001444 miRBase:MI0022601 hsa-mir-6756 NCRO:0001445 miRBase:MI0022602 hsa-mir-6757 NCRO:0001446 miRBase:MI0022603 hsa-mir-6758 NCRO:0001447 miRBase:MI0022604 hsa-mir-6759 NCRO:0001448 miRBase:MI0022605 hsa-mir-6760 NCRO:0001449 miRBase:MI0022606 hsa-mir-6761 NCRO:0001450 miRBase:MI0022607 hsa-mir-6762 NCRO:0001451 miRBase:MI0022608 hsa-mir-6763 NCRO:0001452 miRBase:MI0022609 hsa-mir-6764 NCRO:0001453 miRBase:MI0022610 hsa-mir-6765 NCRO:0001454 miRBase:MI0022611 hsa-mir-6766 NCRO:0001455 miRBase:MI0022612 hsa-mir-6767 NCRO:0001456 miRBase:MI0022613 hsa-mir-6768 NCRO:0001457 miRBase:MI0022614 hsa-mir-6769a NCRO:0001458 miRBase:MI0022616 hsa-mir-6771 NCRO:0001459 miRBase:MI0022617 hsa-mir-6772 NCRO:0001460 miRBase:MI0022618 hsa-mir-6773 NCRO:0001461 miRBase:MI0022619 hsa-mir-6774 NCRO:0001462 miRBase:MI0022620 hsa-mir-6775 NCRO:0001463 miRBase:MI0022621 hsa-mir-6776 NCRO:0001464 miRBase:MI0022622 hsa-mir-6777 NCRO:0001465 miRBase:MI0022623 hsa-mir-6778 NCRO:0001466 miRBase:MI0022624 hsa-mir-6779 NCRO:0001467 miRBase:MI0022625 hsa-mir-6780a NCRO:0001468 miRBase:MI0022626 hsa-mir-6781 NCRO:0001469 miRBase:MI0022627 hsa-mir-6782 NCRO:0001470 miRBase:MI0022628 hsa-mir-6783 NCRO:0001471 miRBase:MI0022629 hsa-mir-6784 NCRO:0001472 miRBase:MI0022630 hsa-mir-6785 NCRO:0001473 miRBase:MI0022631 hsa-mir-6786 NCRO:0001474 miRBase:MI0022632 hsa-mir-6787 NCRO:0001475 miRBase:MI0022633 hsa-mir-6788 NCRO:0001476 miRBase:MI0022634 hsa-mir-6789 NCRO:0001477 miRBase:MI0022636 hsa-mir-6791 NCRO:0001478 miRBase:MI0022637 hsa-mir-6792 NCRO:0001479 miRBase:MI0022638 hsa-mir-6793 NCRO:0001480 miRBase:MI0022640 hsa-mir-6795 NCRO:0001481 miRBase:MI0022641 hsa-mir-6796 NCRO:0001482 miRBase:MI0022642 hsa-mir-6797 NCRO:0001483 miRBase:MI0022643 hsa-mir-6798 NCRO:0001484 miRBase:MI0022644 hsa-mir-6799 NCRO:0001485 miRBase:MI0022645 hsa-mir-6800 NCRO:0001486 miRBase:MI0022646 hsa-mir-6801 NCRO:0001487 miRBase:MI0022647 hsa-mir-6802 NCRO:0001488 miRBase:MI0022648 hsa-mir-6803 NCRO:0001489 miRBase:MI0022649 hsa-mir-6804 NCRO:0001490 miRBase:MI0022650 hsa-mir-6805 NCRO:0001491 miRBase:MI0022651 hsa-mir-6806 NCRO:0001492 miRBase:MI0022652 hsa-mir-6807 NCRO:0001493 miRBase:MI0022653 hsa-mir-6808 NCRO:0001494 miRBase:MI0022654 hsa-mir-6809 NCRO:0001495 miRBase:MI0022655 hsa-mir-6810 NCRO:0001496 miRBase:MI0022656 hsa-mir-6811 NCRO:0001497 miRBase:MI0022657 hsa-mir-6812 NCRO:0001498 miRBase:MI0022658 hsa-mir-6813 NCRO:0001499 miRBase:MI0022659 hsa-mir-6814 NCRO:0001500 miRBase:MI0022660 hsa-mir-6815 NCRO:0001501 miRBase:MI0022661 hsa-mir-6816 NCRO:0001502 miRBase:MI0022662 hsa-mir-6817 NCRO:0001503 miRBase:MI0022663 hsa-mir-6818 NCRO:0001504 miRBase:MI0022664 hsa-mir-6819 NCRO:0001505 miRBase:MI0022665 hsa-mir-6820 NCRO:0001506 miRBase:MI0022666 hsa-mir-6821 NCRO:0001507 miRBase:MI0022667 hsa-mir-6822 NCRO:0001508 miRBase:MI0022668 hsa-mir-6823 NCRO:0001509 miRBase:MI0022669 hsa-mir-6824 NCRO:0001510 miRBase:MI0022670 hsa-mir-6825 NCRO:0001511 miRBase:MI0022671 hsa-mir-6826 NCRO:0001512 miRBase:MI0022673 hsa-mir-6828 NCRO:0001513 miRBase:MI0022674 hsa-mir-6829 NCRO:0001514 miRBase:MI0022675 hsa-mir-6830 NCRO:0001515 miRBase:MI0022676 hsa-mir-6831 NCRO:0001516 miRBase:MI0022677 hsa-mir-6832 NCRO:0001517 miRBase:MI0022678 hsa-mir-6833 NCRO:0001518 miRBase:MI0022679 hsa-mir-6834 NCRO:0001519 miRBase:MI0022680 hsa-mir-6835 NCRO:0001520 miRBase:MI0022681 hsa-mir-6780b NCRO:0001521 miRBase:MI0022682 hsa-mir-6836 NCRO:0001522 miRBase:MI0022683 hsa-mir-6837 NCRO:0001523 miRBase:MI0022684 hsa-mir-6838 NCRO:0001524 miRBase:MI0022685 hsa-mir-6839 NCRO:0001525 miRBase:MI0022686 hsa-mir-6840 NCRO:0001526 miRBase:MI0022687 hsa-mir-6841 NCRO:0001527 miRBase:MI0022688 hsa-mir-6842 NCRO:0001528 miRBase:MI0022689 hsa-mir-6843 NCRO:0001529 miRBase:MI0022690 hsa-mir-6844 NCRO:0001530 miRBase:MI0022691 hsa-mir-6845 NCRO:0001531 miRBase:MI0022692 hsa-mir-6846 NCRO:0001532 miRBase:MI0022693 hsa-mir-6847 NCRO:0001533 miRBase:MI0022694 hsa-mir-6848 NCRO:0001534 miRBase:MI0022695 hsa-mir-6849 NCRO:0001535 miRBase:MI0022696 hsa-mir-6850 NCRO:0001536 miRBase:MI0022697 hsa-mir-6851 NCRO:0001537 miRBase:MI0022698 hsa-mir-6852 NCRO:0001538 miRBase:MI0022699 hsa-mir-6853 NCRO:0001539 miRBase:MI0022700 hsa-mir-6854 NCRO:0001540 miRBase:MI0022701 hsa-mir-6855 NCRO:0001541 miRBase:MI0022702 hsa-mir-6856 NCRO:0001542 miRBase:MI0022703 hsa-mir-6857 NCRO:0001543 miRBase:MI0022704 hsa-mir-6858 NCRO:0001544 miRBase:MI0022706 hsa-mir-6769b NCRO:0001545 miRBase:MI0022707 hsa-mir-6860 NCRO:0001546 miRBase:MI0022708 hsa-mir-6861 NCRO:0001547 miRBase:MI0022710 hsa-mir-6863 NCRO:0001548 miRBase:MI0022711 hsa-mir-6864 NCRO:0001549 miRBase:MI0022712 hsa-mir-6865 NCRO:0001550 miRBase:MI0022713 hsa-mir-6866 NCRO:0001551 miRBase:MI0022714 hsa-mir-6867 NCRO:0001552 miRBase:MI0022715 hsa-mir-6868 NCRO:0001553 miRBase:MI0022716 hsa-mir-6869 NCRO:0001554 miRBase:MI0022717 hsa-mir-6870 NCRO:0001555 miRBase:MI0022718 hsa-mir-6871 NCRO:0001556 miRBase:MI0022719 hsa-mir-6872 NCRO:0001557 miRBase:MI0022720 hsa-mir-6873 NCRO:0001558 miRBase:MI0022721 hsa-mir-6874 NCRO:0001559 miRBase:MI0022722 hsa-mir-6875 NCRO:0001560 miRBase:MI0022723 hsa-mir-6876 NCRO:0001561 miRBase:MI0022724 hsa-mir-6877 NCRO:0001562 miRBase:MI0022725 hsa-mir-6878 NCRO:0001563 miRBase:MI0022726 hsa-mir-6879 NCRO:0001564 miRBase:MI0022727 hsa-mir-6880 NCRO:0001565 miRBase:MI0022728 hsa-mir-6881 NCRO:0001566 miRBase:MI0022729 hsa-mir-6882 NCRO:0001567 miRBase:MI0022730 hsa-mir-6883 NCRO:0001568 miRBase:MI0022731 hsa-mir-6884 NCRO:0001569 miRBase:MI0022732 hsa-mir-6885 NCRO:0001570 miRBase:MI0022733 hsa-mir-6886 NCRO:0001571 miRBase:MI0022734 hsa-mir-6887 NCRO:0001572 miRBase:MI0022735 hsa-mir-6888 NCRO:0001573 miRBase:MI0022736 hsa-mir-6889 NCRO:0001574 miRBase:MI0022737 hsa-mir-6890 NCRO:0001575 miRBase:MI0022738 hsa-mir-6891 NCRO:0001576 miRBase:MI0022739 hsa-mir-6892 NCRO:0001577 miRBase:MI0022740 hsa-mir-6893 NCRO:0001578 miRBase:MI0022741 hsa-mir-6894 NCRO:0001579 miRBase:MI0022742 hsa-mir-6895 NCRO:0001580 miRBase:MI0022957 hsa-mir-7106 NCRO:0001581 miRBase:MI0022958 hsa-mir-7107 NCRO:0001582 miRBase:MI0022959 hsa-mir-7108 NCRO:0001583 miRBase:MI0022960 hsa-mir-7109 NCRO:0001584 miRBase:MI0022961 hsa-mir-7110 NCRO:0001585 miRBase:MI0022962 hsa-mir-7111 NCRO:0001586 miRBase:MI0022963 hsa-mir-7112 NCRO:0001587 miRBase:MI0022964 hsa-mir-7113 NCRO:0001588 miRBase:MI0022965 hsa-mir-7114 NCRO:0001589 miRBase:MI0023610 hsa-mir-7150 NCRO:0001590 miRBase:MI0023611 hsa-mir-7151 NCRO:0001591 miRBase:MI0023612 hsa-mir-7152 NCRO:0001592 miRBase:MI0023613 hsa-mir-7153 NCRO:0001593 miRBase:MI0023614 hsa-mir-7154 NCRO:0001594 miRBase:MI0023615 hsa-mir-7155 NCRO:0001595 miRBase:MI0023616 hsa-mir-7156 NCRO:0001596 miRBase:MI0023617 hsa-mir-7157 NCRO:0001597 miRBase:MI0023618 hsa-mir-7158 NCRO:0001598 miRBase:MI0023619 hsa-mir-7161 NCRO:0001599 miRBase:MI0023620 hsa-mir-7159 NCRO:0001600 miRBase:MI0023621 hsa-mir-7160 NCRO:0001601 miRBase:MI0023623 hsa-mir-7162 NCRO:0001602 miRBase:MI0024354 hsa-mir-7515 NCRO:0001603 miRBase:MI0025238 hsa-mir-7702 NCRO:0001604 miRBase:MI0025239 hsa-mir-7703 NCRO:0001605 miRBase:MI0025240 hsa-mir-7704 NCRO:0001606 miRBase:MI0025241 hsa-mir-7705 NCRO:0001607 miRBase:MI0025242 hsa-mir-7706 NCRO:0001608 miRBase:MI0025510 hsa-mir-7843 NCRO:0001609 miRBase:MI0025512 hsa-mir-1273h NCRO:0001610 miRBase:MI0025514 hsa-mir-7844 NCRO:0001611 miRBase:MI0025515 hsa-mir-7845 NCRO:0001612 miRBase:MI0025516 hsa-mir-7846 NCRO:0001613 miRBase:MI0025517 hsa-mir-7847 NCRO:0001614 miRBase:MI0025518 hsa-mir-7848 NCRO:0001615 miRBase:MI0025519 hsa-mir-7849 NCRO:0001616 miRBase:MI0025520 hsa-mir-7850 NCRO:0001617 miRBase:MI0025521 hsa-mir-7851 NCRO:0001618 miRBase:MI0025522 hsa-mir-7852 NCRO:0001619 miRBase:MI0025523 hsa-mir-7853 NCRO:0001620 miRBase:MI0025524 hsa-mir-7854 NCRO:0001621 miRBase:MI0025525 hsa-mir-7855 NCRO:0001622 miRBase:MI0025526 hsa-mir-7856 NCRO:0001623 miRBase:MI0025750 hsa-mir-7974 NCRO:0001624 miRBase:MI0025751 hsa-mir-7975 NCRO:0001625 miRBase:MI0025752 hsa-mir-7976 NCRO:0001626 miRBase:MI0025753 hsa-mir-7977 NCRO:0001627 miRBase:MI0025754 hsa-mir-7978 NCRO:0001628 miRBase:MI0025888 hsa-mir-8052 NCRO:0001629 miRBase:MI0025889 hsa-mir-8053 NCRO:0001630 miRBase:MI0025890 hsa-mir-8054 NCRO:0001631 miRBase:MI0025891 hsa-mir-8055 NCRO:0001632 miRBase:MI0025892 hsa-mir-8056 NCRO:0001633 miRBase:MI0025893 hsa-mir-8057 NCRO:0001634 miRBase:MI0025894 hsa-mir-8058 NCRO:0001635 miRBase:MI0025895 hsa-mir-8059 NCRO:0001636 miRBase:MI0025896 hsa-mir-8060 NCRO:0001637 miRBase:MI0025897 hsa-mir-8061 NCRO:0001638 miRBase:MI0025898 hsa-mir-8062 NCRO:0001639 miRBase:MI0025899 hsa-mir-8063 NCRO:0001640 miRBase:MI0025900 hsa-mir-8064 NCRO:0001641 miRBase:MI0025901 hsa-mir-8065 NCRO:0001642 miRBase:MI0025902 hsa-mir-8066 NCRO:0001643 miRBase:MI0025903 hsa-mir-8067 NCRO:0001644 miRBase:MI0025904 hsa-mir-8068 NCRO:0001645 miRBase:MI0025906 hsa-mir-8070 NCRO:0001646 miRBase:MI0025908 hsa-mir-8072 NCRO:0001647 miRBase:MI0025909 hsa-mir-8073 NCRO:0001648 miRBase:MI0025910 hsa-mir-8074 NCRO:0001649 miRBase:MI0025911 hsa-mir-8075 NCRO:0001650 miRBase:MI0025912 hsa-mir-8076 NCRO:0001651 miRBase:MI0025913 hsa-mir-8077 NCRO:0001652 miRBase:MI0025914 hsa-mir-8078 NCRO:0001653 miRBase:MI0025915 hsa-mir-8079 NCRO:0001654 miRBase:MI0025916 hsa-mir-8080 NCRO:0001655 miRBase:MI0025917 hsa-mir-8081 NCRO:0001656 miRBase:MI0025918 hsa-mir-8082 NCRO:0001657 miRBase:MI0025919 hsa-mir-8083 NCRO:0001658 miRBase:MI0025920 hsa-mir-8084 NCRO:0001659 miRBase:MI0025921 hsa-mir-8085 NCRO:0001660 miRBase:MI0025922 hsa-mir-8086 NCRO:0001661 miRBase:MI0025923 hsa-mir-8087 NCRO:0001662 miRBase:MI0025924 hsa-mir-8088 NCRO:0001663 miRBase:MI0025925 hsa-mir-8089 NCRO:0001664 miRBase:MI0027288 hsa-mir-8485 NCRO:0001665 miRBase:MI0029185 hsa-mir-9500 NCRO:0001666 miRBase:MI0031522 hsa-mir-5701-3 NCRO:0001667 2015-05-16T19:25:41Z miRNA_gene_family NCRO:0001668 miRBase:MI0000071 hsa-mir-17 NCRO:0001669 miRBase:MI0000072 hsa-mir-18a NCRO:0001670 miRBase:MI0000076 hsa-mir-20a NCRO:0001671 miRBase:MI0005761 hsa-mir-93 NCRO:0001672 miRBase:MI0000113 hsa-mir-106a NCRO:0001673 miRBase:MI0000734 hsa-mir-106b NCRO:0001674 miRBase:MI0001518 hsa-mir-18b NCRO:0001675 miRBase:MI0001519 hsa-mir-20b NCRO:0001676 miRBase:MI0000060 hsa-let-7a-1 NCRO:0001677 miRBase:MI0000061 hsa-let-7a-2 NCRO:0001678 miRBase:MI0000062 hsa-let-7a-3 NCRO:0001679 miRBase:MI0000063 hsa-let-7b NCRO:0001680 miRBase:MI0000064 hsa-let-7c NCRO:0001681 miRBase:MI0000065 hsa-let-7d NCRO:0001682 miRBase:MI0000066 hsa-let-7e NCRO:0001683 miRBase:MI0000067 hsa-let-7f-1 NCRO:0001684 miRBase:MI0000068 hsa-let-7f-2 NCRO:0001685 miRBase:MI0000100 hsa-mir-98 NCRO:0001686 miRBase:MI0000433 hsa-let-7g NCRO:0001687 miRBase:MI0000434 hsa-let-7i NCRO:0001688 miRBase:MI0000088 hsa-mir-30a NCRO:0001689 miRBase:MI0000254 hsa-mir-30c-2 NCRO:0001690 miRBase:MI0000255 hsa-mir-30d NCRO:0001691 miRBase:MI0000441 hsa-mir-30b NCRO:0001692 miRBase:MI0000736 hsa-mir-30c-1 NCRO:0001693 miRBase:MI0000749 hsa-mir-30e NCRO:0001694 miRBase:MI0000069 hsa-mir-15a NCRO:0001695 miRBase:MI0000070 hsa-mir-16-1 NCRO:0001696 miRBase:MI0000115 hsa-mir-16-2 NCRO:0001697 miRBase:MI0000438 hsa-mir-15b NCRO:0001698 miRBase:MI0000489 hsa-mir-195 NCRO:0001699 miRBase:MI0000269 hsa-mir-181a-2 NCRO:0001700 miRBase:MI0000270 hsa-mir-181b-1 NCRO:0001701 miRBase:MI0000271 hsa-mir-181c NCRO:0001702 miRBase:MI0000289 hsa-mir-181a-1 NCRO:0001703 miRBase:MI0000683 hsa-mir-181b-2 NCRO:0001704 miRBase:MI0003139 hsa-mir-181d NCRO:0001705 miRBase:MI0000087 hsa-mir-29a NCRO:0001706 miRBase:MI0000105 hsa-mir-29b-1 NCRO:0001707 miRBase:MI0000107 hsa-mir-29b-2 NCRO:0001708 miRBase:MI0000735 hsa-mir-29c NCRO:0001709 miRBase:MI0000073 hsa-mir-19a NCRO:0001710 miRBase:MI0000074 hsa-mir-19b-1 NCRO:0001711 miRBase:MI0000075 hsa-mir-19b-2 NCRO:0001712 miRBase:MI0000082 hsa-mir-25 NCRO:0001713 miRBase:MI0000093 hsa-mir-92a-1 NCRO:0001714 miRBase:MI0000094 hsa-mir-92a-2 NCRO:0001715 miRBase:MI0003560 hsa-mir-92b NCRO:0001716 miRBase:MI0000466 hsa-mir-9-1 NCRO:0001717 miRBase:MI0000467 hsa-mir-9-2 NCRO:0001718 miRBase:MI0000468 hsa-mir-9-3 NCRO:0001719 miRBase:MI0000480 hsa-mir-154 NCRO:0001720 miRBase:MI0023561 hsa-mir-369 NCRO:0001721 miRBase:MI0000785 hsa-mir-377 NCRO:0001722 miRBase:MI0000789 hsa-mir-381 NCRO:0001723 miRBase:MI0000790 hsa-mir-382 NCRO:0001724 miRBase:MI0000807 hsa-mir-323a NCRO:0001725 miRBase:MI0001735 hsa-mir-409 NCRO:0001726 miRBase:MI0002465 hsa-mir-410 NCRO:0001727 miRBase:MI0002471 hsa-mir-487a NCRO:0001728 miRBase:MI0003134 hsa-mir-494 NCRO:0001729 miRBase:MI0003136 hsa-mir-496 NCRO:0001730 miRBase:MI0003514 hsa-mir-539 NCRO:0001731 miRBase:MI0003530 hsa-mir-487b NCRO:0001732 miRBase:MI0003677 hsa-mir-655 NCRO:0001733 miRBase:MI0003678 hsa-mir-656 NCRO:0001734 miRBase:MI0003821 hsa-mir-1185-2 NCRO:0001735 miRBase:MI0003844 hsa-mir-1185-1 NCRO:0001736 miRBase:MI0005525 hsa-mir-300 NCRO:0001737 miRBase:MI0014206 hsa-mir-323b NCRO:0001738 miRBase:MI0000342 hsa-mir-200b NCRO:0001739 miRBase:MI0000457 hsa-mir-141 NCRO:0001740 miRBase:MI0000650 hsa-mir-200c NCRO:0001741 miRBase:MI0000737 hsa-mir-200a NCRO:0001742 miRBase:MI0001641 hsa-mir-429 NCRO:0001743 miRBase:MI0003143 hsa-mir-520e NCRO:0001744 miRBase:MI0003144 hsa-mir-515-1 NCRO:0001745 miRBase:MI0003145 hsa-mir-519e NCRO:0001746 miRBase:MI0003146 hsa-mir-520f NCRO:0001747 miRBase:MI0003147 hsa-mir-515-2 NCRO:0001748 miRBase:MI0003148 hsa-mir-519c NCRO:0001749 miRBase:MI0003149 hsa-mir-520a NCRO:0001750 miRBase:MI0003150 hsa-mir-526b NCRO:0001751 miRBase:MI0003151 hsa-mir-519b NCRO:0001752 miRBase:MI0003152 hsa-mir-525 NCRO:0001753 miRBase:MI0003153 hsa-mir-523 NCRO:0001754 miRBase:MI0003154 hsa-mir-518f NCRO:0001755 miRBase:MI0003155 hsa-mir-520b NCRO:0001756 miRBase:MI0003156 hsa-mir-518b NCRO:0001757 miRBase:MI0003157 hsa-mir-526a-1 NCRO:0001758 miRBase:MI0003158 hsa-mir-520c NCRO:0001759 miRBase:MI0003159 hsa-mir-518c NCRO:0001760 miRBase:MI0003160 hsa-mir-524 NCRO:0001761 miRBase:MI0003161 hsa-mir-517a NCRO:0001762 miRBase:MI0003162 hsa-mir-519d NCRO:0001763 miRBase:MI0003163 hsa-mir-521-2 NCRO:0001764 miRBase:MI0003164 hsa-mir-520d NCRO:0001765 miRBase:MI0003165 hsa-mir-517b NCRO:0001766 miRBase:MI0003166 hsa-mir-520g NCRO:0001767 miRBase:MI0003167 hsa-mir-516b-2 NCRO:0001768 miRBase:MI0003168 hsa-mir-526a-2 NCRO:0001769 miRBase:MI0003169 hsa-mir-518e NCRO:0001770 miRBase:MI0003170 hsa-mir-518a-1 NCRO:0001771 miRBase:MI0003171 hsa-mir-518d NCRO:0001772 miRBase:MI0003172 hsa-mir-516b-1 NCRO:0001773 miRBase:MI0003173 hsa-mir-518a-2 NCRO:0001774 miRBase:MI0003174 hsa-mir-517c NCRO:0001775 miRBase:MI0003175 hsa-mir-520h NCRO:0001776 miRBase:MI0003176 hsa-mir-521-1 NCRO:0001777 miRBase:MI0003177 hsa-mir-522 NCRO:0001778 miRBase:MI0003178 hsa-mir-519a-1 NCRO:0001779 miRBase:MI0003179 hsa-mir-527 NCRO:0001780 miRBase:MI0003180 hsa-mir-516a-1 NCRO:0001781 miRBase:MI0003181 hsa-mir-516a-2 NCRO:0001782 miRBase:MI0003182 hsa-mir-519a-2 NCRO:0001783 miRBase:MI0003832 hsa-mir-1283-1 NCRO:0001784 miRBase:MI0006430 hsa-mir-1283-2 NCRO:0001785 miRBase:MI0000443 hsa-mir-124-1 NCRO:0001786 miRBase:MI0000444 hsa-mir-124-2 NCRO:0001787 miRBase:MI0000445 hsa-mir-124-3 NCRO:0001788 miRBase:MI0000263 hsa-mir-7-1 NCRO:0001789 miRBase:MI0000264 hsa-mir-7-2 NCRO:0001790 miRBase:MI0000265 hsa-mir-7-3 NCRO:0001791 miRBase:MI0000108 hsa-mir-103a-2 NCRO:0001792 miRBase:MI0000109 hsa-mir-103a-1 NCRO:0001793 miRBase:MI0000114 hsa-mir-107 NCRO:0001794 miRBase:MI0007261 hsa-mir-103b-1 NCRO:0001795 miRBase:MI0007262 hsa-mir-103b-2 NCRO:0001796 miRBase:MI0000294 hsa-mir-218-1 NCRO:0001797 miRBase:MI0000295 hsa-mir-218-2 NCRO:0001798 miRBase:MI0000079 hsa-mir-23a NCRO:0001799 miRBase:MI0000439 hsa-mir-23b NCRO:0001800 miRBase:MI0000452 hsa-mir-135a-1 NCRO:0001801 miRBase:MI0000453 hsa-mir-135a-2 NCRO:0001802 miRBase:MI0000810 hsa-mir-135b NCRO:0001803 miRBase:MI0000450 hsa-mir-133a-1 NCRO:0001804 miRBase:MI0000451 hsa-mir-133a-2 NCRO:0001805 miRBase:MI0000822 hsa-mir-133b NCRO:0001806 miRBase:MI0000238 hsa-mir-196a-1 NCRO:0001807 miRBase:MI0000279 hsa-mir-196a-2 NCRO:0001808 miRBase:MI0001150 hsa-mir-196b NCRO:0001809 miRBase:MI0000101 hsa-mir-99a NCRO:0001810 miRBase:MI0000102 hsa-mir-100 NCRO:0001811 miRBase:MI0000266 hsa-mir-10a NCRO:0001812 miRBase:MI0000267 hsa-mir-10b NCRO:0001813 miRBase:MI0000446 hsa-mir-125b-1 NCRO:0001814 miRBase:MI0000469 hsa-mir-125a NCRO:0001815 miRBase:MI0000470 hsa-mir-125b-2 NCRO:0001816 miRBase:MI0000746 hsa-mir-99b NCRO:0001817 miRBase:MI0000448 hsa-mir-130a NCRO:0001818 miRBase:MI0000745 hsa-mir-301a NCRO:0001819 miRBase:MI0000748 hsa-mir-130b NCRO:0001820 miRBase:MI0005568 hsa-mir-301b NCRO:0001821 miRBase:MI0000085 hsa-mir-27a NCRO:0001822 miRBase:MI0000440 hsa-mir-27b NCRO:0001823 miRBase:MI0000437 hsa-mir-1-2 NCRO:0001824 miRBase:MI0000490 hsa-mir-206 NCRO:0001825 miRBase:MI0000651 hsa-mir-1-1 NCRO:0001826 miRBase:MI0000268 hsa-mir-34a NCRO:0001827 miRBase:MI0000742 hsa-mir-34b NCRO:0001828 miRBase:MI0000743 hsa-mir-34c NCRO:0001829 miRBase:MI0000242 hsa-mir-199a-1 NCRO:0001830 miRBase:MI0000281 hsa-mir-199a-2 NCRO:0001831 miRBase:MI0000282 hsa-mir-199b NCRO:0001832 miRBase:MI0000080 hsa-mir-24-1 NCRO:0001833 miRBase:MI0000081 hsa-mir-24-2 NCRO:0001834 miRBase:MI0000284 hsa-mir-204 NCRO:0001835 miRBase:MI0010633 hsa-mir-211 NCRO:0001836 miRBase:MI0000083 hsa-mir-26a-1 NCRO:0001837 miRBase:MI0000084 hsa-mir-26b NCRO:0001838 miRBase:MI0000750 hsa-mir-26a-2 NCRO:0001839 miRBase:MI0000296 hsa-mir-219a-1 NCRO:0001840 miRBase:MI0000740 hsa-mir-219a-2 NCRO:0001841 miRBase:MI0017299 hsa-mir-219b NCRO:0001842 miRBase:MI0000103 hsa-mir-101-1 NCRO:0001843 miRBase:MI0000739 hsa-mir-101-2 NCRO:0001844 miRBase:MI0000447 hsa-mir-128-1 NCRO:0001845 miRBase:MI0000727 hsa-mir-128-2 NCRO:0001846 miRBase:MI0000463 hsa-mir-153-1 NCRO:0001847 miRBase:MI0000464 hsa-mir-153-2 NCRO:0001848 miRBase:MI0000298 hsa-mir-221 NCRO:0001849 miRBase:MI0000299 hsa-mir-222 NCRO:0001850 miRBase:MI0011285 hsa-mir-22 NCRO:0001851 miRBase:MI0000292 hsa-mir-216a NCRO:0001852 miRBase:MI0005569 hsa-mir-216b NCRO:0001853 miRBase:MI0000488 hsa-mir-194-1 NCRO:0001854 miRBase:MI0000732 hsa-mir-194-2 NCRO:0001855 miRBase:MI0000253 hsa-mir-148a NCRO:0001856 miRBase:MI0000462 hsa-mir-152 NCRO:0001857 miRBase:MI0000811 hsa-mir-148b NCRO:0001858 miRBase:MI0013006 hsa-mir-28 NCRO:0001859 miRBase:MI0000809 hsa-mir-151a NCRO:0001860 miRBase:MI0003772 hsa-mir-151b NCRO:0001861 miRBase:MI0000285 hsa-mir-205 NCRO:0001862 miRBase:MI0000481 hsa-mir-184 NCRO:0001863 miRBase:MI0017299 hsa-mir-21 NCRO:0001864 miRBase:MI0000767 hsa-mir-365a NCRO:0001865 miRBase:MI0000769 hsa-mir-365b NCRO:0001866 miRBase:MI0000290 hsa-mir-214 NCRO:0001867 miRBase:MI0014136 hsa-mir-3120 NCRO:0001868 miRBase:MI0000234 hsa-mir-192 NCRO:0001869 miRBase:MI0000291 hsa-mir-215 NCRO:0001870 miRBase:MI0031510 hsa-mir-31 NCRO:0001871 miRBase:MI0000288 hsa-mir-212 NCRO:0001872 miRBase:MI0006657 hsa-mir-132 NCRO:0001873 miRBase:MI0000273 hsa-mir-183 NCRO:0001874 miRBase:MI0000300 hsa-mir-223 NCRO:0001875 miRBase:MI0000779 hsa-mir-371a NCRO:0001876 miRBase:MI0000780 hsa-mir-372 NCRO:0001877 miRBase:MI0017393 hsa-mir-371b NCRO:0001878 miRBase:MI0014253 hsa-mir-32 NCRO:0001879 miRBase:MI0000091 hsa-mir-33a NCRO:0001880 miRBase:MI0003646 hsa-mir-33b NCRO:0001881 miRBase:MI0000738 hsa-mir-302a NCRO:0001882 miRBase:MI0000772 hsa-mir-302b NCRO:0001883 miRBase:MI0000773 hsa-mir-302c NCRO:0001884 miRBase:MI0000774 hsa-mir-302d NCRO:0001885 miRBase:MI0006418 hsa-mir-302f NCRO:0001886 miRBase:MI0000098 hsa-mir-96 NCRO:0001887 miRBase:MI0000252 hsa-mir-129-1 NCRO:0001888 miRBase:MI0000473 hsa-mir-129-2 NCRO:0001889 miRBase:MI0000111 hsa-mir-105-1 NCRO:0001890 miRBase:MI0000112 hsa-mir-105-2 NCRO:0001891 miRBase:MI0000455 hsa-mir-138-2 NCRO:0001892 miRBase:MI0000476 hsa-mir-138-1 NCRO:0001893 miRBase:MI0000486 hsa-mir-190a NCRO:0001894 miRBase:MI0005545 hsa-mir-190b NCRO:0001895 miRBase:MI0000293 hsa-mir-217 NCRO:0001896 miRBase:MI0000274 hsa-mir-187 NCRO:0001897 miRBase:MI0000461 hsa-mir-145 NCRO:0001898 miRBase:MI0018003 hsa-mir-127 NCRO:0001899 miRBase:MI0000487 hsa-mir-193a NCRO:0001900 miRBase:MI0003137 hsa-mir-193b NCRO:0001901 miRBase:MI0000458 hsa-mir-142 NCRO:0001902 miRBase:MI0000456 hsa-mir-140 NCRO:0001903 miRBase:MI0000286 hsa-mir-210 NCRO:0001904 miRBase:MI0000301 hsa-mir-224 NCRO:0001905 miRBase:MI0000240 hsa-mir-198 NCRO:0001906 miRBase:MI0000776 hsa-mir-376c NCRO:0001907 miRBase:MI0000784 hsa-mir-376a-1 NCRO:0001908 miRBase:MI0002466 hsa-mir-376b NCRO:0001909 miRBase:MI0003529 hsa-mir-376a-2 NCRO:0001910 miRBase:MI0000460 hsa-mir-144 NCRO:0001911 miRBase:MI0000459 hsa-mir-143 NCRO:0001912 miRBase:MI0006318 hsa-mir-122 NCRO:0001913 miRBase:MI0017383 hsa-mir-3591 NCRO:0001914 miRBase:MI0000814 hsa-mir-338 NCRO:0001915 miRBase:MI0000097 hsa-mir-95 NCRO:0001916 miRBase:MI0003516 hsa-mir-545 NCRO:0001917 miRBase:MI0003685 hsa-mir-421 NCRO:0001918 miRBase:MI0003758 hsa-mir-1264 NCRO:0001919 miRBase:MI0000475 hsa-mir-136 NCRO:0001920 miRBase:MI0000477 hsa-mir-146a NCRO:0001921 miRBase:MI0003129 hsa-mir-146b NCRO:0001922 miRBase:MI0000262 hsa-mir-147a NCRO:0001923 miRBase:MI0005544 hsa-mir-147b NCRO:0001924 miRBase:MI0000454 hsa-mir-137 NCRO:0001925 miRBase:MI0000283 hsa-mir-203a NCRO:0001926 miRBase:MI0017343 hsa-mir-203b NCRO:0001927 miRBase:MI0000483 hsa-mir-186 NCRO:0001928 miRBase:MI0001725 hsa-mir-329-1 NCRO:0001929 miRBase:MI0001726 hsa-mir-329-2 NCRO:0001930 miRBase:MI0003135 hsa-mir-495 NCRO:0001931 miRBase:MI0005565 hsa-mir-543 NCRO:0001932 miRBase:MI0003124 hsa-mir-489 NCRO:0001933 miRBase:MI0017320 hsa-mir-134 NCRO:0001934 miRBase:MI0000484 hsa-mir-188 NCRO:0001935 miRBase:MI0003205 hsa-mir-532 NCRO:0001936 miRBase:MI0003684 hsa-mir-660 NCRO:0001937 miRBase:MI0000783 hsa-mir-375 NCRO:0001938 miRBase:MI0014197 hsa-mir-126 NCRO:0001939 miRBase:MI0008195 hsa-mir-182 NCRO:0001940 miRBase:MI0000261 hsa-mir-139 NCRO:0001941 miRBase:MI0003130 hsa-mir-202 NCRO:0001942 miRBase:MI0015977 hsa-mir-197 NCRO:0001943 miRBase:MI0000787 hsa-mir-379 NCRO:0001944 miRBase:MI0000788 hsa-mir-380 NCRO:0001945 miRBase:MI0003675 hsa-mir-411 NCRO:0001946 miRBase:MI0003757 hsa-mir-758 NCRO:0001947 miRBase:MI0006656 hsa-mir-1197 NCRO:0001948 miRBase:MI0001652 hsa-mir-450a-1 NCRO:0001949 miRBase:MI0003187 hsa-mir-450a-2 NCRO:0001950 miRBase:MI0005531 hsa-mir-450b NCRO:0001951 miRBase:MI0003513 hsa-mir-455 NCRO:0001952 miRBase:MI0003127 hsa-mir-511 NCRO:0001953 miRBase:MI0003140 hsa-mir-512-1 NCRO:0001954 miRBase:MI0003141 hsa-mir-512-2 NCRO:0001955 miRBase:MI0003191 hsa-mir-513a-1 NCRO:0001956 miRBase:MI0003192 hsa-mir-513a-2 NCRO:0001957 miRBase:MI0003193 hsa-mir-506 NCRO:0001958 miRBase:MI0003194 hsa-mir-507 NCRO:0001959 miRBase:MI0003195 hsa-mir-508 NCRO:0001960 miRBase:MI0003196 hsa-mir-509-1 NCRO:0001961 miRBase:MI0003197 hsa-mir-510 NCRO:0001962 miRBase:MI0003198 hsa-mir-514a-1 NCRO:0001963 miRBase:MI0003199 hsa-mir-514a-2 NCRO:0001964 miRBase:MI0003200 hsa-mir-514a-3 NCRO:0001965 miRBase:MI0005530 hsa-mir-509-2 NCRO:0001966 miRBase:MI0005717 hsa-mir-509-3 NCRO:0001967 miRBase:MI0006648 hsa-mir-513b NCRO:0001968 miRBase:MI0006649 hsa-mir-513c NCRO:0001969 miRBase:MI0014251 hsa-mir-514b NCRO:0001970 miRBase:MI0001648 hsa-mir-449a NCRO:0001971 miRBase:MI0003673 hsa-mir-449b NCRO:0001972 miRBase:MI0003823 hsa-mir-449c NCRO:0001973 miRBase:MI0000791 hsa-mir-383 NCRO:0001974 miRBase:MI0000764 hsa-mir-363 NCRO:0001975 miRBase:MI0003184 hsa-mir-500a NCRO:0001976 miRBase:MI0003185 hsa-mir-501 NCRO:0001977 miRBase:MI0003186 hsa-mir-502 NCRO:0001978 miRBase:MI0015903 hsa-mir-500b NCRO:0001979 miRBase:MI0015983 hsa-mir-431 NCRO:0001980 miRBase:MI0000808 hsa-mir-326 NCRO:0001981 miRBase:MI0000824 hsa-mir-325 NCRO:0001982 miRBase:MI0001729 hsa-mir-451a NCRO:0001983 miRBase:MI0017360 hsa-mir-451b NCRO:0001984 miRBase:MI0016849 hsa-mir-448 NCRO:0001985 miRBase:MI0000681 hsa-mir-155 NCRO:0001986 miRBase:MI0000747 hsa-mir-296 NCRO:0001987 miRBase:MI0031514 hsa-mir-367 NCRO:0001988 miRBase:MI0000542 hsa-mir-320a NCRO:0001989 miRBase:MI0003776 hsa-mir-320b-1 NCRO:0001990 miRBase:MI0003778 hsa-mir-320c-1 NCRO:0001991 miRBase:MI0003839 hsa-mir-320b-2 NCRO:0001992 miRBase:MI0008190 hsa-mir-320d-1 NCRO:0001993 miRBase:MI0008191 hsa-mir-320c-2 NCRO:0001994 miRBase:MI0008192 hsa-mir-320d-2 NCRO:0001995 miRBase:MI0014234 hsa-mir-320e NCRO:0001996 miRBase:MI0001446 hsa-mir-424 NCRO:0001997 miRBase:MI0000813 hsa-mir-324 NCRO:0001998 miRBase:MI0000778 hsa-mir-370 NCRO:0001999 miRBase:MI0000786 hsa-mir-378a NCRO:0002000 miRBase:MI0003840 hsa-mir-378d-2 NCRO:0002001 miRBase:MI0014154 hsa-mir-378b NCRO:0002002 miRBase:MI0016749 hsa-mir-378d-1 NCRO:0002003 miRBase:MI0016750 hsa-mir-378e NCRO:0002004 miRBase:MI0016008 hsa-mir-361 NCRO:0002005 miRBase:MI0003183 hsa-mir-499a NCRO:0002006 miRBase:MI0003820 hsa-mir-454 NCRO:0002007 miRBase:MI0001723 hsa-mir-433 NCRO:0002008 miRBase:MI0000251 hsa-mir-208a NCRO:0002009 miRBase:MI0005570 hsa-mir-208b NCRO:0002010 miRBase:MI0002467 hsa-mir-483 NCRO:0002011 miRBase:MI0003188 hsa-mir-503 NCRO:0002012 miRBase:MI0003686 hsa-mir-542 NCRO:0002013 miRBase:MI0000744 hsa-mir-299 NCRO:0002014 miRBase:MI0000826 hsa-mir-346 NCRO:0002015 miRBase:MI0000825 hsa-mir-345 NCRO:0002016 miRBase:MI0000805 hsa-mir-342 NCRO:0002017 miRBase:MI0000802 hsa-mir-340 NCRO:0002018 miRBase:MI0002464 hsa-mir-412 NCRO:0002019 miRBase:MI0000815 hsa-mir-339 NCRO:0002020 miRBase:MI0008336 hsa-mir-191 NCRO:0002021 miRBase:MI0000806 hsa-mir-337 NCRO:0002022 miRBase:MI0000816 hsa-mir-335 NCRO:0002023 miRBase:MI0000479 hsa-mir-150 NCRO:0002024 miRBase:MI0000812 hsa-mir-331 NCRO:0002025 miRBase:MI0000803 hsa-mir-330 NCRO:0002026 miRBase:MI0002469 hsa-mir-485 NCRO:0002027 miRBase:MI0000482 hsa-mir-185 NCRO:0002028 miRBase:MI0000804 hsa-mir-328 NCRO:0002029 miRBase:MI0005775 hsa-mir-297 NCRO:0002030 miRBase:MI0005523 hsa-mir-298 NCRO:0002031 miRBase:MI0016014 hsa-mir-362 NCRO:0002032 miRBase:MI0003133 hsa-mir-432 NCRO:0002033 miRBase:MI0005539 hsa-mir-541 NCRO:0002034 miRBase:MI0003190 hsa-mir-505 NCRO:0002035 miRBase:MI0002468 hsa-mir-484 NCRO:0002036 miRBase:MI0002470 hsa-mir-486-1 NCRO:0002037 miRBase:MI0023622 hsa-mir-486-2 NCRO:0002038 miRBase:MI0003125 hsa-mir-490 NCRO:0002039 miRBase:MI0003132 hsa-mir-493 NCRO:0002040 miRBase:MI0003138 hsa-mir-497 NCRO:0002041 miRBase:MI0001448 hsa-mir-425 NCRO:0002042 miRBase:MI0000478 hsa-mir-149 NCRO:0002043 miRBase:MI0019114 hsa-mir-452 NCRO:0002044 miRBase:MI0000782 hsa-mir-374a NCRO:0002045 miRBase:MI0005566 hsa-mir-374b NCRO:0002046 miRBase:MI0016684 hsa-mir-374c NCRO:0002047 miRBase:MI0001145 hsa-mir-384 NCRO:0002048 miRBase:MI0006442 hsa-mir-664a NCRO:0002049 miRBase:MI0019134 hsa-mir-664b NCRO:0002050 miRBase:MI0017297 hsa-mir-466 NCRO:0002051 miRBase:MI0019593 hsa-mir-570 NCRO:0002052 miRBase:MI0003586 hsa-mir-579 NCRO:0002053 miRBase:MI0003593 hsa-mir-548a-1 NCRO:0002054 miRBase:MI0029321 hsa-mir-548b NCRO:0002055 miRBase:MI0003598 hsa-mir-548a-2 NCRO:0002056 miRBase:MI0003612 hsa-mir-548a-3 NCRO:0002057 miRBase:MI0003616 hsa-mir-603 NCRO:0002058 miRBase:MI0003630 hsa-mir-548c NCRO:0002059 miRBase:MI0003668 hsa-mir-548d-1 NCRO:0002060 miRBase:MI0003671 hsa-mir-548d-2 NCRO:0002061 miRBase:MI0006344 hsa-mir-548e NCRO:0002062 miRBase:MI0006345 hsa-mir-548j NCRO:0002063 miRBase:MI0006354 hsa-mir-548k NCRO:0002064 miRBase:MI0006361 hsa-mir-548l NCRO:0002065 miRBase:MI0006374 hsa-mir-548f-1 NCRO:0002066 miRBase:MI0006375 hsa-mir-548f-2 NCRO:0002067 miRBase:MI0006376 hsa-mir-548f-3 NCRO:0002068 miRBase:MI0006377 hsa-mir-548f-4 NCRO:0002069 miRBase:MI0006378 hsa-mir-548f-5 NCRO:0002070 miRBase:MI0006395 hsa-mir-548g NCRO:0002071 miRBase:MI0006399 hsa-mir-548n NCRO:0002072 miRBase:MI0006400 hsa-mir-548m NCRO:0002073 miRBase:MI0006411 hsa-mir-548h-1 NCRO:0002074 miRBase:MI0006412 hsa-mir-548h-2 NCRO:0002075 miRBase:MI0006413 hsa-mir-548h-3 NCRO:0002076 miRBase:MI0006414 hsa-mir-548h-4 NCRO:0002077 miRBase:MI0006420 hsa-mir-548p NCRO:0002078 miRBase:MI0006421 hsa-mir-548i-1 NCRO:0002079 miRBase:MI0006422 hsa-mir-548i-2 NCRO:0002080 miRBase:MI0006423 hsa-mir-548i-3 NCRO:0002081 miRBase:MI0006424 hsa-mir-548i-4 NCRO:0002082 miRBase:MI0010637 hsa-mir-548q NCRO:0002083 miRBase:MI0014141 hsa-mir-548s NCRO:0002084 miRBase:MI0014164 hsa-mir-548t NCRO:0002085 miRBase:MI0014168 hsa-mir-548u NCRO:0002086 miRBase:MI0014174 hsa-mir-548v NCRO:0002087 miRBase:MI0014222 hsa-mir-548w NCRO:0002088 miRBase:MI0016833 hsa-mir-548x NCRO:0002089 miRBase:MI0016595 hsa-mir-548y NCRO:0002090 miRBase:MI0016688 hsa-mir-548z NCRO:0002091 miRBase:MI0016689 hsa-mir-548aa-1 NCRO:0002092 miRBase:MI0016690 hsa-mir-548aa-2 NCRO:0002093 miRBase:MI0016746 hsa-mir-548o-2 NCRO:0002094 miRBase:MI0016751 hsa-mir-548h-5 NCRO:0002095 miRBase:MI0016752 hsa-mir-548ab NCRO:0002096 miRBase:MI0016762 hsa-mir-548ac NCRO:0002097 miRBase:MI0016770 hsa-mir-548ad NCRO:0002098 miRBase:MI0016779 hsa-mir-548ae-1 NCRO:0002099 miRBase:MI0016780 hsa-mir-548ae-2 NCRO:0002100 miRBase:MI0016793 hsa-mir-548ag-1 NCRO:0002101 miRBase:MI0016794 hsa-mir-548ag-2 NCRO:0002102 miRBase:MI0016796 hsa-mir-548ah NCRO:0002103 miRBase:MI0016813 hsa-mir-548ai NCRO:0002104 miRBase:MI0016814 hsa-mir-548aj-1 NCRO:0002105 miRBase:MI0016815 hsa-mir-548aj-2 NCRO:0002106 miRBase:MI0016833 hsa-mir-548x-2 NCRO:0002107 miRBase:MI0016840 hsa-mir-548ak NCRO:0002108 miRBase:MI0016851 hsa-mir-548al NCRO:0002109 miRBase:MI0016904 hsa-mir-548am NCRO:0002110 miRBase:MI0016907 hsa-mir-548an NCRO:0002111 miRBase:MI0017871 hsa-mir-548ao NCRO:0002112 miRBase:MI0017875 hsa-mir-548ap NCRO:0002113 miRBase:MI0019130 hsa-mir-548aq NCRO:0002114 miRBase:MI0019131 hsa-mir-548ar NCRO:0002115 miRBase:MI0019132 hsa-mir-548as NCRO:0002116 miRBase:MI0019137 hsa-mir-548at NCRO:0002117 miRBase:MI0019145 hsa-mir-548au NCRO:0002118 miRBase:MI0019152 hsa-mir-548av NCRO:0002119 miRBase:MI0019283 hsa-mir-548aw NCRO:0002120 miRBase:MI0019286 hsa-mir-548ax NCRO:0002121 miRBase:MI0022210 hsa-mir-548ay NCRO:0002122 miRBase:MI0022212 hsa-mir-548az NCRO:0002123 miRBase:MI0025747 hsa-mir-548ba NCRO:0002124 miRBase:MI0029321 hsa-mir-548bb NCRO:0002125 miRBase:MI0003123 hsa-mir-488 NCRO:0002126 miRBase:MI0003126 hsa-mir-491 NCRO:0002127 miRBase:MI0001445 hsa-mir-423 NCRO:0002128 miRBase:MI0003667 hsa-mir-652 NCRO:0002129 miRBase:MI0003600 hsa-mir-550a-1 NCRO:0002130 miRBase:MI0003601 hsa-mir-550a-2 NCRO:0002131 miRBase:MI0003762 hsa-mir-550a-3 NCRO:0002132 miRBase:MI0016686 hsa-mir-550b-1 NCRO:0002133 miRBase:MI0016687 hsa-mir-550b-2 NCRO:0002134 miRBase:MI0003604 hsa-mir-592 NCRO:0002135 miRBase:MI0003628 hsa-mir-615 NCRO:0002136 miRBase:MI0003906 hsa-mir-802 NCRO:0002137 miRBase:MI0005118 hsa-mir-770 NCRO:0002138 miRBase:MI0003761 hsa-mir-668 NCRO:0002139 miRBase:MI0022548 hsa-mir-671 NCRO:0002140 miRBase:MI0003556 hsa-mir-551a NCRO:0002141 miRBase:MI0003575 hsa-mir-551b NCRO:0002142 miRBase:MI0005416 hsa-mir-675 NCRO:0002143 miRBase:MI0005528 hsa-mir-892a NCRO:0002144 miRBase:MI0005533 hsa-mir-890 NCRO:0002145 miRBase:MI0005537 hsa-mir-888 NCRO:0002146 miRBase:MI0005538 hsa-mir-892b NCRO:0002147 miRBase:MI0022560 hsa-mir-892c NCRO:0002148 miRBase:MI0005763 hsa-mir-941-1 NCRO:0002149 miRBase:MI0005764 hsa-mir-941-2 NCRO:0002150 miRBase:MI0005765 hsa-mir-941-3 NCRO:0002151 miRBase:MI0005766 hsa-mir-941-4 NCRO:0002152 miRBase:MI0031520 hsa-mir-941-5 NCRO:0002153 miRBase:MI0005564 hsa-mir-873 NCRO:0002154 miRBase:MI0005561 hsa-mir-877 NCRO:0002155 miRBase:MI0003610 hsa-mir-598 NCRO:0002156 miRBase:MI0005567 hsa-mir-760 NCRO:0002157 miRBase:MI0005543 hsa-mir-708 NCRO:0002158 miRBase:MI0005532 hsa-mir-874 NCRO:0002159 miRBase:MI0005563 hsa-mir-665 NCRO:0002160 miRBase:MI0019293 hsa-mir-568 NCRO:0002161 miRBase:MI0003676 hsa-mir-654 NCRO:0002162 miRBase:MI0003589 hsa-mir-582 NCRO:0002163 miRBase:MI0003602 hsa-mir-590 NCRO:0002164 miRBase:MI0003581 hsa-mir-574 NCRO:0002165 miRBase:MI0005524 hsa-mir-891a NCRO:0002166 miRBase:MI0005534 hsa-mir-891b NCRO:0002167 miRBase:MI0005541 hsa-mir-875 NCRO:0002168 miRBase:MI0005542 hsa-mir-876 NCRO:0002169 miRBase:MI0005559 hsa-mir-744 NCRO:0002170 miRBase:MI0003674 hsa-mir-653 NCRO:0002171 miRBase:MI0003515 hsa-mir-544a NCRO:0002172 miRBase:MI0014159 hsa-mir-544b NCRO:0002173 miRBase:MI0003189 hsa-mir-504 NCRO:0002174 miRBase:MI0003764 hsa-mir-1224 NCRO:0002175 miRBase:MI0006313 hsa-mir-1226 NCRO:0002176 miRBase:MI0006311 hsa-mir-1225 NCRO:0002177 miRBase:MI0006316 hsa-mir-1227 NCRO:0002178 miRBase:MI0015980 hsa-mir-1302-1 NCRO:0002179 miRBase:MI0006363 hsa-mir-1302-2 NCRO:0002180 miRBase:MI0006364 hsa-mir-1302-3 NCRO:0002181 miRBase:MI0006365 hsa-mir-1302-4 NCRO:0002182 miRBase:MI0006366 hsa-mir-1302-5 NCRO:0002183 miRBase:MI0006367 hsa-mir-1302-6 NCRO:0002184 miRBase:MI0006368 hsa-mir-1302-7 NCRO:0002185 miRBase:MI0006369 hsa-mir-1302-8 NCRO:0002186 miRBase:MI0015978 hsa-mir-1302-9 NCRO:0002187 miRBase:MI0015979 hsa-mir-1302-10 NCRO:0002188 miRBase:MI0015980 hsa-mir-1302-11 NCRO:0002189 miRBase:MI0022217 hsa-mir-650 NCRO:0002190 miRBase:MI0003672 hsa-mir-663a NCRO:0002191 miRBase:MI0006336 hsa-mir-663b NCRO:0002192 miRBase:MI0003142 hsa-mir-498 NCRO:0002193 miRBase:MI0021274 hsa-mir-612 NCRO:0002194 miRBase:MI0003669 hsa-mir-661 NCRO:0002195 miRBase:MI0003588 hsa-mir-581 NCRO:0002196 miRBase:MI0003594 hsa-mir-586 NCRO:0002197 miRBase:MI0003657 hsa-mir-642a NCRO:0002198 miRBase:MI0016685 hsa-mir-642b NCRO:0002199 miRBase:MI0005760 hsa-mir-938 NCRO:0002200 miRBase:MI0003679 hsa-mir-549a NCRO:0002201 miRBase:MI0016436 hsa-mir-676 NCRO:0002202 miRBase:MI0003640 hsa-mir-626 NCRO:0002203 miRBase:MI0003562 hsa-mir-556 NCRO:0002204 miRBase:MI0003663 hsa-mir-648 NCRO:0002205 miRBase:MI0003585 hsa-mir-578 NCRO:0002206 miRBase:MI0025513 hsa-mir-651 NCRO:0002207 miRBase:MI0003609 hsa-mir-597 NCRO:0002208 miRBase:MI0003620 hsa-mir-607 NCRO:0002209 miRBase:MI0003590 hsa-mir-583 NCRO:0002210 miRBase:MI0003814 hsa-mir-1271 NCRO:0002211 miRBase:MI0003613 hsa-mir-600 NCRO:0002212 miRBase:MI0003653 hsa-mir-638 NCRO:0002213 miRBase:MI0003558 hsa-mir-553 NCRO:0002214 miRBase:MI0003658 hsa-mir-643 NCRO:0002215 miRBase:MI0005761 hsa-mir-939 NCRO:0002216 miRBase:MI0003670 hsa-mir-662 NCRO:0002217 miRBase:MI0003583 hsa-mir-576 NCRO:0002218 miRBase:MI0003655 hsa-mir-640 NCRO:0002219 miRBase:MI0005712 hsa-mir-920 NCRO:0002220 miRBase:MI0003599 hsa-mir-589 NCRO:0002221 miRBase:MI0003681 hsa-mir-657 NCRO:0002222 miRBase:MI0003131 hsa-mir-492 NCRO:0002223 miRBase:MI0000781 hsa-mir-373 NCRO:0002224 miRBase:MI0003557 hsa-mir-552 NCRO:0002225 miRBase:MI0003611 hsa-mir-599 NCRO:0002226 miRBase:MI0003605 hsa-mir-593 NCRO:0002227 miRBase:MI0005755 hsa-mir-933 NCRO:0002228 miRBase:MI0006389 hsa-mir-1255a NCRO:0002229 miRBase:MI0006435 hsa-mir-1255b-1 NCRO:0002230 miRBase:MI0006436 hsa-mir-1255b-2 NCRO:0002231 miRBase:MI0003629 hsa-mir-616 NCRO:0002232 miRBase:MI0003645 hsa-mir-631 NCRO:0002233 miRBase:MI0005767 hsa-mir-942 NCRO:0002234 miRBase:MI0003568 hsa-mir-562 NCRO:0002235 miRBase:MI0005716 hsa-mir-924 NCRO:0002236 miRBase:MI0005540 hsa-mir-889 NCRO:0002237 miRBase:MI0003587 hsa-mir-580 NCRO:0002238 miRBase:MI0003622 hsa-mir-609 NCRO:0002239 miRBase:MI0005758 hsa-mir-936 NCRO:0002240 miRBase:MI0003569 hsa-mir-563 NCRO:0002241 miRBase:MI0003563 hsa-mir-557 NCRO:0002242 miRBase:MI0003614 hsa-mir-601 NCRO:0002243 miRBase:MI0003638 hsa-mir-624 NCRO:0002244 miRBase:MI0003651 hsa-mir-636 NCRO:0002245 miRBase:MI0003647 hsa-mir-632 NCRO:0002246 miRBase:MI0003618 hsa-mir-605 NCRO:0002247 miRBase:MI0003642 hsa-mir-628 NCRO:0002248 miRBase:MI0003584 hsa-mir-577 NCRO:0002249 miRBase:MI0006443 hsa-mir-1306 NCRO:0002250 miRBase:MI0005560 hsa-mir-885 NCRO:0002251 miRBase:MI0003591 hsa-mir-584 NCRO:0002252 miRBase:MI0003639 hsa-mir-625 NCRO:0002253 miRBase:MI0019304 hsa-mir-569 NCRO:0002254 miRBase:MI0005714 hsa-mir-922 NCRO:0002255 miRBase:MI0003579 hsa-mir-572 NCRO:0002256 miRBase:MI0019140 hsa-mir-558 NCRO:0002257 miRBase:MI0003624 hsa-mir-611 NCRO:0002258 miRBase:MI0005762 hsa-mir-940 NCRO:0002259 miRBase:MI0005769 hsa-mir-944 NCRO:0002260 miRBase:MI0005756 hsa-mir-934 NCRO:0002261 miRBase:MI0005116 hsa-mir-765 NCRO:0002262 miRBase:MI0003648 hsa-mir-633 NCRO:0002263 miRBase:MI0003664 hsa-mir-649 NCRO:0002264 miRBase:MI0001444 hsa-mir-422a NCRO:0002265 miRBase:MI0003654 hsa-mir-639 NCRO:0002266 miRBase:MI0003641 hsa-mir-627 NCRO:0002267 miRBase:MI0003559 hsa-mir-554 NCRO:0002268 miRBase:MI0003763 hsa-mir-767 NCRO:0002269 miRBase:MI0003632 hsa-mir-618 NCRO:0002270 miRBase:MI0005562 hsa-mir-887 NCRO:0002271 miRBase:MI0003573 hsa-mir-567 NCRO:0002272 miRBase:MI0003659 hsa-mir-644a NCRO:0002273 miRBase:MI0003633 hsa-mir-619 NCRO:0002274 miRBase:MI0006444 hsa-mir-1307 NCRO:0002275 miRBase:MI0006346 hsa-mir-1285-1 NCRO:0002276 miRBase:MI0006347 hsa-mir-1285-2 NCRO:0002277 miRBase:MI0005759 hsa-mir-937 NCRO:0002278 miRBase:MI0003580 hsa-mir-573 NCRO:0002279 miRBase:MI0003617 hsa-mir-604 NCRO:0002280 miRBase:MI0003595 hsa-mir-587 NCRO:0002281 miRBase:MI0006379 hsa-mir-1244-1 NCRO:0002282 miRBase:MI0015974 hsa-mir-1244-2 NCRO:0002283 miRBase:MI0015975 hsa-mir-1244-3 NCRO:0002284 miRBase:MI0031511 hsa-mir-1244-4 NCRO:0002285 miRBase:MI0003572 hsa-mir-566 NCRO:0002286 miRBase:MI0006323 hsa-mir-1233-1 NCRO:0002287 miRBase:MI0015973 hsa-mir-1233-2 NCRO:0002288 miRBase:MI0006409 hsa-mir-1273a NCRO:0002289 miRBase:MI0014254 hsa-mir-1273d NCRO:0002290 miRBase:MI0016059 hsa-mir-1273e NCRO:0002291 miRBase:MI0018002 hsa-mir-1273f NCRO:0002292 miRBase:MI0018003 hsa-mir-1273g NCRO:0002293 miRBase:MI0003561 hsa-mir-555 NCRO:0002294 miRBase:MI0006358 hsa-mir-1297 NCRO:0002295 miRBase:MI0006327 hsa-mir-1237 NCRO:0002296 miRBase:MI0003582 hsa-mir-575 NCRO:0002297 miRBase:MI0006429 hsa-mir-1282 NCRO:0002298 miRBase:MI0006657 hsa-mir-1324 NCRO:0002299 miRBase:MI0021279 hsa-mir-613 NCRO:0002300 miRBase:MI0006425 hsa-mir-1278 NCRO:0002301 miRBase:MI0006277 hsa-mir-1184-1 NCRO:0002302 miRBase:MI0015971 hsa-mir-1184-2 NCRO:0002303 miRBase:MI0015972 hsa-mir-1184-3 NCRO:0002304 miRBase:MI0006390 hsa-mir-1256 NCRO:0002305 miRBase:MI0006397 hsa-mir-1262 NCRO:0002306 miRBase:MI0006340 hsa-mir-1207 NCRO:0002307 miRBase:MI0003652 hsa-mir-637 NCRO:0002308 miRBase:MI0003938 hsa-mir-1298 NCRO:0002309 miRBase:MI0006353 hsa-mir-1291 NCRO:0002310 miRBase:MI0003649 hsa-mir-634 NCRO:0002311 miRBase:MI0006271 hsa-mir-1178 NCRO:0002312 miRBase:MI0006356 hsa-mir-1294 NCRO:0002313 miRBase:MI0006431 hsa-mir-1284 NCRO:0002314 miRBase:MI0003661 hsa-mir-646 NCRO:0002315 miRBase:MI0005757 hsa-mir-935 NCRO:0002316 miRBase:MI0006370 hsa-mir-1303 NCRO:0002317 miRBase:MI0006338 hsa-mir-1205 NCRO:0002318 miRBase:MI0006352 hsa-mir-1290 NCRO:0002319 miRBase:MI0006387 hsa-mir-1253 NCRO:0002320 miRBase:MI0003570 hsa-mir-564 NCRO:0002321 miRBase:MI0006334 hsa-mir-1202 NCRO:0002322 miRBase:MI0006388 hsa-mir-1254-1 NCRO:0002323 miRBase:MI0016747 hsa-mir-1254-2 NCRO:0002324 miRBase:MI0006403 hsa-mir-1266 NCRO:0002325 miRBase:MI0003786 hsa-mir-1323 NCRO:0002326 miRBase:MI0003636 hsa-mir-622 NCRO:0002327 miRBase:MI0006380 hsa-mir-1245a NCRO:0002328 miRBase:MI0017431 hsa-mir-1245b NCRO:0002329 miRBase:MI0006386 hsa-mir-1251 NCRO:0002330 miRBase:MI0006383 hsa-mir-1248 NCRO:0002331 miRBase:MI0003567 hsa-mir-561 NCRO:0002332 miRBase:MI0003892 hsa-mir-762 NCRO:0002333 miRBase:MI0006359 hsa-mir-1299 NCRO:0002334 miRBase:MI0006350 hsa-mir-1289-1 NCRO:0002335 miRBase:MI0006351 hsa-mir-1289-2 NCRO:0002336 miRBase:MI0006381 hsa-mir-1246 NCRO:0002337 miRBase:MI0006341 hsa-mir-1208 NCRO:0002338 miRBase:MI0003635 hsa-mir-621 NCRO:0002339 miRBase:MI0006272 hsa-mir-1179 NCRO:0002340 miRBase:MI0006335 hsa-mir-1203 NCRO:0002341 miRBase:MI0006339 hsa-mir-1206 NCRO:0002342 miRBase:MI0006404 hsa-mir-1267 NCRO:0002343 miRBase:MI0003603 hsa-mir-591 NCRO:0002344 miRBase:MI0003682 hsa-mir-658 NCRO:0002345 miRBase:MI0006408 hsa-mir-1272 NCRO:0002346 miRBase:MI0008195 hsa-mir-1827 NCRO:0002347 miRBase:MI0003627 hsa-mir-614 NCRO:0002348 miRBase:MI0003780 hsa-mir-1296 NCRO:0002349 miRBase:MI0003607 hsa-mir-595 NCRO:0002350 miRBase:MI0006416 hsa-mir-1276 NCRO:0002351 miRBase:MI0003644 hsa-mir-630 NCRO:0002352 miRBase:MI0003565 hsa-mir-559 NCRO:0002353 miRBase:MI0003660 hsa-mir-645 NCRO:0002354 miRBase:MI0006417 hsa-mir-302e NCRO:0002355 miRBase:MI0006432 hsa-mir-1288 NCRO:0002356 miRBase:MI0003623 hsa-mir-610 NCRO:0002357 miRBase:MI0003650 hsa-mir-635 NCRO:0002358 miRBase:MI0006653 hsa-mir-1322 NCRO:0002359 miRBase:MI0006274 hsa-mir-1181 NCRO:0002360 miRBase:MI0006384 hsa-mir-1249 NCRO:0002361 miRBase:MI0006276 hsa-mir-1183 NCRO:0002362 miRBase:MI0006382 hsa-mir-1247 NCRO:0002363 miRBase:MI0008193 hsa-mir-1825 NCRO:0002364 miRBase:MI0006337 hsa-mir-1204 NCRO:0002365 miRBase:MI0003631 hsa-mir-617 NCRO:0002366 miRBase:MI0006275 hsa-mir-1182 NCRO:0002367 miRBase:MI0006415 hsa-mir-1275 NCRO:0002368 miRBase:MI0006433 hsa-mir-1292 NCRO:0002369 miRBase:MI0006357 hsa-mir-1295a NCRO:0002370 miRBase:MI0003836 hsa-mir-766 NCRO:0002371 miRBase:MI0003656 hsa-mir-641 NCRO:0002372 miRBase:MI0003597 hsa-mir-588 NCRO:0002373 miRBase:MI0006348 hsa-mir-1286 NCRO:0002374 miRBase:MI0006392 hsa-mir-1258 NCRO:0002375 miRBase:MI0006398 hsa-mir-1263 NCRO:0002376 miRBase:MI0006401 hsa-mir-1265 NCRO:0002377 miRBase:MI0006326 hsa-mir-1236 NCRO:0002378 miRBase:MI0005768 hsa-mir-943 NCRO:0002379 miRBase:MI0006355 hsa-mir-1293 NCRO:0002380 miRBase:MI0006428 hsa-mir-1281 NCRO:0002381 miRBase:MI0006385 hsa-mir-1250 NCRO:0002382 miRBase:MI0004065 hsa-mir-759 NCRO:0002383 miRBase:MI0024976 hsa-mir-764 NCRO:0002384 miRBase:MI0003941 hsa-mir-761 NCRO:0002385 miRBase:MI0014205 hsa-mir-1193 NCRO:0002386 miRBase:MI0012489 hsa-mir-718 NCRO:0002387 miRBase:MI0006349 hsa-mir-1287 NCRO:0002388 miRBase:MI0003834 hsa-mir-769 NCRO:0002389 miRBase:MI0003933 hsa-mir-670 NCRO:0002390 miRBase:MI0003815 hsa-mir-1301 NCRO:0002391 miRBase:MI0012488 hsa-mir-711 NCRO:0002392 miRBase:MI0003578 hsa-mir-571 NCRO:0002393 miRBase:MI0003615 hsa-mir-602 NCRO:0002394 miRBase:MI0008333 hsa-mir-1912 NCRO:0002395 miRBase:MI0003782 hsa-mir-1468 NCRO:0002396 miRBase:MI0003619 hsa-mir-606 NCRO:0002397 miRBase:MI0006273 hsa-mir-1180 NCRO:0002398 miRBase:MI0003637 hsa-mir-623 NCRO:0002399 miRBase:MI0006396 hsa-mir-1261 NCRO:0002400 miRBase:MI0003608 hsa-mir-596 NCRO:0002401 miRBase:MI0014147 hsa-mir-3130-1 NCRO:0002402 miRBase:MI0014148 hsa-mir-3130-2 NCRO:0002403 miRBase:MI0014252 hsa-mir-3202-1 NCRO:0002404 miRBase:MI0014253 hsa-mir-3202-2 NCRO:0002405 miRBase:MI0006407 hsa-mir-1270 NCRO:0002406 miRBase:MI0014184 hsa-mir-3156-1 NCRO:0002407 miRBase:MI0014230 hsa-mir-3156-2 NCRO:0002408 miRBase:MI0014242 hsa-mir-3156-3 NCRO:0002409 miRBase:MI0014214 hsa-mir-3180-1 NCRO:0002410 miRBase:MI0014215 hsa-mir-3180-2 NCRO:0002411 miRBase:MI0014217 hsa-mir-3180-3 NCRO:0002412 miRBase:MI0016408 hsa-mir-3180-4 NCRO:0002413 miRBase:MI0016409 hsa-mir-3180-5 NCRO:0002414 miRBase:MI0014213 hsa-mir-3179-1 NCRO:0002415 miRBase:MI0014216 hsa-mir-3179-2 NCRO:0002416 miRBase:MI0014221 hsa-mir-3179-3 NCRO:0002417 miRBase:MI0031510 hsa-mir-3179-4 NCRO:0002418 miRBase:MI0007259 hsa-mir-1538 NCRO:0002419 miRBase:MI0007258 hsa-mir-1537 NCRO:0002420 miRBase:MI0015892 hsa-mir-4283-1 NCRO:0002421 miRBase:MI0015982 hsa-mir-4283-2 NCRO:0002422 miRBase:MI0006318 hsa-mir-1228 NCRO:0002423 miRBase:MI0015873 hsa-mir-2355 NCRO:0002424 miRBase:MI0003662 hsa-mir-647 NCRO:0002425 miRBase:MI0006328 hsa-mir-1238 NCRO:0002426 miRBase:MI0006405 hsa-mir-1268a NCRO:0002427 miRBase:MI0013006 hsa-mir-2861 NCRO:0002428 miRBase:MI0006372 hsa-mir-1305 NCRO:0002429 miRBase:MI0006434 hsa-mir-1252 NCRO:0002430 miRBase:MI0014134 hsa-mir-3119-1 NCRO:0002431 miRBase:MI0014135 hsa-mir-3119-2 NCRO:0002432 miRBase:MI0023563 hsa-mir-608 NCRO:0002433 miRBase:MI0008330 hsa-mir-1909 NCRO:0002434 miRBase:MI0007074 hsa-mir-1469 NCRO:0002435 miRBase:MI0005713 hsa-mir-921 NCRO:0002436 miRBase:MI0006406 hsa-mir-1269a NCRO:0002437 miRBase:MI0008331 hsa-mir-1910 NCRO:0002438 miRBase:MI0006391 hsa-mir-1257 NCRO:0002439 miRBase:MI0014128 hsa-mir-3116-1 NCRO:0002440 miRBase:MI0014129 hsa-mir-3116-2 NCRO:0002441 miRBase:MI0008334 hsa-mir-1913 NCRO:0002442 miRBase:MI0006394 hsa-mir-1260a NCRO:0002443 miRBase:MI0008329 hsa-mir-1908 NCRO:0002444 miRBase:MI0009982 hsa-mir-1972-1 NCRO:0002445 miRBase:MI0015977 hsa-mir-1972-2 NCRO:0002446 miRBase:MI0019316 hsa-mir-5708 NCRO:0002447 miRBase:MI0014247 hsa-mir-3199-1 NCRO:0002448 miRBase:MI0014248 hsa-mir-3199-2 NCRO:0002449 miRBase:MI0014189 hsa-mir-3160-1 NCRO:0002450 miRBase:MI0014190 hsa-mir-3160-2 NCRO:0002451 miRBase:MI0015844 hsa-mir-4315-1 NCRO:0002452 miRBase:MI0015983 hsa-mir-4315-2 NCRO:0002453 miRBase:MI0006332 hsa-mir-1200 NCRO:0002454 miRBase:MI0008336 hsa-mir-1915 NCRO:0002455 miRBase:MI0008335 hsa-mir-1914 NCRO:0002456 miRBase:MI0006371 hsa-mir-1304 NCRO:0002457 miRBase:MI0014186 hsa-mir-3158-1 NCRO:0002458 miRBase:MI0014187 hsa-mir-3158-2 NCRO:0002459 miRBase:MI0007076 hsa-mir-1471 NCRO:0002460 miRBase:MI0014177 hsa-mir-3150a NCRO:0002461 miRBase:MI0016426 hsa-mir-3150b NCRO:0002462 miRBase:MI0014181 hsa-mir-3074 NCRO:0002463 miRBase:MI0014228 hsa-mir-3065 NCRO:0002464 miRBase:MI0016434 hsa-mir-3926-1 NCRO:0002465 miRBase:MI0016437 hsa-mir-3926-2 NCRO:0002466 miRBase:MI0016417 hsa-mir-3913-1 NCRO:0002467 miRBase:MI0016418 hsa-mir-3913-2 NCRO:0002468 miRBase:MI0016090 hsa-mir-3689a NCRO:0002469 miRBase:MI0016411 hsa-mir-3689b NCRO:0002470 miRBase:MI0016832 hsa-mir-3689c NCRO:0002471 miRBase:MI0016834 hsa-mir-3689d-1 NCRO:0002472 miRBase:MI0016835 hsa-mir-3689d-2 NCRO:0002473 miRBase:MI0016836 hsa-mir-3689e NCRO:0002474 miRBase:MI0016837 hsa-mir-3689f NCRO:0002475 miRBase:MI0016414 hsa-mir-3910-1 NCRO:0002476 miRBase:MI0016431 hsa-mir-3910-2 NCRO:0002477 miRBase:MI0016419 hsa-mir-3914-1 NCRO:0002478 miRBase:MI0016421 hsa-mir-3914-2 NCRO:0002479 miRBase:MI0016013 hsa-mir-3622a NCRO:0002480 miRBase:MI0016014 hsa-mir-3622b NCRO:0002481 miRBase:MI0017320 hsa-mir-1343 NCRO:0002482 miRBase:MI0016873 hsa-mir-4509-1 NCRO:0002483 miRBase:MI0016874 hsa-mir-4509-2 NCRO:0002484 miRBase:MI0016875 hsa-mir-4509-3 NCRO:0002485 miRBase:MI0017419 hsa-mir-4776-1 NCRO:0002486 miRBase:MI0017420 hsa-mir-4776-2 NCRO:0002487 miRBase:MI0014246 hsa-mir-3198-1 NCRO:0002488 miRBase:MI0017335 hsa-mir-3198-2 NCRO:0002489 miRBase:MI0014156 hsa-mir-3135a NCRO:0002490 miRBase:MI0016809 hsa-mir-3135b NCRO:0002491 miRBase:MI0016775 hsa-mir-4435-1 NCRO:0002492 miRBase:MI0016777 hsa-mir-4435-2 NCRO:0002493 miRBase:MI0017310 hsa-mir-4679-1 NCRO:0002494 miRBase:MI0017311 hsa-mir-4679-2 NCRO:0002495 miRBase:MI0017277 hsa-mir-4650-1 NCRO:0002496 miRBase:MI0017278 hsa-mir-4650-2 NCRO:0002497 miRBase:MI0016776 hsa-mir-4436a NCRO:0002498 miRBase:MI0017425 hsa-mir-4436b-1 NCRO:0002499 miRBase:MI0019110 hsa-mir-4436b-2 NCRO:0002500 miRBase:MI0017375 hsa-mir-3064 NCRO:0002501 miRBase:MI0014183 hsa-mir-3155a NCRO:0002502 miRBase:MI0016839 hsa-mir-3155b NCRO:0002503 miRBase:MI0017290 hsa-mir-4662a NCRO:0002504 miRBase:MI0017293 hsa-mir-4662b NCRO:0002505 miRBase:MI0017415 hsa-mir-4773-1 NCRO:0002506 miRBase:MI0017416 hsa-mir-4773-2 NCRO:0002507 miRBase:MI0014235 hsa-mir-3190 NCRO:0002508 miRBase:MI0014236 hsa-mir-3191 NCRO:0002509 miRBase:MI0017287 hsa-mir-4659a NCRO:0002510 miRBase:MI0017291 hsa-mir-4659b NCRO:0002511 miRBase:MI0017412 hsa-mir-4771-1 NCRO:0002512 miRBase:MI0017413 hsa-mir-4771-2 NCRO:0002513 miRBase:MI0017351 hsa-mir-3529 NCRO:0002514 miRBase:MI0016089 hsa-mir-3688-1 NCRO:0002515 miRBase:MI0017447 hsa-mir-3688-2 NCRO:0002516 miRBase:MI0016964 hsa-mir-3960 NCRO:0002517 miRBase:MI0016886 hsa-mir-4520-1 NCRO:0002518 miRBase:MI0017358 hsa-mir-4520-2 NCRO:0002519 miRBase:MI0016829 hsa-mir-4477a NCRO:0002520 miRBase:MI0016830 hsa-mir-4477b NCRO:0002521 miRBase:MI0006321 hsa-mir-1231 NCRO:0002522 miRBase:MI0016787 hsa-mir-4444-1 NCRO:0002523 miRBase:MI0019111 hsa-mir-4444-2 NCRO:0002524 miRBase:MI0016906 hsa-mir-4536-1 NCRO:0002525 miRBase:MI0019149 hsa-mir-4536-2 NCRO:0002526 miRBase:MI0019308 hsa-mir-5701-1 NCRO:0002527 miRBase:MI0019593 hsa-mir-5701-2 NCRO:0002528 miRBase:MI0016891 hsa-mir-4524a NCRO:0002529 miRBase:MI0019114 hsa-mir-4524b NCRO:0002530 miRBase:MI0016081 hsa-mir-3680-1 NCRO:0002531 miRBase:MI0019113 hsa-mir-3680-2 NCRO:0002532 miRBase:MI0016071 hsa-mir-3670-1 NCRO:0002533 miRBase:MI0019112 hsa-mir-3670-2 NCRO:0002534 miRBase:MI0031513 hsa-mir-3670-3 NCRO:0002535 miRBase:MI0031514 hsa-mir-3670-4 NCRO:0002536 miRBase:MI0019281 hsa-mir-5681a NCRO:0002537 miRBase:MI0019293 hsa-mir-5681b NCRO:0002538 miRBase:MI0019288 hsa-mir-5692c-1 NCRO:0002539 miRBase:MI0019289 hsa-mir-5692c-2 NCRO:0002540 miRBase:MI0019297 hsa-mir-5692a-1 NCRO:0002541 miRBase:MI0019298 hsa-mir-5692a-2 NCRO:0002542 miRBase:MI0019139 hsa-mir-5583-1 NCRO:0002543 miRBase:MI0019140 hsa-mir-5583-2 NCRO:0002544 miRBase:MI0014197 hsa-mir-1260b NCRO:0002545 miRBase:MI0022223 hsa-mir-6511a-1 NCRO:0002546 miRBase:MI0022552 hsa-mir-6511b-1 NCRO:0002547 miRBase:MI0023431 hsa-mir-6511b-2 NCRO:0002548 miRBase:MI0023564 hsa-mir-6511a-2 NCRO:0002549 miRBase:MI0023565 hsa-mir-6511a-3 NCRO:0002550 miRBase:MI0023566 hsa-mir-6511a-4 NCRO:0002551 miRBase:MI0014204 hsa-mir-3173 NCRO:0002552 miRBase:MI0017381 hsa-mir-4743 NCRO:0002553 miRBase:MI0016789 hsa-mir-4446 NCRO:0002554 miRBase:MI0014182 hsa-mir-3154 NCRO:0002555 miRBase:MI0017297 hsa-mir-4667 NCRO:0002556 miRBase:MI0014178 hsa-mir-3151 NCRO:0002557 miRBase:MI0016061 hsa-mir-3660 NCRO:0002558 miRBase:MI0010629 hsa-mir-2110 NCRO:0002559 miRBase:MI0016600 hsa-mir-3943 NCRO:0002560 miRBase:MI0014238 hsa-mir-3193 NCRO:0002561 miRBase:MI0017443 hsa-mir-4796 NCRO:0002562 miRBase:MI0021271 hsa-mir-6127 NCRO:0002563 miRBase:MI0016003 hsa-mir-3613 NCRO:0002564 miRBase:MI0021276 hsa-mir-6131 NCRO:0002565 miRBase:MI0021275 hsa-mir-6130 NCRO:0002566 miRBase:MI0021278 hsa-mir-6133 NCRO:0002567 miRBase:MI0014137 hsa-mir-3121 NCRO:0002568 miRBase:MI0021274 hsa-mir-6129 NCRO:0002569 miRBase:MI0014170 hsa-mir-3145 NCRO:0002570 miRBase:MI0014161 hsa-mir-3138 NCRO:0002571 miRBase:MI0016010 hsa-mir-23c NCRO:0002572 miRBase:MI0021277 hsa-mir-6132 NCRO:0002573 miRBase:MI0014144 hsa-mir-3127 NCRO:0002574 miRBase:MI0016845 hsa-mir-4484 NCRO:0002575 miRBase:MI0014249 hsa-mir-3200 NCRO:0002576 miRBase:MI0021272 hsa-mir-6128 NCRO:0002577 miRBase:MI0021279 hsa-mir-6134 NCRO:0002578 miRBase:MI0016896 hsa-mir-4529 NCRO:0002579 miRBase:MI0014146 hsa-mir-3129 NCRO:0002580 miRBase:MI0017288 hsa-mir-4660 NCRO:0002581 miRBase:MI0016435 hsa-mir-3927 NCRO:0002582 miRBase:MI0021273 hsa-mir-378j NCRO:0002583 miRBase:MI0010633 hsa-mir-2114 NCRO:0002584 miRBase:MI0016876 hsa-mir-4510 NCRO:0002585 miRBase:MI0016768 hsa-mir-4429 NCRO:0002586 miRBase:MI0017350 hsa-mir-4716 NCRO:0002587 miRBase:MI0016007 hsa-mir-3617 NCRO:0002588 miRBase:MI0014171 hsa-mir-1273c NCRO:0002589 miRBase:MI0014232 hsa-mir-3188 NCRO:0002590 miRBase:MI0016593 hsa-mir-3937 NCRO:0002591 miRBase:MI0014130 hsa-mir-3117 NCRO:0002592 miRBase:MI0017282 hsa-mir-4654 NCRO:0002593 miRBase:MI0016867 hsa-mir-4504 NCRO:0002594 miRBase:MI0014152 hsa-mir-3132 NCRO:0002595 miRBase:MI0020366 hsa-mir-6089-1 NCRO:0002596 miRBase:MI0023563 hsa-mir-6089-2 NCRO:0002597 miRBase:MI0017451 hsa-mir-4803 NCRO:0002598 miRBase:MI0016881 hsa-mir-4515 NCRO:0002599 miRBase:MI0016065 hsa-mir-3664 NCRO:0002600 miRBase:MI0016002 hsa-mir-3612 NCRO:0002601 miRBase:MI0016594 hsa-mir-3938 NCRO:0002602 miRBase:MI0017376 hsa-mir-4738 NCRO:0002603 miRBase:MI0011285 hsa-mir-2278 NCRO:0002604 miRBase:MI0014143 hsa-mir-3126 NCRO:0002605 miRBase:MI0016430 hsa-mir-3923 NCRO:0002606 miRBase:MI0017438 hsa-mir-4791 NCRO:0002607 miRBase:MI0016062 hsa-mir-3661 NCRO:0002608 miRBase:MI0016005 hsa-mir-3615 NCRO:0002609 miRBase:MI0016893 hsa-mir-4526 NCRO:0002610 miRBase:MI0017427 hsa-mir-4782 NCRO:0002611 miRBase:MI0016758 hsa-mir-4421 NCRO:0002612 miRBase:MI0022211 hsa-mir-6500 NCRO:0002613 miRBase:MI0014138 hsa-mir-3122 NCRO:0002614 miRBase:MI0017303 hsa-mir-4672 NCRO:0002615 miRBase:MI0017380 hsa-mir-4742 NCRO:0002616 miRBase:MI0003643 hsa-mir-629 NCRO:0002617 miRBase:MI0015997 hsa-mir-3607 NCRO:0002618 miRBase:MI0014208 hsa-mir-3174 NCRO:0002619 miRBase:MI0017435 hsa-mir-4788 NCRO:0002620 miRBase:MI0017445 hsa-mir-4798 NCRO:0002621 miRBase:MI0014158 hsa-mir-3136 NCRO:0002622 miRBase:MI0017417 hsa-mir-4774 NCRO:0002623 miRBase:MI0016797 hsa-mir-4451 NCRO:0002624 miRBase:MI0016590 hsa-mir-3934 NCRO:0002625 miRBase:MI0017264 hsa-mir-4637 NCRO:0002626 miRBase:MI0016760 hsa-mir-4423 NCRO:0002627 miRBase:MI0014237 hsa-mir-3192 NCRO:0002628 miRBase:MI0016597 hsa-mir-3940 NCRO:0002629 miRBase:MI0016416 hsa-mir-3912 NCRO:0002630 miRBase:MI0016870 hsa-mir-2392 NCRO:0002631 miRBase:MI0014163 hsa-mir-3140 NCRO:0002632 miRBase:MI0016091 hsa-mir-3690-1 NCRO:0002633 miRBase:MI0023561 hsa-mir-3690-2 NCRO:0002634 miRBase:MI0016849 hsa-mir-4488 NCRO:0002635 miRBase:MI0014172 hsa-mir-3146 NCRO:0002636 miRBase:MI0016767 hsa-mir-4428 NCRO:0002637 miRBase:MI0009986 hsa-mir-1976 NCRO:0002638 miRBase:MI0014195 hsa-mir-3165 NCRO:0002639 miRBase:MI0014201 hsa-mir-3170 NCRO:0002640 miRBase:MI0015995 hsa-mir-3605 NCRO:0002641 miRBase:MI0016766 hsa-mir-4427 NCRO:0002642 miRBase:MI0020340 hsa-mir-1199 NCRO:0002643 miRBase:MI0025513 hsa-mir-6516 NCRO:0002644 miRBase:MI0022615 hsa-mir-6770-1 NCRO:0002645 miRBase:MI0026418 hsa-mir-6770-2 NCRO:0002646 miRBase:MI0026419 hsa-mir-6770-3 NCRO:0002647 miRBase:MI0025748 hsa-mir-7973-1 NCRO:0002648 miRBase:MI0025749 hsa-mir-7973-2 NCRO:0002649 miRBase:MI0022705 hsa-mir-6859-1 NCRO:0002650 miRBase:MI0026420 hsa-mir-6859-2 NCRO:0002651 miRBase:MI0026421 hsa-mir-6859-3 NCRO:0002652 miRBase:MI0031521 hsa-mir-6859-4 NCRO:0002653 miRBase:MI0022548 hsa-mir-6715a NCRO:0002654 miRBase:MI0016008 hsa-mir-3618 NCRO:0002655 miRBase:MI0022639 hsa-mir-6794 NCRO:0002656 miRBase:MI0022672 hsa-mir-6827 NCRO:0002657 miRBase:MI0019304 hsa-mir-5697 NCRO:0002658 miRBase:MI0017336 hsa-mir-4703 NCRO:0002659 miRBase:MI0017407 hsa-mir-4766 NCRO:0002660 miRBase:MI0008332 hsa-mir-1911 NCRO:0002661 miRBase:MI0025907 hsa-mir-8071-1 NCRO:0002662 miRBase:MI0026417 hsa-mir-8071-2 NCRO:0002663 miRBase:MI0022217 hsa-mir-6505 NCRO:0002664 miRBase:MI0022635 hsa-mir-6790 NCRO:0002665 miRBase:MI0006373 hsa-mir-1243 NCRO:0002666 miRBase:MI0014198 hsa-mir-3167 NCRO:0002667 miRBase:MI0024975 hsa-mir-7641-1 NCRO:0002668 miRBase:MI0024976 hsa-mir-7641-2 NCRO:0002669 miRBase:MI0016773 hsa-mir-4433a NCRO:0002670 miRBase:MI0025511 hsa-mir-4433b NCRO:0002671 miRBase:MI0017308 hsa-mir-4677 NCRO:0002672 miRBase:MI0022709 hsa-mir-6862-1 NCRO:0002673 miRBase:MI0026415 hsa-mir-6862-2 NCRO:0002674 miRBase:MI0022559 hsa-mir-6724-1 NCRO:0002675 miRBase:MI0031516 hsa-mir-6724-2 NCRO:0002676 miRBase:MI0031517 hsa-mir-6724-3 NCRO:0002677 miRBase:MI0031518 hsa-mir-6724-4 NCRO:0002678 miRBase:MI0014131 hsa-mir-3118-1 NCRO:0002679 miRBase:MI0014132 hsa-mir-3118-2 NCRO:0002680 miRBase:MI0014133 hsa-mir-3118-3 NCRO:0002681 miRBase:MI0014176 hsa-mir-3149 NCRO:0002682 miRBase:MI0006419 hsa-mir-1277 NCRO:0002683 miRBase:MI0016048 hsa-mir-3648-1 NCRO:0002684 miRBase:MI0031512 hsa-mir-3648-2 NCRO:0002685 miRBase:MI0017312 hsa-mir-4680 NCRO:0002686 miRBase:MI0017285 hsa-mir-4657 NCRO:0002687 miRBase:MI0025905 hsa-mir-8069-1 NCRO:0002688 miRBase:MI0031519 hsa-mir-8069-2 NCRO:0002689 miRBase:MI0016088 hsa-mir-3687-1 NCRO:0002690 miRBase:MI0031515 hsa-mir-3687-2 NCRO:0002691 miRBase:MI0016792 hsa-mir-4449 NCRO:0002692 miRBase:MI0016890 hsa-mir-4523 NCRO:0002693 miRBase:MIPF0000001 mir-17 NCRO:0002694 miRBase:MIPF0000002 let-7 NCRO:0002695 miRBase:MIPF0000005 mir-30 NCRO:0002696 miRBase:MIPF0000006 mir-15 NCRO:0002697 miRBase:MIPF0000007 mir-181 NCRO:0002698 miRBase:MIPF0000009 mir-29 NCRO:0002699 miRBase:MIPF0000011 mir-19 NCRO:0002700 miRBase:MIPF0000013 mir-25 NCRO:0002701 miRBase:MIPF0000014 mir-9 NCRO:0002702 miRBase:MIPF0000018 mir-154 NCRO:0002703 miRBase:MIPF0000019 mir-8 NCRO:0002704 miRBase:MIPF0000020 mir-515 NCRO:0002705 miRBase:MIPF0000021 mir-124 NCRO:0002706 miRBase:MIPF0000022 mir-7 NCRO:0002707 miRBase:MIPF0000024 mir-103 NCRO:0002708 miRBase:MIPF0000026 mir-218 NCRO:0002709 miRBase:MIPF0000027 mir-23 NCRO:0002710 miRBase:MIPF0000028 mir-135 NCRO:0002711 miRBase:MIPF0000029 mir-133 NCRO:0002712 miRBase:MIPF0000031 mir-196 NCRO:0002713 miRBase:MIPF0000033 mir-10 NCRO:0002714 miRBase:MIPF0000034 mir-130 NCRO:0002715 miRBase:MIPF0000036 mir-27 NCRO:0002716 miRBase:MIPF0000038 mir-1 NCRO:0002717 miRBase:MIPF0000039 mir-34 NCRO:0002718 miRBase:MIPF0000040 mir-199 NCRO:0002719 miRBase:MIPF0000041 mir-24 NCRO:0002720 miRBase:MIPF0000042 mir-204 NCRO:0002721 miRBase:MIPF0000043 mir-26 NCRO:0002722 miRBase:MIPF0000044 mir-219 NCRO:0002723 miRBase:MIPF0000046 mir-101 NCRO:0002724 miRBase:MIPF0000048 mir-128 NCRO:0002725 miRBase:MIPF0000050 mir-153 NCRO:0002726 miRBase:MIPF0000051 mir-221 NCRO:0002727 miRBase:MIPF0000053 mir-22 NCRO:0002728 miRBase:MIPF0000054 mir-216 NCRO:0002729 miRBase:MIPF0000055 mir-194 NCRO:0002730 miRBase:MIPF0000056 mir-148 NCRO:0002731 miRBase:MIPF0000057 mir-28 NCRO:0002732 miRBase:MIPF0000058 mir-205 NCRO:0002733 miRBase:MIPF0000059 mir-184 NCRO:0002734 miRBase:MIPF0000060 mir-21 NCRO:0002735 miRBase:MIPF0000061 mir-365 NCRO:0002736 miRBase:MIPF0000062 mir-214 NCRO:0002737 miRBase:MIPF0000063 mir-192 NCRO:0002738 miRBase:MIPF0000064 mir-31 NCRO:0002739 miRBase:MIPF0000065 mir-132 NCRO:0002740 miRBase:MIPF0000066 mir-183 NCRO:0002741 miRBase:MIPF0000067 mir-223 NCRO:0002742 miRBase:MIPF0000068 mir-290 NCRO:0002743 miRBase:MIPF0000069 mir-32 NCRO:0002744 miRBase:MIPF0000070 mir-33 NCRO:0002745 miRBase:MIPF0000071 mir-302 NCRO:0002746 miRBase:MIPF0000072 mir-96 NCRO:0002747 miRBase:MIPF0000073 mir-129 NCRO:0002748 miRBase:MIPF0000074 mir-105 NCRO:0002749 miRBase:MIPF0000075 mir-138 NCRO:0002750 miRBase:MIPF0000076 mir-190 NCRO:0002751 miRBase:MIPF0000077 mir-217 NCRO:0002752 miRBase:MIPF0000078 mir-187 NCRO:0002753 miRBase:MIPF0000079 mir-145 NCRO:0002754 miRBase:MIPF0000080 mir-127 NCRO:0002755 miRBase:MIPF0000082 mir-193 NCRO:0002756 miRBase:MIPF0000084 mir-142 NCRO:0002757 miRBase:MIPF0000085 mir-140 NCRO:0002758 miRBase:MIPF0000086 mir-210 NCRO:0002759 miRBase:MIPF0000088 mir-224 NCRO:0002760 miRBase:MIPF0000090 mir-198 NCRO:0002761 miRBase:MIPF0000091 mir-368 NCRO:0002762 miRBase:MIPF0000093 mir-144 NCRO:0002763 miRBase:MIPF0000094 mir-143 NCRO:0002764 miRBase:MIPF0000095 mir-122 NCRO:0002765 miRBase:MIPF0000097 mir-338 NCRO:0002766 miRBase:MIPF0000098 mir-95 NCRO:0002767 miRBase:MIPF0000099 mir-136 NCRO:0002768 miRBase:MIPF0000103 mir-146 NCRO:0002769 miRBase:MIPF0000105 mir-147 NCRO:0002770 miRBase:MIPF0000106 mir-137 NCRO:0002771 miRBase:MIPF0000108 mir-203 NCRO:0002772 miRBase:MIPF0000109 mir-186 NCRO:0002773 miRBase:MIPF0000110 mir-329 NCRO:0002774 miRBase:MIPF0000111 mir-489 NCRO:0002775 miRBase:MIPF0000112 mir-134 NCRO:0002776 miRBase:MIPF0000113 mir-188 NCRO:0002777 miRBase:MIPF0000114 mir-375 NCRO:0002778 miRBase:MIPF0000115 mir-126 NCRO:0002779 miRBase:MIPF0000116 mir-182 NCRO:0002780 miRBase:MIPF0000117 mir-139 NCRO:0002781 miRBase:MIPF0000121 mir-202 NCRO:0002782 miRBase:MIPF0000123 mir-197 NCRO:0002783 miRBase:MIPF0000126 mir-379 NCRO:0002784 miRBase:MIPF0000128 mir-450 NCRO:0002785 miRBase:MIPF0000129 mir-455 NCRO:0002786 miRBase:MIPF0000130 mir-506 NCRO:0002787 miRBase:MIPF0000133 mir-449 NCRO:0002788 miRBase:MIPF0000137 mir-383 NCRO:0002789 miRBase:MIPF0000138 mir-363 NCRO:0002790 miRBase:MIPF0000139 mir-500 NCRO:0002791 miRBase:MIPF0000142 mir-431 NCRO:0002792 miRBase:MIPF0000143 mir-326 NCRO:0002793 miRBase:MIPF0000147 mir-325 NCRO:0002794 miRBase:MIPF0000148 mir-451 NCRO:0002795 miRBase:MIPF0000149 mir-448 NCRO:0002796 miRBase:MIPF0000157 mir-155 NCRO:0002797 miRBase:MIPF0000159 mir-296 NCRO:0002798 miRBase:MIPF0000162 mir-367 NCRO:0002799 miRBase:MIPF0000163 mir-320 NCRO:0002800 miRBase:MIPF0000164 mir-322 NCRO:0002801 miRBase:MIPF0000165 mir-324 NCRO:0002802 miRBase:MIPF0000167 mir-370 NCRO:0002803 miRBase:MIPF0000168 mir-378 NCRO:0002804 miRBase:MIPF0000172 mir-361 NCRO:0002805 miRBase:MIPF0000173 mir-499 NCRO:0002806 miRBase:MIPF0000174 mir-454 NCRO:0002807 miRBase:MIPF0000177 mir-433 NCRO:0002808 miRBase:MIPF0000178 mir-208 NCRO:0002809 miRBase:MIPF0000180 mir-483 NCRO:0002810 miRBase:MIPF0000183 mir-503 NCRO:0002811 miRBase:MIPF0000185 mir-542 NCRO:0002812 miRBase:MIPF0000186 mir-299 NCRO:0002813 miRBase:MIPF0000188 mir-346 NCRO:0002814 miRBase:MIPF0000189 mir-345 NCRO:0002815 miRBase:MIPF0000190 mir-342 NCRO:0002816 miRBase:MIPF0000191 mir-340 NCRO:0002817 miRBase:MIPF0000192 mir-412 NCRO:0002818 miRBase:MIPF0000193 mir-339 NCRO:0002819 miRBase:MIPF0000194 mir-191 NCRO:0002820 miRBase:MIPF0000195 mir-337 NCRO:0002821 miRBase:MIPF0000196 mir-335 NCRO:0002822 miRBase:MIPF0000197 mir-150 NCRO:0002823 miRBase:MIPF0000199 mir-331 NCRO:0002824 miRBase:MIPF0000200 mir-330 NCRO:0002825 miRBase:MIPF0000201 mir-485 NCRO:0002826 miRBase:MIPF0000202 mir-185 NCRO:0002827 miRBase:MIPF0000203 mir-328 NCRO:0002828 miRBase:MIPF0000204 mir-297 NCRO:0002829 miRBase:MIPF0000206 mir-298 NCRO:0002830 miRBase:MIPF0000209 mir-362 NCRO:0002831 miRBase:MIPF0000211 mir-432 NCRO:0002832 miRBase:MIPF0000213 mir-541 NCRO:0002833 miRBase:MIPF0000217 mir-505 NCRO:0002834 miRBase:MIPF0000219 mir-484 NCRO:0002835 miRBase:MIPF0000220 mir-486 NCRO:0002836 miRBase:MIPF0000229 mir-490 NCRO:0002837 miRBase:MIPF0000230 mir-493 NCRO:0002838 miRBase:MIPF0000231 mir-497 NCRO:0002839 miRBase:MIPF0000242 mir-425 NCRO:0002840 miRBase:MIPF0000274 mir-149 NCRO:0002841 miRBase:MIPF0000287 mir-452 NCRO:0002842 miRBase:MIPF0000288 mir-374 NCRO:0002843 miRBase:MIPF0000289 mir-384 NCRO:0002844 miRBase:MIPF0000300 mir-664 NCRO:0002845 miRBase:MIPF0000316 mir-467 NCRO:0002846 miRBase:MIPF0000317 mir-548 NCRO:0002847 miRBase:MIPF0000318 mir-488 NCRO:0002848 miRBase:MIPF0000319 mir-491 NCRO:0002849 miRBase:MIPF0000329 mir-423 NCRO:0002850 miRBase:MIPF0000333 mir-652 NCRO:0002851 miRBase:MIPF0000334 mir-550 NCRO:0002852 miRBase:MIPF0000340 mir-592 NCRO:0002853 miRBase:MIPF0000342 mir-615 NCRO:0002854 miRBase:MIPF0000353 mir-802 NCRO:0002855 miRBase:MIPF0000355 mir-770 NCRO:0002856 miRBase:MIPF0000357 mir-668 NCRO:0002857 miRBase:MIPF0000358 mir-671 NCRO:0002858 miRBase:MIPF0000360 mir-551 NCRO:0002859 miRBase:MIPF0000365 mir-675 NCRO:0002860 miRBase:MIPF0000386 mir-743 NCRO:0002861 miRBase:MIPF0000387 mir-941 NCRO:0002862 miRBase:MIPF0000390 mir-873 NCRO:0002863 miRBase:MIPF0000392 mir-877 NCRO:0002864 miRBase:MIPF0000393 mir-598 NCRO:0002865 miRBase:MIPF0000395 mir-760 NCRO:0002866 miRBase:MIPF0000397 mir-708 NCRO:0002867 miRBase:MIPF0000401 mir-874 NCRO:0002868 miRBase:MIPF0000404 mir-665 NCRO:0002869 miRBase:MIPF0000408 mir-568 NCRO:0002870 miRBase:MIPF0000409 mir-654 NCRO:0002871 miRBase:MIPF0000417 mir-582 NCRO:0002872 miRBase:MIPF0000418 mir-590 NCRO:0002873 miRBase:MIPF0000419 mir-574 NCRO:0002874 miRBase:MIPF0000420 mir-891 NCRO:0002875 miRBase:MIPF0000424 mir-875 NCRO:0002876 miRBase:MIPF0000430 mir-876 NCRO:0002877 miRBase:MIPF0000431 mir-744 NCRO:0002878 miRBase:MIPF0000435 mir-653 NCRO:0002879 miRBase:MIPF0000436 mir-544 NCRO:0002880 miRBase:MIPF0000437 mir-504 NCRO:0002881 miRBase:MIPF0000440 mir-1224 NCRO:0002882 miRBase:MIPF0000444 mir-1226 NCRO:0002883 miRBase:MIPF0000445 mir-1225 NCRO:0002884 miRBase:MIPF0000454 mir-1227 NCRO:0002885 miRBase:MIPF0000456 mir-1302 NCRO:0002886 miRBase:MIPF0000457 mir-650 NCRO:0002887 miRBase:MIPF0000462 mir-663 NCRO:0002888 miRBase:MIPF0000463 mir-498 NCRO:0002889 miRBase:MIPF0000464 mir-612 NCRO:0002890 miRBase:MIPF0000465 mir-661 NCRO:0002891 miRBase:MIPF0000466 mir-581 NCRO:0002892 miRBase:MIPF0000467 mir-586 NCRO:0002893 miRBase:MIPF0000468 mir-642 NCRO:0002894 miRBase:MIPF0000469 mir-938 NCRO:0002895 miRBase:MIPF0000470 mir-549 NCRO:0002896 miRBase:MIPF0000471 mir-676 NCRO:0002897 miRBase:MIPF0000474 mir-626 NCRO:0002898 miRBase:MIPF0000475 mir-556 NCRO:0002899 miRBase:MIPF0000476 mir-648 NCRO:0002900 miRBase:MIPF0000477 mir-578 NCRO:0002901 miRBase:MIPF0000478 mir-651 NCRO:0002902 miRBase:MIPF0000479 mir-597 NCRO:0002903 miRBase:MIPF0000480 mir-607 NCRO:0002904 miRBase:MIPF0000482 mir-583 NCRO:0002905 miRBase:MIPF0000483 mir-1271 NCRO:0002906 miRBase:MIPF0000484 mir-600 NCRO:0002907 miRBase:MIPF0000486 mir-638 NCRO:0002908 miRBase:MIPF0000487 mir-553 NCRO:0002909 miRBase:MIPF0000488 mir-643 NCRO:0002910 miRBase:MIPF0000490 mir-939 NCRO:0002911 miRBase:MIPF0000492 mir-662 NCRO:0002912 miRBase:MIPF0000493 mir-576 NCRO:0002913 miRBase:MIPF0000494 mir-640 NCRO:0002914 miRBase:MIPF0000495 mir-920 NCRO:0002915 miRBase:MIPF0000496 mir-589 NCRO:0002916 miRBase:MIPF0000498 mir-657 NCRO:0002917 miRBase:MIPF0000499 mir-492 NCRO:0002918 miRBase:MIPF0000500 mir-373 NCRO:0002919 miRBase:MIPF0000501 mir-552 NCRO:0002920 miRBase:MIPF0000502 mir-599 NCRO:0002921 miRBase:MIPF0000503 mir-593 NCRO:0002922 miRBase:MIPF0000505 mir-933 NCRO:0002923 miRBase:MIPF0000506 mir-1255 NCRO:0002924 miRBase:MIPF0000507 mir-616 NCRO:0002925 miRBase:MIPF0000508 mir-631 NCRO:0002926 miRBase:MIPF0000511 mir-942 NCRO:0002927 miRBase:MIPF0000512 mir-562 NCRO:0002928 miRBase:MIPF0000513 mir-924 NCRO:0002929 miRBase:MIPF0000514 mir-889 NCRO:0002930 miRBase:MIPF0000515 mir-580 NCRO:0002931 miRBase:MIPF0000516 mir-609 NCRO:0002932 miRBase:MIPF0000517 mir-936 NCRO:0002933 miRBase:MIPF0000519 mir-563 NCRO:0002934 miRBase:MIPF0000520 mir-557 NCRO:0002935 miRBase:MIPF0000522 mir-601 NCRO:0002936 miRBase:MIPF0000523 mir-624 NCRO:0002937 miRBase:MIPF0000524 mir-636 NCRO:0002938 miRBase:MIPF0000527 mir-632 NCRO:0002939 miRBase:MIPF0000528 mir-605 NCRO:0002940 miRBase:MIPF0000529 mir-628 NCRO:0002941 miRBase:MIPF0000530 mir-577 NCRO:0002942 miRBase:MIPF0000531 mir-1306 NCRO:0002943 miRBase:MIPF0000532 mir-885 NCRO:0002944 miRBase:MIPF0000533 mir-584 NCRO:0002945 miRBase:MIPF0000534 mir-625 NCRO:0002946 miRBase:MIPF0000535 mir-569 NCRO:0002947 miRBase:MIPF0000536 mir-922 NCRO:0002948 miRBase:MIPF0000537 mir-572 NCRO:0002949 miRBase:MIPF0000538 mir-558 NCRO:0002950 miRBase:MIPF0000539 mir-611 NCRO:0002951 miRBase:MIPF0000540 mir-940 NCRO:0002952 miRBase:MIPF0000541 mir-944 NCRO:0002953 miRBase:MIPF0000542 mir-934 NCRO:0002954 miRBase:MIPF0000545 mir-765 NCRO:0002955 miRBase:MIPF0000546 mir-633 NCRO:0002956 miRBase:MIPF0000547 mir-649 NCRO:0002957 miRBase:MIPF0000548 mir-422 NCRO:0002958 miRBase:MIPF0000549 mir-639 NCRO:0002959 miRBase:MIPF0000550 mir-627 NCRO:0002960 miRBase:MIPF0000551 mir-554 NCRO:0002961 miRBase:MIPF0000552 mir-767 NCRO:0002962 miRBase:MIPF0000553 mir-618 NCRO:0002963 miRBase:MIPF0000554 mir-887 NCRO:0002964 miRBase:MIPF0000555 mir-567 NCRO:0002965 miRBase:MIPF0000556 mir-644 NCRO:0002966 miRBase:MIPF0000557 mir-619 NCRO:0002967 miRBase:MIPF0000558 mir-1307 NCRO:0002968 miRBase:MIPF0000559 mir-1285 NCRO:0002969 miRBase:MIPF0000560 mir-937 NCRO:0002970 miRBase:MIPF0000561 mir-573 NCRO:0002971 miRBase:MIPF0000562 mir-604 NCRO:0002972 miRBase:MIPF0000563 mir-587 NCRO:0002973 miRBase:MIPF0000569 mir-1244 NCRO:0002974 miRBase:MIPF0000576 mir-566 NCRO:0002975 miRBase:MIPF0000578 mir-1233 NCRO:0002976 miRBase:MIPF0000579 mir-1273 NCRO:0002977 miRBase:MIPF0000583 mir-555 NCRO:0002978 miRBase:MIPF0000584 mir-1297 NCRO:0002979 miRBase:MIPF0000585 mir-1237 NCRO:0002980 miRBase:MIPF0000586 mir-575 NCRO:0002981 miRBase:MIPF0000587 mir-1282 NCRO:0002982 miRBase:MIPF0000589 mir-1324 NCRO:0002983 miRBase:MIPF0000590 mir-613 NCRO:0002984 miRBase:MIPF0000591 mir-1278 NCRO:0002985 miRBase:MIPF0000592 mir-1184 NCRO:0002986 miRBase:MIPF0000594 mir-1256 NCRO:0002987 miRBase:MIPF0000595 mir-1262 NCRO:0002988 miRBase:MIPF0000596 mir-1207 NCRO:0002989 miRBase:MIPF0000597 mir-637 NCRO:0002990 miRBase:MIPF0000598 mir-1298 NCRO:0002991 miRBase:MIPF0000599 mir-1291 NCRO:0002992 miRBase:MIPF0000600 mir-634 NCRO:0002993 miRBase:MIPF0000601 mir-1178 NCRO:0002994 miRBase:MIPF0000603 mir-1294 NCRO:0002995 miRBase:MIPF0000604 mir-1284 NCRO:0002996 miRBase:MIPF0000605 mir-646 NCRO:0002997 miRBase:MIPF0000606 mir-935 NCRO:0002998 miRBase:MIPF0000608 mir-1303 NCRO:0002999 miRBase:MIPF0000609 mir-1205 NCRO:0003000 miRBase:MIPF0000610 mir-1290 NCRO:0003001 miRBase:MIPF0000611 mir-1253 NCRO:0003002 miRBase:MIPF0000612 mir-564 NCRO:0003003 miRBase:MIPF0000613 mir-1202 NCRO:0003004 miRBase:MIPF0000614 mir-1254 NCRO:0003005 miRBase:MIPF0000615 mir-1266 NCRO:0003006 miRBase:MIPF0000617 mir-1323 NCRO:0003007 miRBase:MIPF0000619 mir-622 NCRO:0003008 miRBase:MIPF0000620 mir-1245 NCRO:0003009 miRBase:MIPF0000621 mir-1251 NCRO:0003010 miRBase:MIPF0000622 mir-1248 NCRO:0003011 miRBase:MIPF0000623 mir-561 NCRO:0003012 miRBase:MIPF0000624 mir-762 NCRO:0003013 miRBase:MIPF0000625 mir-1299 NCRO:0003014 miRBase:MIPF0000626 mir-1289 NCRO:0003015 miRBase:MIPF0000627 mir-1246 NCRO:0003016 miRBase:MIPF0000628 mir-1208 NCRO:0003017 miRBase:MIPF0000631 mir-621 NCRO:0003018 miRBase:MIPF0000632 mir-1179 NCRO:0003019 miRBase:MIPF0000633 mir-1203 NCRO:0003020 miRBase:MIPF0000634 mir-1206 NCRO:0003021 miRBase:MIPF0000640 mir-1267 NCRO:0003022 miRBase:MIPF0000641 mir-591 NCRO:0003023 miRBase:MIPF0000643 mir-658 NCRO:0003024 miRBase:MIPF0000645 mir-1272 NCRO:0003025 miRBase:MIPF0000646 mir-1827 NCRO:0003026 miRBase:MIPF0000647 mir-614 NCRO:0003027 miRBase:MIPF0000649 mir-1296 NCRO:0003028 miRBase:MIPF0000651 mir-595 NCRO:0003029 miRBase:MIPF0000652 mir-1276 NCRO:0003030 miRBase:MIPF0000653 mir-630 NCRO:0003031 miRBase:MIPF0000656 mir-559 NCRO:0003032 miRBase:MIPF0000657 mir-645 NCRO:0003033 miRBase:MIPF0000658 mir-302_2 NCRO:0003034 miRBase:MIPF0000660 mir-1288 NCRO:0003035 miRBase:MIPF0000661 mir-610 NCRO:0003036 miRBase:MIPF0000662 mir-635 NCRO:0003037 miRBase:MIPF0000663 mir-1322 NCRO:0003038 miRBase:MIPF0000665 mir-1181 NCRO:0003039 miRBase:MIPF0000667 mir-1249 NCRO:0003040 miRBase:MIPF0000668 mir-1183 NCRO:0003041 miRBase:MIPF0000669 mir-1247 NCRO:0003042 miRBase:MIPF0000670 mir-1825 NCRO:0003043 miRBase:MIPF0000671 mir-1204 NCRO:0003044 miRBase:MIPF0000672 mir-617 NCRO:0003045 miRBase:MIPF0000673 mir-1182 NCRO:0003046 miRBase:MIPF0000674 mir-1275 NCRO:0003047 miRBase:MIPF0000675 mir-1292 NCRO:0003048 miRBase:MIPF0000676 mir-1295 NCRO:0003049 miRBase:MIPF0000677 mir-766 NCRO:0003050 miRBase:MIPF0000679 mir-641 NCRO:0003051 miRBase:MIPF0000681 mir-588 NCRO:0003052 miRBase:MIPF0000682 mir-1286 NCRO:0003053 miRBase:MIPF0000684 mir-1258 NCRO:0003054 miRBase:MIPF0000687 mir-1263 NCRO:0003055 miRBase:MIPF0000688 mir-1265 NCRO:0003056 miRBase:MIPF0000689 mir-1236 NCRO:0003057 miRBase:MIPF0000690 mir-943 NCRO:0003058 miRBase:MIPF0000691 mir-1293 NCRO:0003059 miRBase:MIPF0000695 mir-1281 NCRO:0003060 miRBase:MIPF0000696 mir-1250 NCRO:0003061 miRBase:MIPF0000706 mir-759 NCRO:0003062 miRBase:MIPF0000707 mir-764 NCRO:0003063 miRBase:MIPF0000709 mir-761 NCRO:0003064 miRBase:MIPF0000714 mir-1193 NCRO:0003065 miRBase:MIPF0000721 mir-718 NCRO:0003066 miRBase:MIPF0000725 mir-1287 NCRO:0003067 miRBase:MIPF0000727 mir-769 NCRO:0003068 miRBase:MIPF0000734 mir-670 NCRO:0003069 miRBase:MIPF0000742 mir-1301 NCRO:0003070 miRBase:MIPF0000748 mir-711 NCRO:0003071 miRBase:MIPF0000757 mir-571 NCRO:0003072 miRBase:MIPF0000767 mir-602 NCRO:0003073 miRBase:MIPF0000768 mir-1912 NCRO:0003074 miRBase:MIPF0000777 mir-1468 NCRO:0003075 miRBase:MIPF0000780 mir-606 NCRO:0003076 miRBase:MIPF0000789 mir-1180 NCRO:0003077 miRBase:MIPF0000798 mir-623 NCRO:0003078 miRBase:MIPF0000802 mir-1261 NCRO:0003079 miRBase:MIPF0000808 mir-596 NCRO:0003080 miRBase:MIPF0000845 mir-3130 NCRO:0003081 miRBase:MIPF0000846 mir-3202 NCRO:0003082 miRBase:MIPF0000877 mir-1270 NCRO:0003083 miRBase:MIPF0000891 mir-3156 NCRO:0003084 miRBase:MIPF0000894 mir-3180 NCRO:0003085 miRBase:MIPF0000900 mir-3179 NCRO:0003086 miRBase:MIPF0000903 mir-1538 NCRO:0003087 miRBase:MIPF0000917 mir-1537 NCRO:0003088 miRBase:MIPF0000919 mir-4283 NCRO:0003089 miRBase:MIPF0000924 mir-1228 NCRO:0003090 miRBase:MIPF0000938 mir-2355 NCRO:0003091 miRBase:MIPF0000939 mir-647 NCRO:0003092 miRBase:MIPF0000941 mir-1238 NCRO:0003093 miRBase:MIPF0000946 mir-1268 NCRO:0003094 miRBase:MIPF0000963 mir-2861 NCRO:0003095 miRBase:MIPF0000965 mir-1305 NCRO:0003096 miRBase:MIPF0000968 mir-1252 NCRO:0003097 miRBase:MIPF0000971 mir-3119 NCRO:0003098 miRBase:MIPF0000972 mir-608 NCRO:0003099 miRBase:MIPF0000973 mir-1909 NCRO:0003100 miRBase:MIPF0000979 mir-1469 NCRO:0003101 miRBase:MIPF0000982 mir-921 NCRO:0003102 miRBase:MIPF0000984 mir-1269 NCRO:0003103 miRBase:MIPF0000987 mir-1910 NCRO:0003104 miRBase:MIPF0000998 mir-1257 NCRO:0003105 miRBase:MIPF0001002 mir-3116 NCRO:0003106 miRBase:MIPF0001015 mir-1913 NCRO:0003107 miRBase:MIPF0001020 mir-1260a NCRO:0003108 miRBase:MIPF0001021 mir-1908 NCRO:0003109 miRBase:MIPF0001025 mir-1972 NCRO:0003110 miRBase:MIPF0001026 mir-3199 NCRO:0003111 miRBase:MIPF0001028 mir-3160 NCRO:0003112 miRBase:MIPF0001033 mir-4315 NCRO:0003113 miRBase:MIPF0001036 mir-1200 NCRO:0003114 miRBase:MIPF0001037 mir-1915 NCRO:0003115 miRBase:MIPF0001040 mir-1914 NCRO:0003116 miRBase:MIPF0001064 mir-1304 NCRO:0003117 miRBase:MIPF0001065 mir-3158 NCRO:0003118 miRBase:MIPF0001069 mir-1471 NCRO:0003119 miRBase:MIPF0001102 mir-3150 NCRO:0003120 miRBase:MIPF0001103 mir-3074 NCRO:0003121 miRBase:MIPF0001105 mir-3065 NCRO:0003122 miRBase:MIPF0001118 mir-3926 NCRO:0003123 miRBase:MIPF0001134 mir-3913 NCRO:0003124 miRBase:MIPF0001144 mir-3689 NCRO:0003125 miRBase:MIPF0001148 mir-3910 NCRO:0003126 miRBase:MIPF0001169 mir-3914 NCRO:0003127 miRBase:MIPF0001179 mir-3622 NCRO:0003128 miRBase:MIPF0001206 mir-1343 NCRO:0003129 miRBase:MIPF0001207 mir-4509 NCRO:0003130 miRBase:MIPF0001210 mir-4776 NCRO:0003131 miRBase:MIPF0001216 mir-3198 NCRO:0003132 miRBase:MIPF0001219 mir-3135 NCRO:0003133 miRBase:MIPF0001220 mir-4435 NCRO:0003134 miRBase:MIPF0001228 mir-4679 NCRO:0003135 miRBase:MIPF0001234 mir-4650 NCRO:0003136 miRBase:MIPF0001236 mir-4436 NCRO:0003137 miRBase:MIPF0001238 mir-3064 NCRO:0003138 miRBase:MIPF0001242 mir-3155 NCRO:0003139 miRBase:MIPF0001245 mir-4662 NCRO:0003140 miRBase:MIPF0001250 mir-4773 NCRO:0003141 miRBase:MIPF0001251 mir-3190 NCRO:0003142 miRBase:MIPF0001256 mir-4659 NCRO:0003143 miRBase:MIPF0001258 mir-4771 NCRO:0003144 miRBase:MIPF0001261 mir-3529 NCRO:0003145 miRBase:MIPF0001263 mir-3688 NCRO:0003146 miRBase:MIPF0001271 mir-3960 NCRO:0003147 miRBase:MIPF0001272 mir-4520 NCRO:0003148 miRBase:MIPF0001274 mir-4477 NCRO:0003149 miRBase:MIPF0001309 mir-1231 NCRO:0003150 miRBase:MIPF0001310 mir-4444 NCRO:0003151 miRBase:MIPF0001319 mir-4536 NCRO:0003152 miRBase:MIPF0001325 mir-5701 NCRO:0003153 miRBase:MIPF0001330 mir-4524 NCRO:0003154 miRBase:MIPF0001338 mir-3680 NCRO:0003155 miRBase:MIPF0001340 mir-3670 NCRO:0003156 miRBase:MIPF0001343 mir-5681 NCRO:0003157 miRBase:MIPF0001351 mir-5692 NCRO:0003158 miRBase:MIPF0001356 mir-5583 NCRO:0003159 miRBase:MIPF0001381 mir-1260b NCRO:0003160 miRBase:MIPF0001382 mir-6511 NCRO:0003161 miRBase:MIPF0001383 mir-3173 NCRO:0003162 miRBase:MIPF0001384 mir-4743 NCRO:0003163 miRBase:MIPF0001385 mir-4446 NCRO:0003164 miRBase:MIPF0001387 mir-3154 NCRO:0003165 miRBase:MIPF0001390 mir-4667 NCRO:0003166 miRBase:MIPF0001394 mir-3151 NCRO:0003167 miRBase:MIPF0001397 mir-3660 NCRO:0003168 miRBase:MIPF0001399 mir-2110 NCRO:0003169 miRBase:MIPF0001400 mir-3943 NCRO:0003170 miRBase:MIPF0001401 mir-3193 NCRO:0003171 miRBase:MIPF0001402 mir-4796 NCRO:0003172 miRBase:MIPF0001405 mir-6127 NCRO:0003173 miRBase:MIPF0001411 mir-3613 NCRO:0003174 miRBase:MIPF0001412 mir-6131 NCRO:0003175 miRBase:MIPF0001413 mir-6130 NCRO:0003176 miRBase:MIPF0001415 mir-6133 NCRO:0003177 miRBase:MIPF0001417 mir-3121 NCRO:0003178 miRBase:MIPF0001423 mir-6129 NCRO:0003179 miRBase:MIPF0001427 mir-3145 NCRO:0003180 miRBase:MIPF0001428 mir-3138 NCRO:0003181 miRBase:MIPF0001429 mir-23c NCRO:0003182 miRBase:MIPF0001438 mir-6132 NCRO:0003183 miRBase:MIPF0001439 mir-3127 NCRO:0003184 miRBase:MIPF0001440 mir-4484 NCRO:0003185 miRBase:MIPF0001441 mir-3200 NCRO:0003186 miRBase:MIPF0001442 mir-6128 NCRO:0003187 miRBase:MIPF0001445 mir-6134 NCRO:0003188 miRBase:MIPF0001451 mir-4529 NCRO:0003189 miRBase:MIPF0001458 mir-3129 NCRO:0003190 miRBase:MIPF0001460 mir-4660 NCRO:0003191 miRBase:MIPF0001462 mir-3927 NCRO:0003192 miRBase:MIPF0001463 mir-378_2 NCRO:0003193 miRBase:MIPF0001464 mir-2114 NCRO:0003194 miRBase:MIPF0001467 mir-4510 NCRO:0003195 miRBase:MIPF0001474 mir-4429 NCRO:0003196 miRBase:MIPF0001476 mir-4716 NCRO:0003197 miRBase:MIPF0001477 mir-3617 NCRO:0003198 miRBase:MIPF0001481 mir-1273c NCRO:0003199 miRBase:MIPF0001488 mir-3188 NCRO:0003200 miRBase:MIPF0001500 mir-3937 NCRO:0003201 miRBase:MIPF0001506 mir-3117 NCRO:0003202 miRBase:MIPF0001507 mir-4654 NCRO:0003203 miRBase:MIPF0001508 mir-4504 NCRO:0003204 miRBase:MIPF0001509 mir-3132 NCRO:0003205 miRBase:MIPF0001510 mir-6089 NCRO:0003206 miRBase:MIPF0001511 mir-4803 NCRO:0003207 miRBase:MIPF0001512 mir-4515 NCRO:0003208 miRBase:MIPF0001518 mir-3664 NCRO:0003209 miRBase:MIPF0001519 mir-3612 NCRO:0003210 miRBase:MIPF0001520 mir-3938 NCRO:0003211 miRBase:MIPF0001521 mir-4738 NCRO:0003212 miRBase:MIPF0001522 mir-2278 NCRO:0003213 miRBase:MIPF0001525 mir-3126 NCRO:0003214 miRBase:MIPF0001527 mir-3923 NCRO:0003215 miRBase:MIPF0001529 mir-4791 NCRO:0003216 miRBase:MIPF0001530 mir-3661 NCRO:0003217 miRBase:MIPF0001540 mir-3615 NCRO:0003218 miRBase:MIPF0001545 mir-4526 NCRO:0003219 miRBase:MIPF0001546 mir-4782 NCRO:0003220 miRBase:MIPF0001548 mir-4421 NCRO:0003221 miRBase:MIPF0001549 mir-3122 NCRO:0003222 miRBase:MIPF0001551 mir-4672 NCRO:0003223 miRBase:MIPF0001552 mir-4742 NCRO:0003224 miRBase:MIPF0001555 mir-629 NCRO:0003225 miRBase:MIPF0001566 mir-3607 NCRO:0003226 miRBase:MIPF0001569 mir-3174 NCRO:0003227 miRBase:MIPF0001573 mir-4788 NCRO:0003228 miRBase:MIPF0001574 mir-4798 NCRO:0003229 miRBase:MIPF0001575 mir-3136 NCRO:0003230 miRBase:MIPF0001578 mir-4774 NCRO:0003231 miRBase:MIPF0001582 mir-4451 NCRO:0003232 miRBase:MIPF0001584 mir-3934 NCRO:0003233 miRBase:MIPF0001586 mir-4637 NCRO:0003234 miRBase:MIPF0001587 mir-4423 NCRO:0003235 miRBase:MIPF0001597 mir-3192 NCRO:0003236 miRBase:MIPF0001599 mir-3940 NCRO:0003237 miRBase:MIPF0001601 mir-3912 NCRO:0003238 miRBase:MIPF0001614 mir-2392 NCRO:0003239 miRBase:MIPF0001615 mir-3140 NCRO:0003240 miRBase:MIPF0001618 mir-3690 NCRO:0003241 miRBase:MIPF0001623 mir-4488 NCRO:0003242 miRBase:MIPF0001626 mir-3146 NCRO:0003243 miRBase:MIPF0001630 mir-4428 NCRO:0003244 miRBase:MIPF0001633 mir-1976 NCRO:0003245 miRBase:MIPF0001635 mir-3165 NCRO:0003246 miRBase:MIPF0001637 mir-3170 NCRO:0003247 miRBase:MIPF0001639 mir-3605 NCRO:0003248 miRBase:MIPF0001640 mir-4427 NCRO:0003249 miRBase:MIPF0001659 mir-1199 NCRO:0003250 miRBase:MIPF0001672 mir-6516 NCRO:0003251 miRBase:MIPF0001692 mir-6770 NCRO:0003252 miRBase:MIPF0001693 mir-7973 NCRO:0003253 miRBase:MIPF0001698 mir-6859 NCRO:0003254 miRBase:MIPF0001708 mir-6715 NCRO:0003255 miRBase:MIPF0001710 mir-3618 NCRO:0003256 miRBase:MIPF0001726 mir-6794 NCRO:0003257 miRBase:MIPF0001747 mir-6827 NCRO:0003258 miRBase:MIPF0001748 mir-5697 NCRO:0003259 miRBase:MIPF0001759 mir-4703 NCRO:0003260 miRBase:MIPF0001764 mir-4766 NCRO:0003261 miRBase:MIPF0001787 mir-1911 NCRO:0003262 miRBase:MIPF0001799 mir-8071 NCRO:0003263 miRBase:MIPF0001805 mir-6505 NCRO:0003264 miRBase:MIPF0001811 mir-6790 NCRO:0003265 miRBase:MIPF0001821 mir-1243 NCRO:0003266 miRBase:MIPF0001823 mir-3167 NCRO:0003267 miRBase:MIPF0001825 mir-7641 NCRO:0003268 miRBase:MIPF0001826 mir-4433 NCRO:0003269 miRBase:MIPF0001848 mir-4677 NCRO:0003270 miRBase:MIPF0001855 mir-6862 NCRO:0003271 miRBase:MIPF0001920 mir-6724 NCRO:0003272 miRBase:MIPF0001928 mir-3118 NCRO:0003273 miRBase:MIPF0001935 mir-3149 NCRO:0003274 miRBase:MIPF0001937 mir-1277 NCRO:0003275 miRBase:MIPF0001984 mir-3648 NCRO:0003276 miRBase:MIPF0001988 mir-4680 NCRO:0003277 miRBase:MIPF0002009 mir-4657 NCRO:0003278 miRBase:MIPF0002050 mir-8069 NCRO:0003279 miRBase:MIPF0002051 mir-3687 NCRO:0003280 miRBase:MIPF0002103 mir-4449 NCRO:0003281 miRBase:MIPF0002104 mir-4523 NCRO:0003282 miRBase:MIMAT0000423 hsa-miR-125b-5p NCRO:0003283 miRBase:MIMAT0004592 hsa-miR-125b-1-3p NCRO:0003284 miRBase:MIMAT0004603 hsa-miR-125b-2-3p NCRO:0004000 A non-coding RNA (ncRNA) is an RNA molecule that is not translated into a protein. Alan Ruttenberg ncRNA WEB:https://en.wikipedia.org/w/index.php?title=Non-coding_RNA&oldid=688555892#Non-coding RNA non-coding RNA NCRO:0004001 A short (20-24 nt) miRNA gene product that is derived from pre-miRNA that is exported from the nucleus and is capable of being involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs after being incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA. Alan Ruttenberg RefSeq, Sep 2009 mature miRNA NCRO:0004002 A genetic non-coding RNA is a non-coding RNA that is created by transcription in a cell Alan Ruttenberg TODO: Add axiom linking GO transcription genetic non-coding RNA NCRO:0004003 Alan Ruttenberg a RNA that is manufactured in a planned process TODO: Add axiom relating to OBI planned process and anything else from OBI that is relevant synthesized non-coding RNA NCRO:0004004 Long non-coding RNAs (long ncRNAs, lncRNA) are non-protein coding transcripts longer than 200 nucleotides. This somewhat arbitrary limit distinguishes long ncRNAs from small regulatory RNAs such as microRNAs (miRNAs), short interfering RNAs (siRNAs), Piwi-interacting RNAs (piRNAs), small nucleolar RNAs (snoRNAs), and other short RNAs Alan Ruttenberg lncRNA WEB:https://en.wikipedia.org/w/index.php?title=Long_non-coding_RNA&oldid=687562040#Long non-coding RNA Should requested and then imported from ChEBI long non-coding RNA NCRO:0004005 small interfering RNA (siRNA) is a class of double-stranded RNA molecules, 20-25 base pairs in length. siRNA plays many roles, but it is most notable in the RNA interference (RNAi) pathway, where it interferes with thes expression of specific genes with complementary nucleotide sequences. Alan Ruttenberg siRNA WEB:https://en.wikipedia.org/w/index.php?title=Special:CiteThisPage&page=Small_interfering_RNA&id=685334024#Small_interfering_RNA Should requested and then imported from ChEBI small interfering RNA NCRO:0004017 miRNA target disposition NCRO:0004018 A miRNA gene product which is capped, inside the nucleus, with a specially modified nucleotide at the 5’ end, polyadenylated with multiple adenosines (a poly(A) tail),[49][53] and spliced, forming an RNA stem-loop that in turn is part of this miRNA precursor Alan Ruttenberg Refseq, Wikipedia primary miRNA NCRO:0004019 A non-coding RNA product initially transcribed from a DNA gene, or derived from such RNA by post-transcriptional processing to become capable of forming part of a RNA silencing complex and participating in gene silencing. Alan Ruttenberg 2016-02-01: Stance on identity: pri-miNRA, pre-miRNA, and mature miRNA are disjoint. It is a process of derivation that results first from pri-miRNA to pre-miRNA then to miRNA. The identity of an miRNA gene product is determined by the molecule from which it is transcribed or derived and by its own nucleotide sequence. We have to be careful in the definitions to not undermine this position. Alan Ruttenberg miRNA gene product NCRO:0004020 A miRNA gene product cleaved from a pri-miRNA by Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor to mature miRNA, which is cleaved from the pre-miRNA by cytoplasmic Dicer ribonuclease . Alan Ruttenberg Refseq, Wikipedia pre-miRNA NCRO:0004021 An miRNA gene product from which a mature miRNA is capable of being derived. Alan Ruttenberg miRNA precursor OBI:0000047 processed material Examples include gel matrices, filter paper, parafilm and buffer solutions, mass spectrometer, tissue samples Is a material entity that is created or changed during material processing. PERSON: Alan Ruttenberg processed material OBI:0100026 organism animal fungus plant virus A material entity that is an individual living system, such as animal, plant, bacteria or virus, that is capable of replicating or reproducing, growth and maintenance in the right environment. An organism may be unicellular or made up, like humans, of many billions of cells divided into specialized tissues and organs. 10/21/09: This is a placeholder term, that should ideally be imported from the NCBI taxonomy, but the high level hierarchy there does not suit our needs (includes plasmids and 'other organisms') GROUP: OBI Biomaterial Branch WEB: http://en.wikipedia.org/wiki/Organism organism OBI:0100060 cultured cell population A processed material comprised of a collection of cultured cells that has been continuously maintained together in culture and shares a common propagation history. 2013-6-5 MHB: This OBI class was formerly called 'cell culture', but label changed and definition updated following CLO alignment efforts in spring 2013, during which the intent of this class was clarified to refer to portions of a culture or line rather than a complete cell culture or line. PERSON:Matthew Brush cell culture sample PERSON:Matthew Brush cultured cell population PR:000000001 An amino acid chain that is produced de novo by ribosome-mediated translation of a genetically-encoded mRNA. protein PR:000018263 A molecular entity that is a polymer of amino acids residues linked by peptide bonds. amino acid chain SO:0000001 A sequence_feature with an extent greater than zero. A nucleotide region is composed of bases and a polypeptide region is composed of amino acids. sequence region SO:0000002 A folded sequence. sequence secondary structure sequence_secondary_structure SO:0000018 A group of loci that can be grouped in a linear order representing the different degrees of linkage among the genes concerned. linkage group linkage_group http://en.wikipedia.org/wiki/Linkage_group SO:0000087 A gene from nuclear sequence. nuclear gene nuclear_gene http://en.wikipedia.org/wiki/Nuclear_gene SO:0000088 A gene located in mitochondrial sequence. mitochondrial gene mt gene mt_gene http://en.wikipedia.org/wiki/Mitochondrial_gene SO:0000089 A gene located in kinetoplast sequence. kinetoplast gene kinetoplast_gene SO:0000090 A gene from plastid sequence. plastid gene plastid_gene SO:0000091 A gene from apicoplast sequence. apicoplast gene apicoplast_gene SO:0000092 A gene from chloroplast sequence. chloroplast gene ct gene ct_gene SO:0000093 A gene from chromoplast_sequence. chromoplast gene chromoplast_gene SO:0000094 A gene from cyanelle sequence. cyanelle gene cyanelle_gene SO:0000095 A plastid gene from leucoplast sequence. leucoplast gene leucoplast_gene SO:0000096 A gene from proplastid sequence. proplastid gene proplastid_gene SO:0000097 A gene from nucleomorph sequence. nucleomorph gene nucleomorph_gene SO:0000098 A gene from plasmid sequence. plasmid gene plasmid_gene SO:0000099 A gene from proviral sequence. proviral gene proviral_gene SO:0000100 A proviral gene with origin endogenous retrovirus. endogenous retroviral gene endogenous_retroviral_gene SO:0000101 A transposon or insertion sequence. An element that can insert in a variety of DNA sequences. transposable element transposon transposable_element http://en.wikipedia.org/wiki/Transposable_element SO:0000104 A sequence of amino acids linked by peptide bonds which may lack appreciable tertiary structure and may not be liable to irreversible denaturation. protein polypeptide http://en.wikipedia.org/wiki/Polypeptide SO:0000108 An mRNA with a frameshift. frameshifted mRNA mRNA with frameshift mRNA_with_frameshift SO:0000110 Any extent of continuous biological sequence. located_sequence_feature sequence feature sequence_feature SO:0000111 A gene encoded within a transposable element. For example gag, int, env and pol are the transposable element genes of the TY element in yeast. transposable element gene transposable_element_gene SO:0000127 A gene that is silenced. silenced gene silenced_gene SO:0000128 A gene that is silenced by DNA modification. gene silenced by DNA modification gene_silenced_by_DNA_modification SO:0000129 A gene that is silenced by DNA methylation. gene silenced by DNA methylation methylation-silenced gene gene_silenced_by_DNA_methylation SO:0000138 An epigenetically modified gene, rearranged at the DNA level. gene rearranged at DNA level gene_rearranged_at_DNA_level SO:0000159 The point at which one or more contiguous nucleotides were excised. deleted_sequence nucleotide deletion nucleotide_deletion deletion http://en.wikipedia.org/wiki/Nucleotide_deletion loinc:LA6692-3 SO:0000167 A regulatory_region composed of the TSS(s) and binding sites for TF_complexes of the basal transcription machinery. promoter sequence promoter http://en.wikipedia.org/wiki/Promoter SO:0000169 A DNA sequence in eukaryotic DNA to which RNA polymerase I binds, to begin transcription. RNA polymerase A promoter RNApol I promoter pol I promoter polymerase I promoter RNApol_I_promoter SO:0000170 A DNA sequence in eukaryotic DNA to which RNA polymerase II binds, to begin transcription. RNA polymerase B promoter RNApol II promoter polymerase II promoter RNApol_II_promoter SO:0000171 A DNA sequence in eukaryotic DNA to which RNA polymerase III binds, to begin transcription. RNA polymerase C promoter RNApol III promoter pol III promoter polymerase III promoter RNApol_III_promoter SO:0000185 A transcript that in its initial state requires modification to be functional. precursor RNA primary transcript primary_transcript http://en.wikipedia.org/wiki/Primary_transcript SO:0000233 A transcript which has undergone the necessary modifications, if any, for its function. In eukaryotes this includes, for example, processing of introns, cleavage, base modification, and modifications to the 5' and/or the 3' ends, other than addition of bases. In bacteria functional mRNAs are usually not modified. mature transcript mature_transcript http://en.wikipedia.org/wiki/Mature_transcript SO:0000234 Messenger RNA is the intermediate molecule between DNA and protein. It includes UTR and coding sequences. It does not contain introns. messenger RNA mRNA mRNA feature http://en.wikipedia.org/wiki/MRNA SO:0000239 The sequences extending on either side of a specific region. flanking region flanking_region SO:0000276 Small, ~22-nt, RNA molecule that is the endogenous transcript of a miRNA gene (or the product of other non coding RNA genes. Micro RNAs are produced from precursor molecules (SO:0000647) that can form local hairpin structures, which ordinarily are processed (usually via the Dicer pathway) such that a single miRNA molecule accumulates from one arm of a hairpin precursor molecule. Micro RNAs may trigger the cleavage of their target molecules or act as translational repressors. micro RNA microRNA small temporal RNA stRNA Removed axiom 'derives_from some miRNA_primary_transcript' pending review of status of SO terms. Changed relation of small regulatory ncRNA (superclass) into is about relationship miRNA miRNA feature http://en.wikipedia.org/wiki/MiRNA http://en.wikipedia.org/wiki/StRNA SO:0000280 A gene that is engineered. engineered gene engineered_gene SO:0000281 A gene that is engineered and foreign. engineered foreign gene engineered_foreign_gene SO:0000282 An mRNA with a minus 1 frameshift. mRNA with minus 1 frameshift mRNA_with_minus_1_frameshift SO:0000283 A transposable_element that is engineered and foreign. engineered foreign transposable element gene engineered_foreign_transposable_element_gene SO:0000285 A gene that is foreign. foreign gene foreign_gene SO:0000287 A gene that is a fusion. fusion gene fusion_gene http://en.wikipedia.org/wiki/Fusion_gene SO:0000288 A fusion gene that is engineered. engineered fusion gene engineered_fusion_gene SO:0000296 The origin of replication; starting site for duplication of a nucleic acid molecule to give two identical copies. ori origin of replication origin_of_replication http://en.wikipedia.org/wiki/Origin_of_replication SO:0000298 recombination feature recombination_feature SO:0000307 Regions of a few hundred to a few thousand bases in vertebrate genomes that are relatively GC and CpG rich; they are typically unmethylated and often found near the 5' ends of genes. CG island CpG island CpG_island http://en.wikipedia.org/wiki/CpG_island SO:0000321 An mRNA with a plus 1 frameshift. mRNA with plus 1 frameshift mRNA_with_plus_1_frameshift SO:0000329 An mRNA with a plus 2 frameshift. mRNA with plus 2 frameshift mRNA_with_plus_2_frameshift SO:0000335 A mRNA with a minus 2 frameshift. mRNA with minus 2 frameshift mRNA_with_minus_2_frameshift SO:0000336 A sequence that closely resembles a known functional gene, at another locus within a genome, that is non-functional as a consequence of (usually several) mutations that prevent either its transcription or translation (or both). In general, pseudogenes result from either reverse transcription of a transcript of their "normal" paralog (SO:0000043) (in which case the pseudogene typically lacks introns and includes a poly(A) tail) or from recombination (SO:0000044) (in which case the pseudogene is typically a tandem duplication of its "normal" paralog). pseudogene http://en.wikipedia.org/wiki/Pseudogene SO:0000363 A transgene that is floxed. floxed gene floxed_gene SO:0000364 The region of sequence surrounding a transposable element. transposable element flanking region transposable_element_flanking_region SO:0000366 The junction where an insertion occurred. insertion site insertion_site SO:0000368 The junction in a genome where a transposable_element has inserted. transposable element insertion site transposable_element_insertion_site SO:0000370 A non-coding RNA, usually with a specific secondary structure, that acts to regulate gene expression. small regulatory ncRNA small_regulatory_ncRNA SO:0000373 A recombinationally rearranged gene by inversion. recombinationally inverted gene recombinationally_inverted_gene SO:0000376 A small (184-nt in E. coli) RNA that forms a hairpin type structure. 6S RNA associates with RNA polymerase in a highly specific manner. 6S RNA represses expression from a sigma70-dependent promoter during stationary phase. 6S RNA RNA 6S RNA_6S http://en.wikipedia.org/wiki/6S_RNA SO:0000377 An enterobacterial RNA that binds the CsrA protein. The CsrB RNAs contain a conserved motif CAGGXXG that is found in up to 18 copies and has been suggested to bind CsrA. The Csr regulatory system has a strong negative regulatory effect on glycogen biosynthesis, glyconeogenesis and glycogen catabolism and a positive regulatory effect on glycolysis. In other bacteria such as Erwinia caratovara the RsmA protein has been shown to regulate the production of virulence determinants, such extracellular enzymes. RsmA binds to RsmB regulatory RNA which is also a member of this family. CsrB RsmB RNA CsrB-RsmB RNA CsrB_RsmB_RNA SO:0000378 DsrA RNA regulates both transcription, by overcoming transcriptional silencing by the nucleoid-associated H-NS protein, and translation, by promoting efficient translation of the stress sigma factor, RpoS. These two activities of DsrA can be separated by mutation: the first of three stem-loops of the 85 nucleotide RNA is necessary for RpoS translation but not for anti-H-NS action, while the second stem-loop is essential for antisilencing and less critical for RpoS translation. The third stem-loop, which behaves as a transcription terminator, can be substituted by the trp transcription terminator without loss of either DsrA function. The sequence of the first stem-loop of DsrA is complementary with the upstream leader portion of RpoS messenger RNA, suggesting that pairing of DsrA with the RpoS message might be important for translational regulation. DsrA RNA DsrA_RNA http://en.wikipedia.org/wiki/DsrA_RNA SO:0000384 A small untranslated RNA which is induced in response to oxidative stress in Escherichia coli. Acts as a global regulator to activate or repress the expression of as many as 40 genes, including the fhlA-encoded transcriptional activator and the rpoS-encoded sigma(s) subunit of RNA polymerase. OxyS is bound by the Hfq protein, that increases the OxyS RNA interaction with its target messages. OxyS RNA OxyS_RNA http://en.wikipedia.org/wiki/OxyS_RNA SO:0000387 Translational regulation of the stationary phase sigma factor RpoS is mediated by the formation of a double-stranded RNA stem-loop structure in the upstream region of the rpoS messenger RNA, occluding the translation initiation site. Clones carrying rprA (RpoS regulator RNA) increased the translation of RpoS. The rprA gene encodes a 106 nucleotide regulatory RNA. As with DsrA Rfam:RF00014, RprA is predicted to form three stem-loops. Thus, at least two small RNAs, DsrA and RprA, participate in the positive regulation of RpoS translation. Unlike DsrA, RprA does not have an extensive region of complementarity to the RpoS leader, leaving its mechanism of action unclear. RprA is non-essential. RprA RNA RprA_RNA http://en.wikipedia.org/wiki/RprA_RNA SO:0000388 The Rev response element (RRE) is encoded within the HIV-env gene. Rev is an essential regulatory protein of HIV that binds an internal loop of the RRE leading, encouraging further Rev-RRE binding. This RNP complex is critical for mRNA export and hence for expression of the HIV structural proteins. RRE RNA RRE_RNA SO:0000389 A 109-nucleotide RNA of E. coli that seems to have a regulatory role on the galactose operon. Changes in Spot 42 levels are implicated in affecting DNA polymerase I levels. spot-42 RNA spot_42_RNA http://en.wikipedia.org/wiki/Spot_42_RNA SO:0000409 A biological_region of sequence that, in the molecule, interacts selectively and non-covalently with other molecules. A region on the surface of a molecule that may interact with another molecule. When applied to polypeptides: Amino acids involved in binding or interactions. It can also apply to an amino acid bond which is represented by the positions of the two flanking amino acids. binding_or_interaction_site binding_site http://en.wikipedia.org/wiki/Binding_site SO:0000451 A gene that encodes a polyadenylated mRNA. gene with polyadenylated mRNA gene_with_polyadenylated_mRNA SO:0000455 A gene that encodes an mRNA with a frameshift. gene with mRNA with frameshift gene_with_mRNA_with_frameshift SO:0000456 A gene that is recombinationally rearranged. recombinationally rearranged gene recombinationally_rearranged_gene SO:0000459 A gene with a transcript that is trans-spliced. gene with trans spliced transcript gene_with_trans_spliced_transcript SO:0000462 A non-functional descendant of a functional entity. pseudogenic region pseudogenic_region SO:0000483 A primary transcript that is never translated into a protein. nc primary transcript noncoding primary transcript nc_primary_transcript SO:0000548 A gene that encodes a transcript that is edited. gene with edited transcript gene_with_edited_transcript SO:0000568 An unregulated promoter that allows continuous expression. bidirectional promoter bidirectional_promoter SO:0000581 A structure consisting of a 7-methylguanosine in 5'-5' triphosphate linkage with the first nucleotide of an mRNA. It is added post-transcriptionally, and is not encoded in the DNA. cap http://en.wikipedia.org/wiki/5%27_cap SO:0000584 A tmRNA liberates a mRNA from a stalled ribosome. To accomplish this part of the tmRNA is used as a reading frame that ends in a translation stop signal. The broken mRNA is replaced in the ribosome by the tmRNA and translation of the tmRNA leads to addition of a proteolysis tag to the incomplete protein enabling recognition by a protease. Recently a number of permuted tmRNAs genes have been found encoded in two parts. TmRNAs have been identified in eubacteria and some chloroplasts but are absent from archeal and Eukaryote nuclear genomes. tmRNA http://en.wikipedia.org/wiki/TmRNA SO:0000605 A region containing or overlapping no genes that is bounded on either side by a gene, or bounded by a gene and the end of the chromosome. intergenic region intergenic_region http://en.wikipedia.org/wiki/Intergenic_region SO:0000609 The string of non-encoded U's at the 3' end of a guide RNA (SO:0000602). oligo U tail oligo_U_tail SO:0000610 Sequence of about 100 nucleotides of A added to the 3' end of most eukaryotic mRNAs. polyA sequence polyA_sequence SO:0000613 A DNA sequence to which bacterial RNA polymerase binds, to begin transcription. bacterial RNApol promoter bacterial_RNApol_promoter SO:0000617 RNApol III promoter type 1 RNApol_III_promoter_type_1 SO:0000618 RNApol III promoter type 2 RNApol_III_promoter_type_2 SO:0000621 RNApol III promoter type 3 RNApol_III_promoter_type_3 SO:0000627 A transcriptional cis regulatory region that when located between a CM and a gene's promoter prevents the CRM from modulating that genes expression. insulator element insulator http://en.wikipedia.org/wiki/Insulator_(genetics) SO:0000633 An mRNA with either a single protein product, or for which the regions encoding all its protein products overlap. monocistronic mRNA monocistronic processed transcript monocistronic_mRNA http://en.wikipedia.org/wiki/Monocistronic_mRNA SO:0000634 An mRNA that encodes multiple proteins from at least two non-overlapping regions. polycistronic mRNA polycistronic_mRNA http://en.wikipedia.org/wiki/Polycistronic_mRNA SO:0000647 A primary transcript encoding a micro RNA. miRNA primary transcript micro RNA primary transcript small temporal RNA primary transcript stRNA primary transcript stRNA_primary_transcript miRNA_primary_transcript SO:0000654 A mitochondrial gene located in a maxicircle. maxi-circle gene maxicircle gene maxicircle_gene SO:0000655 An RNA transcript that does not encode for a protein rather the RNA molecule is the gene product. noncoding RNA ncRNA ncRNA feature http://en.wikipedia.org/wiki/NcRNA SO:0000657 A region of sequence containing one or more repeat units. repeat region repeat_region SO:0000667 The sequence of one or more nucleotides added between two adjacent nucleotides in the sequence. insertion nucleotide insertion nucleotide_insertion insertion loinc:LA6687-3 SO:0000673 An RNA synthesized on a DNA or RNA template by an RNA polymerase. transcript http://en.wikipedia.org/wiki/RNA SO:0000690 A gene that encodes a polycistronic transcript. gene with polycistronic transcript gene_with_polycistronic_transcript SO:0000692 A gene that encodes a dicistronic transcript. gene with dicistronic transcript gene_with_dicistronic_transcript SO:0000693 A gene that encodes an mRNA that is recoded. gene with recoded mRNA gene_with_recoded_mRNA SO:0000697 A gene that encodes a transcript with stop codon readthrough. gene with stop codon read through gene_with_stop_codon_read_through SO:0000698 A gene encoding an mRNA that has the stop codon redefined as pyrrolysine. gene with stop codon redefined as pyrrolysine gene_with_stop_codon_redefined_as_pyrrolysine SO:0000699 A sequence_feature with an extent of zero. boundary breakpoint junction SO:0000704 A region (or regions) that includes all of the sequence elements necessary to encode a functional transcript. A gene may include regulatory regions, transcribed regions and/or other functional sequence regions. gene http://en.wikipedia.org/wiki/Gene SO:0000710 A gene encoding an mRNA that has the stop codon redefined as selenocysteine. gene with stop codon redefined as selenocysteine gene_with_stop_codon_redefined_as_selenocysteine SO:0000711 A gene with mRNA recoded by translational bypass. gene with mRNA recoded by translational bypass gene_with_mRNA_recoded_by_translational_bypass SO:0000712 A gene encoding a transcript that has a translational frameshift. gene with transcript with translational frameshift gene_with_transcript_with_translational_frameshift SO:0000716 An mRNA that has the quality dicistronic. dicistronic mRNA dicistronic_mRNA SO:0000720 A transposable element that is foreign. foreign transposable element foreign_transposable_element SO:0000721 A gene that encodes a dicistronic primary transcript. gene with dicistronic primary transcript gene_with_dicistronic_primary_transcript SO:0000722 A gene that encodes a polycistronic mRNA. gene with dicistronic mRNA gene with dicistronic processed transcript gene_with_dicistronic_mRNA SO:0000726 The simplest repeated component of a repeat region. A single repeat. repeat unit repeat_unit http://www.ebi.ac.uk/embl/Documentation/FT_definitions/feature_table.html SO:0000727 A regulatory region where transcription factor binding sites clustered to regulate various aspects of transcription activities. (CRMs can be located a few kb to hundred kb upstream of the basal promoter, in the coding sequence, within introns, or in the downstream 3'UTR sequences, as well as on different chromosome). A single gene can be regulated by multiple CRMs to give precise control of its spatial and temporal expression. CRMs function as nodes in large, intertwined regulatory network. TF module cis regulatory module transcription factor module CRM SO:0000734 An exemplar is a representative cDNA sequence for each gene. The exemplar approach is a method that usually involves some initial clustering into gene groups and the subsequent selection of a representative from each gene group. exemplar mRNA exemplar_mRNA SO:0000771 A quantitative trait locus (QTL) is a polymorphic locus which contains alleles that differentially affect the expression of a continuously distributed phenotypic trait. Usually it is a marker described by statistical association to quantitative variation in the particular phenotypic trait that is thought to be controlled by the cumulative action of alleles at multiple loci. quantitative trait locus QTL SO:0000797 TE that exists (or existed) in nature. natural transposable element natural_transposable_element SO:0000798 TE that has been modified by manipulations in vitro. engineered transposable element engineered_transposable_element SO:0000816 A gene that rescues. rescue gene rescue_gene SO:0000818 A gene that rescues. wild type rescue gene wild_type_rescue_gene SO:0000830 A region of a chromosome. chromosome part chromosome_part SO:0000831 A region of a gene. gene member region gene_member_region SO:0000833 A region of a transcript. transcript region transcript_region SO:0000839 Biological sequence region that can be assigned to a specific subsequence of a polypeptide. polypeptide_region SO:0000842 gene component region gene_component_region SO:0000862 An mRNA that is capped. capped mRNA capped_mRNA SO:0000871 An mRNA that is polyadenylated. polyadenylated mRNA polyadenylated_mRNA SO:0000872 An mRNA that is trans-spliced. trans-spliced mRNA trans_spliced_mRNA SO:0000888 A gene that is maternally_imprinted. maternally imprinted gene maternally_imprinted_gene SO:0000889 A gene that is paternally imprinted. paternally imprinted gene paternally_imprinted_gene SO:0000890 A gene that is post translationally regulated. post translationally regulated gene post_translationally_regulated_gene SO:0000891 A gene that is negatively autoreguated. negatively autoregulated gene negatively_autoregulated_gene SO:0000892 A gene that is positively autoregulated. positively autoregulated gene positively_autoregulated_gene SO:0000896 A gene that is translationally regulated. translationally regulated gene translationally_regulated_gene SO:0000897 A gene that is allelically_excluded. allelically excluded gene allelically_excluded_gene SO:0000898 A gene that is epigenetically modified. epigenetically modified gene epigenetically_modified_gene SO:0000902 A transgene is a gene that has been transferred naturally or by any of a number of genetic engineering techniques from one organism to another. transgene http://en.wikipedia.org/wiki/Transgene SO:0000929 An mRNA that is edited. edited mRNA edited_mRNA SO:0000941 A recombinationally rearranged gene of the vertebrate immune system. recombinationally rearranged vertebrate immune system gene recombinationally_rearranged_vertebrate_immune_system_gene SO:0000975 minicircle gene minicircle_gene SO:0000995 consensus mRNA consensus_mRNA SO:0000996 predicted gene predicted_gene SO:0001037 A nucleotide region with either intra-genome or intracellular mobility, of varying length, which often carry the information necessary for transfer and recombination with the host genome. MGE mobile genetic element mobile_genetic_element http://en.wikipedia.org/wiki/Mobile_genetic_element SO:0001055 A regulatory_region that modulates the transcription of a gene or genes. transcription-control region transcriptional cis regulatory region transcriptional_cis_regulatory_region SO:0001058 A transcriptional_cis_regulatory_region that restricts the activity of a CRM to a single promoter and which functions only when both itself and an insulator are located between the CRM and the promoter. promoter targeting sequence promoter_targeting_sequence SO:0001203 A region (DNA) to which RNA polymerase binds, to begin transcription. RNA polymerase promoter RNA_polymerase_promoter SO:0001204 A region (DNA) to which Bacteriophage RNA polymerase binds, to begin transcription. Phage RNA Polymerase Promoter Phage_RNA_Polymerase_Promoter SO:0001205 A region (DNA) to which the SP6 RNA polymerase binds, to begin transcription. SP6 RNA Polymerase Promoter SP6_RNA_Polymerase_Promoter SO:0001206 A DNA sequence to which the T3 RNA polymerase binds, to begin transcription. T3 RNA Polymerase Promoter T3_RNA_Polymerase_Promoter SO:0001207 A region (DNA) to which the T7 RNA polymerase binds, to begin transcription. T7 RNA Polymerase Promoter T7_RNA_Polymerase_Promoter SO:0001217 protein coding gene protein_coding_gene SO:0001219 retrogene SO:0001224 A gene that is silenced by RNA interference. RNA interference silenced gene RNAi silenced gene gene silenced by RNA interference gene_silenced_by_RNA_interference SO:0001225 A gene that is silenced by histone modification. gene silenced by histone modification gene_silenced_by_histone_modification SO:0001226 A gene that is silenced by histone methylation. gene silenced by histone methylation gene_silenced_by_histone_methylation SO:0001227 A gene that is silenced by histone deacetylation. gene silenced by histone deacetylation gene_silenced_by_histone_deacetylation SO:0001235 A region containing at least one unique origin of replication and a unique termination site. replicon http://en.wikipedia.org/wiki/Replicon_(genetics) SO:0001236 A base is a sequence feature that corresponds to a single unit of a nucleotide polymer. base http://en.wikipedia.org/wiki/Nucleobase SO:0001237 A sequence feature that corresponds to a single amino acid residue in a polypeptide. amino acid amino_acid http://en.wikipedia.org/wiki/Amino_acid SO:0001263 ncRNA gen ncRNA gene ncRNA_gene SO:0001264 gRNA gene gRNA_gene SO:0001265 miRNA gene stRNA gene stRNA_gene miRNA_gene SO:0001266 scRNA gene scRNA_gene SO:0001267 snoRNA gene snoRNA_gene SO:0001268 snRNA gene snRNA_gene SO:0001269 SRP RNA gene SRP_RNA_gene SO:0001271 tmRNA gene tmRNA_gene SO:0001272 tRNA gene tRNA_gene SO:0001411 A region defined by its disposition to be involved in a biological process. biological region biological_region SO:0001412 A region that is defined according to its relations with other regions within the same sequence. topologically defined region topologically_defined_region SO:0001431 A gene that is not transcribed under normal conditions and is not critical to normal cellular functioning. cryptic gene cryptic_gene SO:0001637 A gene that encodes for ribosomal RNA. rDNA rRNA gene rRNA_gene SO:0001638 A gene that encodes for an piwi associated RNA. piRNA gene piRNA_gene SO:0001639 A gene that encodes an RNase P RNA. RNase P RNA gene RNase_P_RNA_gene SO:0001640 A gene that encodes a RNase_MRP_RNA. RNase_MRP_RNA_gene SO:0001641 A gene that encodes large intervening non-coding RNA. lincRNA gene lincRNA_gene SO:0001643 A telomerase RNA gene is a non coding RNA gene the RNA product of which is a component of telomerase. TERC Telomerase RNA component telomerase RNA gene telomerase_RNA_gene http:http://en.wikipedia.org/wiki/Telomerase_RNA_component SO:0001645 A measurable sequence feature that varies within a population. genetic_marker SO:0001669 The minimal portion of the promoter required to properly initiate transcription in RNA polymerase II transcribed genes. RNApol II core promoter RNApol_II_core_promoter SO:0001671 bacterial RNA polymerase promoter sigma 70 bacterial_RNApol_promoter_sigma_70 SO:0001672 bacterial RNA polymerase promoter sigma54 bacterial_RNApol_promoter_sigma54 SO:0001679 A regulatory region that is involved in the control of the process of transcription. transcription regulatory region transcription_regulatory_region SO:0001683 A sequence motif is a nucleotide or amino-acid sequence pattern that may have biological significance. sequence_motif http://en.wikipedia.org/wiki/Sequence_motif SO:0001687 The nucleotide region (usually a palindrome) that is recognized by a restriction enzyme. This may or may not be equal to the restriction enzyme binding site. restriction endonuclease recognition site restriction enzyme recognition site restriction_enzyme_recognition_site SO:0001695 A terminal region of DNA sequence where the end of the region is not blunt ended. single strand overhang restriction_enzyme_single_strand_overhang SO:0001715 An ISRE is a transcriptional cis regulatory region, containing the consensus region: YAGTTTC(A/T)YTTTYCC, responsible for increased transcription via interferon binding. interferon stimulated response element ISRE SO:0001720 A biological region implicated in inherited changes caused by mechanisms other than changes in the underlying DNA sequence. epigenetically_modified_region SO:0001739 A gene with a start codon other than AUG. gene with non canonical start codon gene_with_non_canonical_start_codon SO:0001740 A gene with a translational start codon of CUG. gene with start codon CUG gene_with_start_codon_CUG SO:0001747 A DNA sequence that in the normal state of the chromosome corresponds to an unfolded, un-complexed stretch of double-stranded DNA. open chromatin region open_chromatin_region SO:0001867 A gene suspected of being involved in the expression of a trait. candidate gene target gene candidate_gene SO:0001868 A candidate gene whose association with a trait is based on the gene's location on a chromosome. positional candidate gene positional_candidate_gene SO:0001869 A candidate gene whose function has something in common biologically with the trait under investigation. functional candidate gene functional target gene functional_candidate_gene SO:0001872 A region of a chromosome, where the chromosome has undergone a large structural rearrangement that altered the genome organization. There is no longer synteny to the reference genome. rearrangement region rearrangement_region SO:0001896 A CDS that is part of a transposable element. transposable element CDS transposable_element_CDS SO:0001897 A pseudogene contained within a transposable element. transposable element pseudogene transposable_element_pseudogene SO:0001913 A bacterial promoter with sigma ecf factor binding dependency. This is a type of bacterial promoters that requires a sigma ECF factor to bind to identified -10 and -35 sequence regions in order to mediate binding of the RNA polymerase to the promoter region as part of transcription initiation. bacterial RNApol promoter sigma ecf bacterial_RNApol_promoter_sigma_ecf SO:0005836 A region of sequence that is involved in the control of a biological process. regulatory region regulatory_region http://en.wikipedia.org/wiki/Regulatory_region SO:0005853 A gene that can be substituted for a related gene at a different site in the genome. gene cassette gene_cassette http://en.wikipedia.org/wiki/Gene_cassette SO:0005855 A collection of related genes. gene group gene_group SO:1000002 A sequence alteration where the length of the change in the variant is the same as that of the reference. substitution loinc:LA6690-7 SO:1000036 A continuous nucleotide sequence is inverted in the same position. inversion inversion loinc:LA6689-9 SO:1001196 A maxicircle gene so extensively edited that it cannot be matched to its edited mRNA sequence. cryptogene SO:1001261 The sequence of a mature mRNA transcript, modified before translation or during translation, usually by special cis-acting signals. recoded mRNA recoded_mRNA SO:1001264 A recoded_mRNA where translation was suspended at a particular codon and resumed at a particular non-overlapping downstream codon. mRNA recoded by translational bypass mRNA_recoded_by_translational_bypass SO:1001265 A recoded_mRNA that was modified by an alteration of codon meaning. mRNA recoded by codon redefinition mRNA_recoded_by_codon_redefinition SO:1001275 Sequence coding for a short, single-stranded, DNA sequence via a retrotransposed RNA intermediate; characteristic of some microbial genomes. retron UBERON:0000061 Material anatomical entity that is a single connected structure with inherent 3D shape generated by coordinated expression of the organism's own genome. biological structure connected biological structure anatomical structure AAO:0010825 AEO:0000003 BILA:0000003 CARO:0000003 EHDAA2:0003003 EMAPA:0 FBbt:00007001 FMA:67135 GAID:781 HAO:0000003 MA:0003000 MESH:D000825 TAO:0000037 TGMA:0001823 VHOG:0001759 WBbt:0000100 XAO:0003000 ZFA:0000037 UBERON:0000062 Anatomical structure that performs a specific function or group of functions [WP]. organ CARO:0020004 EFO:0000634 EMAPA:35949 ENVO:01000162 FMA:67498 MA:0003001 OpenCyc:Mx4rv5XMb5wpEbGdrcN5Y29ycA OpenCyc:Mx4rwP3iWpwpEbGdrcN5Y29ycA UMLS:C0178784 WBbt:0003760 UBERON:0000465 Anatomical entity that has mass. material anatomical entity AAO:0010264 AEO:0000006 BILA:0000006 CARO:0000006 EHDAA2:0003006 FBbt:00007016 FMA:67165 HAO:0000006 TAO:0001836 TGMA:0001826 VHOG:0001721 UBERON:0000479 Multicellular anatomical structure that consists of many cells of one or a few types, arranged in an extracellular matrix such that their long-range organisation is at least partly a repetition of their short-range organisation. portion of tissue tissue portion tissue AAO:0000607 AAO:0010054 AEO:0000043 BILA:0000043 CALOHA:TS-2090 CARO:0000043 EHDAA2:0003043 EMAPA:35868 FBbt:00007003 FMA:9637 HAO:0000043 MA:0003002 MESH:D014024 TAO:0001477 TGMA:0001844 UMLS:C0040300 VHOG:0001757 WBbt:0005729 XAO:0003040 ZFA:0001477 galen:Tissue oboInOwl:DbXref oboInOwl:Definition oboInOwl:Subset oboInOwl:Synonym oboInOwl:SynonymType owl:Thing example to be eventually removed The term was used in an attempt to structure part of the ontology but in retrospect failed to do a good job Person:Alan Ruttenberg failed exploratory term Class has all its metadata, but is either not guaranteed to be in its final location in the asserted IS_A hierarchy or refers to another class that is not complete. metadata complete term created to ease viewing/sort terms for development purpose, and will not be included in a release organizational term Class has undergone final review, is ready for use, and will be included in the next release. Any class lacking "ready_for_release" should be considered likely to change place in hierarchy, have its definition refined, or be obsoleted in the next release. Those classes deemed "ready_for_release" will also derived from a chain of ancestor classes that are also "ready_for_release." ready for release Class is being worked on; however, the metadata (including definition) are not complete or sufficiently clear to the branch editors. metadata incomplete Nothing done yet beyond assigning a unique class ID and proposing a preferred term. uncurated All definitions, placement in the asserted IS_A hierarchy and required minimal metadata are complete. The class is awaiting a final review by someone other than the term editor. pending final vetting Core is an instance of a grouping of terms from an ontology or ontologies. It is used by the ontology to identify main classes. PERSON: Alan Ruttenberg PERSON: Melanie Courtot core placeholder removed An editor note should explain what were the merged terms and the reason for the merge. terms merged This is to be used when the original term has been replaced by a term imported from an other ontology. An editor note should indicate what is the URI of the new term to use. term imported This is to be used when a term has been split in two or more new terms. An editor note should indicate the reason for the split and indicate the URIs of the new terms created. term split Hard to give a definition for. Intuitively a "natural kind" rather than a collection of any old things, which a class is able to be, formally. At the meta level, universals are defined as positives, are disjoint with their siblings, have single asserted parents. Alan Ruttenberg A Formal Theory of Substances, Qualities, and Universals, http://ontology.buffalo.edu/bfo/SQU.pdf universal A defined class is a class that is defined by a set of logically necessary and sufficient conditions but is not a universal "definitions", in some readings, always are given by necessary and sufficient conditions. So one must be careful (and this is difficult sometimes) to distinguish between defined classes and universal. Alan Ruttenberg defined class A named class expression is a logical expression that is given a name. The name can be used in place of the expression. named class expressions are used in order to have more concise logical definition but their extensions may not be interesting classes on their own. In languages such as OWL, with no provisions for macros, these show up as actuall classes. Tools may with to not show them as such, and to replace uses of the macros with their expansions Alan Ruttenberg named class expression Terms with this status should eventually replaced with a term from another ontology. Alan Ruttenberg group:OBI to be replaced with external ontology term A term that is metadata complete, has been reviewed, and problems have been identified that require discussion before release. Such a term requires editor note(s) to identify the outstanding issues. Alan Ruttenberg group:OBI requires discussion Person:Alan Ruttenberg x precedes y if and only if the time point at which x ends is before or equivalent to the time point at which y starts. Formally: x precedes y iff ω(x) <= α(y), where α is a function that maps a process to a start point, and ω is a function that maps a process to an end point. precedes To say that each spatiotemporal region s temporally_projects_onto some temporal region t is to say that t is the temporal extension of s. (axiom label in BFO2 Reference: [080-003]) To say that spatiotemporal region s spatially_projects_onto spatial region r at t is to say that r is the spatial extent of s at t. (axiom label in BFO2 Reference: [081-003]) To say that each spatiotemporal region s temporally_projects_onto some temporal region t is to say that t is the temporal extension of s. (axiom label in BFO2 Reference: [080-003]) To say that spatiotemporal region s spatially_projects_onto spatial region r at t is to say that r is the spatial extent of s at t. (axiom label in BFO2 Reference: [081-003]) This document is about information artifacts and their representations is_about is a (currently) primitive relation that relates an information artifact to an entity. person:Alan Ruttenberg Smith, Ceusters, Ruttenberg, 2000 years of philosophy is about He_Zhang 2015-05-16T19:28:03Z is_about_grouped_miRNA is_about_miRNA is_about_miRNA_target_gene He_Zhang 2015-05-16T19:27:05Z is_classified_into_gene_family_group is_gene_template_of_mRNA is_model_of_disease miRNA_expressed_in_tissue regulate_mRNA_translation a relation between an independent continuant (the bearer) and a specifically dependent continuant (the dependent), in which the dependent specifically depends on the bearer for its existence bearer_of is bearer of bearer of a relation between a continuant and a process, in which the continuant is somehow involved in the process participates_in participates in a relation between a process and a continuant, in which the continuant is somehow involved in the process has_participant has participant a relation between two distinct material entities, the new entity and the old entity, in which the new entity begins to exist when the old entity ceases to exist, and the new entity inherits the significant portion of the matter of the old entity derives_from derives from x only in taxon y if and only if x is in taxon y, and there is no other organism z such that y!=z a and x is in taxon z. Chris Mungall only in taxon BFO 2 Reference: BFO does not claim to provide complete coverage of entities of all types. It seeks only to provide coverage of those entities studied by empirical science together with those entities which affect or are involved in human activities such as data processing and planning - coverage that is sufficiently broad to provide assistance to those engaged in building domain ontologies for purposes of data annotation. BFO 2 Reference: BFO's treatment of continuants and occurrents - as also its treatment of regions, rests on a dichotomy between space and time, and on the view that there are two perspectives on reality - earlier called the 'SNAP' and 'SPAN' perspectives, both of which are essential to the non-reductionist representation of reality as we understand it from the best available science. BFO 2 Reference: For both terms and relational expressions in BFO, we distinguish between primitive and defined. 'Entity' is an example of a primitive term. Primitive terms in a highest-level ontology such as BFO are terms that are so basic to our understanding of reality that there is no way of defining them in a non-circular fashion. For these, therefore, we can provide only elucidations, supplemented by examples and by axioms. Alan Ruttenberg Albert Goldfain Barry Smith Bill Duncan Bjoern Peters Chris Mungall David Osumi-Sutherland Fabian Neuhaus Holger Stenzhorn James A. Overton Janna Hastings Jie Zheng Jonathan Bona Larry Hunter Leonard Jacuzzo Ludger Jansen Mark Ressler Mathias Brochhausen Mauricio Almeida Melanie Courtot Pierre Grenon Randall Dipert Ron Rudnicki Selja Seppälä Stefan Schulz Thomas Bittner Werner Ceusters Yongqun "Oliver" He Please see the project site https://github.com/BFO-ontology/BFO, the bfo2 owl discussion group http://groups.google.com/group/bfo-owl-devel, the bfo2 discussion group http://groups.google.com/group/bfo-devel, the tracking google doc http://goo.gl/IlrEE, and the current version of the bfo2 reference http://purl.obolibrary.org/obo/bfo/dev/bfo2-reference.docx. This ontology is generated from a specification at https://github.com/BFO-ontology/BFO/tree/master/src/ontology/owl-group/specification/ and with the code that generates the OWL version in https://github.com/BFO-ontology/BFO/tree/master/src/tools/. A very early version of BFO version 2 in CLIF is at http://purl.obolibrary.org/obo/bfo/dev/bfo.clif. The BSD license on the BFO project site refers to code used to build BFO. This BFO 2.0 version represents a major update to BFO and is not strictly backwards compatible with BFO 1.1. The previous OWL version of BFO, version 1.1.1 will remain available at http://ifomis.org/bfo/1.1 and will no longer be updated. The BFO 2.0 OWL is a classes-only specification. The incorporation of core relations has been held over for a later version. Alan Ruttenberg Alan Ruttenberg Asiyah Yu Lin Harrison Strachan He Zhang Jingshan Huang 2015-12-10 December 2015: This ontology is currently undergoing changes. ID deprecation policies will start in the next couple of months. In the mean time, identifiers may be deleted and not marked obsolete. This is the release of December 12, 2015. It will always be available at http://purl.obolibrary.org/ncro/2015-12-10/ncro.owl. While current, this ontology is also available at http://purl.obolibrary.org/obo/ncro.owl This file is a merge of NCRO and any imported ontologies or terms. You can access the ontology that existed before the merge, with imports intact, at http://purl.obolibrary.org/obo/ncro/YYYY-MM-DD/ncro.owl or, for the current version, http://purl.obolibrary.org/obo/ncro/prebuild/ncro.owl This ontology is currently undergoing changes. ID deprecation policies will start in the next couple of months. In the mean time, identifiers may be deleted and not marked obsolete. d en Adam Goldstein Alan Ruttenberg Albert Goldfain Barry Smith Bjoern Peters Carlo Torniai Chris Mungall Chris Stoeckert Christian A. Boelling Darren Natale David Osumi-Sutherland Gwen Frishkoff Holger Stenzhorn James A. Overton James Malone Jennifer Fostel Jie Zheng Jonathan Rees Larisa Soldatova Lawrence Hunter Mathias Brochhausen Matt Brush Melanie Courtot Michel Dumontier Paolo Ciccarese Pat Hayes Philippe Rocca-Serra Randy Dipert Ron Rudnicki Satya Sahoo Sivaram Arabandi Werner Ceusters William Duncan William Hogan Yongqun (Oliver) He