Chi Zhang, West China Hospital, Sichuan University, China Bairong Shen, West China Hospital, Sichuan University, China English Sepsis Ontology (SO) The Sepsis Ontology (SEPON) is a disease-specific ontology that defines the concepts and relationships between concepts in the field of sepsis and related diseases, contributing to data standardization and providing precise and personalized diagnosis, treatment and prognosis recommandations for sepsis. V1.0.0 Caused By A relationship between a condition (a phenotype or disease) and an entity (e.g. environment) or condition (phenotype or disease) which could be an existing condition or an event, where the entity or second condition has a causal role for the condition being described. http://purl.obolibrary.org/obo/SCDO_1000202 Caused_By Differential_Diagnosis Differential_Diagnosis Drug_Target drug has protein target An object property that represents a relation between a drug and a protein where the drug can target the protein. http://purl.obolibrary.org/obo/CIDO_0000124 Drug_Target Has_Complication Has_Complication Has_Diagnostic_Biomarker Has_Diagnostic_Biomarker Has_Diagnostic_Imaging Has_Diagnostic_Imaging Has_Disease Has_Disease Has_Drug Has_Drug Has_Prognostic_Biomarker Has_Prognostic_Biomarker Has_Surgery Has_Surgery Has_Symptom Has_Symptom Is_Part_Of Is_Part_Of Protein_Protein_Interaction PPI Protein_Protein_Interaction Related_Gene_Is Related_Gene_Is Resulted in Prolongation of Hospitalization Resulted in prolongation of hospitalization An indication or description that an extended period of hospitalization is necessary. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C102450 Resulted in Prolongation of Hospitalization Superficial Lymph Node Distant Lymph Node Physical Condition Individual Physical Condition The physical condition of an individual. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C106492 Individual Physical Condition Branch Duct A small duct that originates from the main duct. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C113668 Branch Duct Tracheobronchial Tree TRACHEOBRONCHIAL TREE An anatomical structure comprising of trachea, bronchi, and bronchioles that terminate with the alveolar ducts, sacs, and alveoli. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C117875 Tracheobronchial Tree Reactive Amniocyte Reactive Amniocytes Proliferation and aggregation of amniocytes due to a meconium exposure. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C118138 Reactive Amniocyte Structural Modifier STRUCTURAL MODIFICATION Chemical Modification A molecule that binds to a macromolecule and can change the structural properties of that macromolecule. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C118425 Structural Modifier HEART, VENTRICULAR WALL Ventricular Wall of the Heart The tissue layers that form the cardiac ventricle. They include the endocardium, myocardium and pericardium. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C119295 Ventricular Wall of the Heart Oculus Dexter (Right Eye) Oculus Dexter OD Right Eye The eye positioned in the right orbit. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C119333 Right Eye Oculus Sinister Oculus Sinister (Left Eye) Left Eye OS The eye positioned in the left orbit. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C119334 Left Eye Oculus Uterque Oculus Uterque (Both Eyes) Both Eyes OU Of or pertaining to both the left and right eyes, http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C119335 Both Eyes INTERSTITIAL FLUID Interstitial Fluid The extracellular fluid component found in the spaces between tissues. This excludes plasma and transcellular fluid. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C120839 Interstitial Fluid Cardiophrenic Lymph Node Anatomic Structure, System, or Substance Anatomic Structures and Systems A human biological structure, fluid or other substance. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12219 Anatomic Structure, System, or Substance Canal of Wirsung pancreatic duct Pancreatic Duct Pancreatic duct PANCREATIC DUCT Main Pancreatic Duct A duct joining the pancreas to the common bile duct to supply pancreatic juices. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12272 Pancreatic Duct EPIDIDYMIS Epididymal Epididymis epididymis A crescent-like structure located in the upper and posterior surfaces of the testis. It consists of the efferent ductules and the duct of the epididymis. It facilitates the maturation of sperm that is produced in the testis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12328 Epididymis Spermatic Cord spermatic cord Spermatic cord testicular cord A tube-like structure composed of the vas deferens and surrounding tissue layers, that runs from the abdomen to each of the testicles. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12329 Spermatic Cord Urethral Gland Urethra Gland Any of the glands that secrete mucus into the urethra including the Cowper, Skene, and Littre glands. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12339 Urethral Gland lacrimal-preorbital gland glandula lacrimalis GLAND, LACRIMAL Lacrimal Gland Lacrimal gland lacrimal gland Lacrimal gland structure (body structure) LACRIMAL GLAND Paired, almond-shaped exocrine glands situated superior and posterior to each orbit of the eye that produce and secrete the watery serous component of tears. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12346 Lacrimal Gland Orbital Cavity BODY CAVITY, ORBITAL Ocular Orbit Ocular Orbits Ocular orbits Structure of orbit proper (body structure) Eye Socket ORBIT Orbit Orbit, NOS The bony cavity of the skull which contains the eye, anterior portion of the optic nerve, ocular muscles and ocular adnexa. Seven bones contribute to the structure of the orbit: the frontal, maxillary, zygomatic, sphenoid, lacrimal, ethmoid, and palatine bones. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12347 Orbit Mammary Gland GLAND, MAMMARY MAMMARY GLAND mammary gland In humans, the glands of the breast, consisting of fibrous tissue connecting the lobes and fatty tissue in between the lobes. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12367 Mammary Gland BILE DUCT Bile Duct DUCT, BILE bile duct Any of the ducts conveying bile between the liver and the intestine, including hepatic, cystic, and common bile duct. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12376 Bile Duct Gastrointestinal Tract, Gall Bladder gallbladder Gallbladder / Biliar gall bladder Gallbladder structure (body structure) Gallbladder GALLBLADDER cholecyst A pear-shaped organ located under the liver that stores and concentrates bile secreted by the liver. From the gallbladder the bile is delivered through the bile ducts into the intestine thereby aiding the digestion of fat-containing foods. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12377 Gallbladder Esophagus, NOS Gastrointestinal Tract, Esophagus Esophageal structure (body structure) ESOPHAGUS Esophagus Oesophagus esophagus gullet The portion of the digestive canal between the pharynx and stomach. It is about 25 cm long and consists of three parts: the cervical part, from the cricoid cartilage to the thoracic inlet; thoracic part, from thoracic inlet to the diaphragm; and abdominal part, below the diaphragm to the cardiac opening of the stomach. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12389 Esophagus Gastrointestinal Tract, Stomach Stomach, NOS Stomach structure (body structure) Gastric STOMACH Stomach stomach The primary organ of food digestion. It is located under the diaphragm, between the liver and the spleen as well as between the esophagus and the small intestine. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12391 Stomach Gastrointestinal Tract, Liver Hepatic Body System Liver structure (body structure) Hepatic Organ System Organ System, Hepatic Body System, Hepatic LIVER Liver liver A triangular-shaped organ located under the diaphragm in the right hypochondrium. It is the largest internal organ of the body, weighting up to 2 kg. Metabolism and bile secretion are its main functions. It is composed of cells which have the ability to regenerate. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12392 Liver Pancreas, NOS Pancreatic structure (body structure) Gastrointestinal Tract, Pancreas PANCREAS Pancreas pancreas An organ behind the lower part of the stomach that is the shape of a fish and about the size of a hand. It is a compound gland composed of both exocrine and endocrine tissues. The endocrine pancreas makes insulin so that the body can use glucose (sugar) for energy. The exocrine pancreas makes enzymes that help the body digest food. Spread all over the pancreas are areas called the Islets of Langerhans. The cells in these areas each have a special purpose. The alpha cells make glucagon, which raises the level of glucose in the blood; the beta cells make insulin; the delta cells make somatostatin. There are also PP cells and D1 cells, about which little is known. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12393 Pancreas Ear structure (body structure) EAR Ear ear A sense organ needed for the detection of sound and for establishing balance. The outer ear consists of the auricle, the ear canal as well as the tympanic membrane. The middle ear is made up of an air-filled cavity behind the tympanic membrane that contains the ossicles (malleus, incus and stapes). The inner ear is made up of the cochlea needed for hearing and the vestibular apparatus required for balance. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12394 Ear Pineal Gland GLAND, PINEAL Pineal Body Pineal gland PINEAL GLAND pineal organ pineal body Pineal structure (body structure) corpus pineale pineal gland glandula pinealis Pineal A small endocrine gland in the brain, situated beneath the back part of the corpus callosum, that secretes melatonin. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12398 Pineal Gland Pituitary structure (body structure) glandula pituitaria Nervous System, Pituitary Pituitary gland PITUITARY GLAND Hypophysis Cerebri Pituitary Gland GLAND, PITUITARY pituitary body pituitary gland Hypophysis Pituitary pituitary Pea-sized endocrine gland located at the base of the brain in the pituitary fossa. It produces and secretes hormones such as oxytocin and vasopressin, to regulate the activities of the hypothalamus. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12399 Pituitary Gland Thyroid structure (body structure) THYROID GLAND Thyroid gland thyroid gland GLAND, THYROID Head and Neck, Thyroid Total Thyroid Thyroid Gland Thyroid thyroid An endocrine gland located at the base of the neck that produces and secretes thyroxine and other hormones. Thyroxine is important for metabolic control. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12400 Thyroid Gland Structure of eye proper (body structure) EYE Eye Eye, NOS Eyeball Ocular Ophthalmic Optic eye ophthalmic The organ of sight or vision. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12401 Eye mammalian oviduct uterine tube FALLOPIAN TUBE Fallopian tube Fallopian Tube, NOS fallopian tube Fallopian Tube Fallopian Tubes OVIDUCT Oviduct One of a pair of tubes that extend from the uterus to each of the ovaries. Following ovulation the egg travels down the fallopian tube to the uterus where fertilization may or may not occur. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12403 Fallopian Tube Genital System, Female, Ovary gonada of genitalia of female organism gonada of female organism reproductive system female organism reproductive system gonada gonada of reproductive system of female organism gonad of female organism reproductive system genitalia of female organism gonad genitalia of female organism gonada Ovarian structure (body structure) female organism genitalia gonad gonad of reproductive system of female organism female organism genitalia gonada female reproductive system gonad female reproductive system gonada gonada of female reproductive system reproductive system of female organism gonad reproductive system of female organism gonada female gonad gonad of female reproductive system animal ovary gonad of female organism genitalia gonada of female organism genitalia ovum-producing ovary female organism reproductive system gonad gonad of genitalia of female organism OVARY Ovaries Ovary Ovary, NOS ovary One of the paired female reproductive glands containing the ova or germ cells; the ovary's stroma is a vascular connective tissue containing numbers of ovarian follicles enclosing the ova. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12404 Ovary Uterus, NOS Genital System, Female, Uterus Uterine structure (body structure) UTERUS Uterine Utero Uterus Womb uterus womb A hollow, thick-walled, muscular organ located within the pelvic cavity of a woman. Within the uterus the fertilized egg implants and the fetus develops during pregnancy. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12405 Uterus Pregnant Uterus A uterus containing one or more viable embryos or fetuses. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12406 Pregnant Uterus birth canal Vaginal structure (body structure) Genital System, Female, Vagina Vagina, NOS VAGINA Vagina vagina The female genital canal, extending from the uterus to the vulva. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12407 Vagina External Genitalia female pudendum mammalian vulva puboperineal region pudendum femininum Vulval structure (body structure) VULVA Vulva Vulva, NOS vulva The external, visible part of the female genitalia surrounding the urethral and vaginal opening. The vulva includes the clitoris and inner as well as outer labia. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12408 Vulva Genital System, Male, Penis Penile structure (body structure) PENIS Penis Penis, NOS penis The male organ of urination and copulation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12409 Penis Prostatic structure (body structure) GLAND, PROSTATE Prostate gland prostate gland male prostate PROSTATE GLAND Genital System, Male, Prostate Prostate Gland Prostatic Gland Prostate prostate The walnut shaped accessory sex gland of the male reproductive system. It is located in the pelvis just below the bladder, surrounding the prostatic part of the urethra. The prostate gland secretes a fluid which is part of the semen. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12410 Prostate Gland Genital System, Male, Testis gonad of male reproductive system gonad of male genitalia Testis, NOS Testis structure (body structure) TESTIS Testes Testicle Testicles Testis male gonad testicle testis Either of the paired male reproductive glands that produce the male germ cells and the male hormones. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12412 Testis URINARY BLADDER Urinary Bladder vesica urinaria urinary bladder Urinary bladder structure (body structure) Urinary System, Bladder Bladder, NOS BLADDER Bladder bladder The distensible sac-like organ that functions as a reservoir of urine, collecting from the kidneys and eliminating via the urethra. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12414 Bladder Kidney, NOS Kidney structure (body structure) Urinary System, Kidney KIDNEY Kidney Kidneys kidney One of the two bean-shaped organs located on each side of the spine in the retroperitoneum. The right kidney is located below the liver and the left kidney below the diaphragm. The kidneys filter and secrete metabolic products and minerals from the blood, thus maintaining homeostasis. On the superior pole of each kidney there is an adrenal gland. Each kidney and adrenal gland is surrounded by fat. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12415 Kidney Ureteric structure (body structure) URETER Ureter ureter The thick-walled tube that carries urine from each kidney to the bladder. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12416 Ureter Urethral structure (body structure) URETHRA Urethra urethra The tube carrying urine from the bladder to outside of the body. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12417 Urethra ORAL CAVITY Buccal Cavity buccal cavity oral cavity cavity of mouth regio oralis Oral Cavity Oral cavity structure (body structure) BODY CAVITY, ORAL Buccal cavity Buccal Mouth Mouth, NOS Oral Orally mouth The cavity located at the upper end of the alimentary canal, behind the teeth and gums that is bounded on the outside by the lips, above by the hard and soft palates and below by the tongue. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12421 Oral Cavity Tongue, NOS Tongue structure (body structure) Entire tongue (body structure) TONGUE Tongue tongue The muscular organ located in the floor of the mouth and serving as the principal organ of taste and modification of the voice in speech. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12422 Tongue Nasal Fossa Nasal Cavity nasal fossa NASAL CAVITY nasal canal BODY CAVITY, NASAL olfactory chamber cavity cavity of nose cavity of olfactory apparatus nasal conduit space nasal cavity Nasal cavity Nasal cavity structure (body structure) The proximal portion of the respiratory passages on either side of the nasal septum lying between the floor of the cranium and the roof of the mouth and extending from the face to the pharynx. The nasal cavity is lined with ciliated mucosa, extending from the nares to the pharynx. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12424 Nasal Cavity Head and Neck, Salivary Glands Major salivary gland, NOS SALIVARY GLAND Salivary Gland Salivary Glands salivary gland GLAND, SALIVARY An exocrine gland that secretes saliva. Salivary glands are mostly located in and around the oral cavity. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12426 Salivary Gland cartilaginous trachea Tracheal structure (body structure) vertebrate trachea TRACHEA Trachea Windpipe trachea windpipe The fibrocartilaginous, mucous-lined tube passing from the larynx to the bronchi. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12428 Trachea medulla ossea bone marrow Bone marrow medulla ossium Bone marrow structure (body structure) Bone Marrow Reticuloendothelial System, Bone Marrow BONE MARROW Marrow The tissue occupying the spaces of bone. It consists of blood vessel sinuses and a network of hematopoietic cells which give rise to the red cells, white cells, and megakaryocytes. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12431 Bone Marrow Reticuloendothelial System, Spleen Splenic structure (body structure) SPLEEN Spleen Splenic spleen splenic An organ that is part of the hematopoietic and immune systems. It is composed of the white pulp and the red pulp and is surrounded by a capsule. It is located in the left hypochondriac region. Its functions include lymphocyte production, blood cell storage, and blood cell destruction. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12432 Spleen thymus gland thymus organ Thymus gland structure (body structure) Thymus Gland Reticuloendothelial System, Thymus THYMUS GLAND THYMUS Thymus thymus A bi-lobed organ surrounded by a connective tissue capsule. It is located in the upper anterior portion of the chest, behind the sternum. It is composed predominantly of lymphocytes and fewer epithelial cells. Connective tissue septa separate the lobes into lobules. The lobules contain an outer portion (cortical zone) which is rich in lymphocytes and an inner portion (medullary zone) which is rich in epithelial cells. It is an organ essential for the development of the immune system. Its function is the maturation of the progenitor lymphoid cells to thymocytes and subsequently to mature T-cells. It reaches its greatest weight at puberty and subsequently begins to involute. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12433 Thymus Gland peripheral blood vertebrate blood Reticuloendothelial System, Blood Peripheral Blood portion of blood Whole Blood BLOOD Blood blood A liquid tissue; its major function is to transport oxygen throughout the body. It also supplies the tissues with nutrients, removes waste products, and contains various components of the immune system defending the body against infection. Several hormones also travel in the blood. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12434 Blood Nervous System, Brain Brain structure (body structure) BRAIN Brain Brain, NOS CNS-Brain brain An organ composed of grey and white matter containing billions of neurons that is the center for intelligence and reasoning. It is protected by the bony cranium. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12439 Brain Spinal cord spinal cord Spinal Cord Medulla Spinalis Spinal cord structure (body structure) SPINAL CORD The elongated, approximately cylindrical part of the central nervous system of vertebrates that lies in the vertebral canal and from which the spinal nerves emerge. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12464 Spinal Cord Lung structure (body structure) Respiratory System, Lung LUNG Lung Lung, NOS Lungs lung pulmo One of a pair of viscera occupying the pulmonary cavities of the thorax, the organs of respiration in which aeration of the blood takes place. As a rule, the right lung is slightly larger than the left and is divided into three lobes (an upper, a middle, and a lower or basal), while the left has two lobes (an upper and a lower or basal). Each lung is irregularly conical in shape, presenting a blunt upper extremity (the apex), a concave base following the curve of the diaphragm, an outer convex surface (costal surface), an inner or mediastinal surface (mediastinal surface), a thin and sharp anterior border, and a thick and rounded posterior border. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12468 Lung entire skin Skin structure (body structure) skin of body Skin, total Human Skin Integument SKIN Skin Skin, NOS skin organ An organ that constitutes the external surface of the body. It consists of the epidermis, dermis, and skin appendages. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12470 Skin Signet Ring Cell Signet-Ring Cell A neoplastic cell containing cytoplasmic mucin. The presence of mucin pushes the nucleus of the cell to the periphery, assuming a configuration resembling a signet ring. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12487 Signet Ring Cell Alimentary Bolus Bolus of Ingested Food Bolus of Food Bolus A soft mass or lump of chewed food that is passed from the mouth into the esophagus and the stomach. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C125189 Alimentary Bolus Anal Sac SAC, ANAL Paired glands located on either side of the anus of most carnivores that secrete a noxious-smelling liquid, thus allowing members of the same species to identify one another. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C125896 Anal Sac Multinucleated Giant Cell MULTINUCLEATED GIANT CELL Giant Cell syncytium An abnormally large cell that contains multiple nuclei and an abundant amount of cytoplasm. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12607 Giant Cell Basal Metabolic Rate BMR A patient's eenergy expenditure at rest. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C126083 Basal Metabolic Rate abdominopelvis Abdomen, total BODY CAVITY, ABDOMINAL Abdomen, NOS ABDOMINAL CAVITY abdominopelvic region Abdominal Cavity Abdomen abdomen The cavity located between the lungs and pelvis. It contains the lower esophagus, stomach, pancreas, intestines, liver, gallbladder and spleen. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12664 Abdomen Adrenal gland ADRENAL GLAND Adrenal Glands glandula suprarenalis adrenal gland suprarenal gland Adrenal gland, NOS Adrenal Gland GLAND, ADRENAL Adrenal structure (body structure) glandula adrenalis Adrenal Adrenals A flattened, roughly triangular body resting upon the upper end of each kidney; it is one of the ductless glands furnishing internal secretions (epinephrine and norepinephrine from the medulla and steroid hormones from the cortex). http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12666 Adrenal Gland Bartholin Gland Bartholin's Gland The two mucous secreting glands on either side of the vaginal opening. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12675 Bartholin Gland biliary system BILIARY TRACT biliary tract Tract, Biliary Biliary tract, NOS Biliary Tract Biliary System Bile Tract The system that transports bile from the hepatocytes in the liver to the small intestine. It is comprised of the intrahepatic bile ducts, hepatic ducts, common bile duct, cystic duct, and the gallbladder. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12678 Biliary Tract CARDIOVASCULAR SYSTEM circulatory system Vascular, Heart Body System, Cardiovascular Cardiovascular Cardiovascular System Cardiovascular Organ System Circulatory System Organ System, Cardiovascular Cardiovascular Body System Relating to the heart and the blood vessels or the circulation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12686 Cardiovascular System Cerebrospinal fluid FLUID, CEREBROSPINAL Cerebrospinal Fluid CEREBROSPINAL FLUID cerebral spinal fluid Cerebral Spinal Fluid cerebrospinal fluid Cerebral spinal fluid CSF The fluid that is contained within the brain ventricles, the subarachnoid space and the central canal of the spinal cord. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12692 Cerebrospinal Fluid Endocrine gland, NOS Endocrine Organs endocrine gland Endocrine Gland ductless gland glandula endocrina Ductless glands that secrete substances which are released directly into the circulation and which influence metabolism and other body functions. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12704 Endocrine Gland Metabolic/Endocrine Body System endocrine system Organ System, Endocrine/Metabolic Body System, Endocrine/Metabolic Endocrine/Metabolic Body System Hormonal System Endocrine/Metabolic Organ System Endocrine System Endocrine Collective designation for those tissues capable of secreting hormones. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12705 Endocrine System Apocrine Gland apocrine gland Exocrine Gland Apocrine A gland from which secretions reach a free surface of the body by ducts. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12712 Exocrine Gland GONAD Gonad Gonadal Gonads gonad A reproductive system organ that produces and releases either sperm (testis) or eggs (ovary). http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12725 Gonad vertebrate heart chambered heart Heart structure (body structure) Cardiac HEART Heart heart A hollow organ located slightly to the left of the middle portion of the chest. It is composed of muscle and it is divided by a septum into two sides: the right side which receives de-oxygenated blood from the body and the left side which sends newly oxygenated blood to the body. Each side is composed of two chambers: the atrium (receiving blood) and ventricle (ejecting blood). http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12727 Heart body system, allergic/immunologic allergic/immunologic organ system organ system, allergic/immunologic immune system immunologic/allergic organ system allergic/immunologic body system Immune System The complex group of organs like thymus, spleen, tonsils, lymphatic system, hematopoetic system and cells like lymphocytes, granulocytes, monocytes and macrophages that defends the body against infection or disease. It consists of a complex interrelated cellular, molecular and genetic component. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12735 Immune System Intestinal tract, NOS Intestinal structure (body structure) Bowel INTESTINE Intestine Intestines bowel intestine The portion of the gastrointestinal tract between the stomach and the anus. It includes the small intestine and large intestine. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12736 Intestine KIDNEY, CORTEX Cortical Portion of Kidney Renal Cortex Structure of cortex of kidney (body structure) Cortical Portion of the Kidney Cortical The outer part of the renal parenchyma beneath the renal capsule. It contains glomeruli and tubules. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12739 Renal Cortex Medullary Portion of the Kidney Medullary Portion of Kidney Renal Medulla KIDNEY, MEDULLA The inner part of the renal parenchyma. It consists mostly of collecting tubules and is organized in sections called pyramids. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12740 Renal Medulla Lymph Node, NOS Structure of lymph node (body structure) Lymph Gland Lymph Node(s) Lymph node, NOS Lymphatic Gland Lymph nodes lymph gland Reticuloendothelial System, Lymph Node Lymph Nodes LYMPH NODE Lymph Node lymph node A bean-shaped organ surrounded by a connective tissue capsule. It is part of the lymphatic system and is found throughout the body. It is composed predominantly of lymphocytes and its main function is immune protection. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12745 Lymph Node MUSCULOSKELETAL SYSTEM Musculoskeletal System Musculoskeletal The system of muscles, tendons, ligaments, bones, joints and associated tissues that move the body and maintain its form. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12754 Musculoskeletal System Nervous system, NOS Neurologic Organ System nervous system Organ System, Neurologic Neurologic Body System Nervous System Body System, Neurologic Neurologic The entire nerve apparatus, composed of a central part, the brain and spinal cord, and a peripheral part, the cranial and spinal nerves, autonomic ganglia, and plexuses. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12755 Nervous System Nasal structure (body structure) NOSE Nose A structure of special sense serving as an organ of the sense of smell and as an entrance to the respiratory tract. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12756 Nose GLAND, PARATHYROID parathyroid gland Parathyroid gland PARATHYROID GLAND Parathyroid Gland Parathyroid structure (body structure) parathyroid Head and Neck, Parathyroid Parathyroid One of two small paired endocrine glands, superior and inferior, usually found embedded in the connective tissue capsule on the posterior surface of the thyroid gland; these glands secrete parathyroid hormone that regulates the metabolism of calcium and phosphorus. The parenchyma is composed of chief and oxyphilic cells arranged in anastomosing cords. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12765 Parathyroid Gland Pelvic Region pelvic region of trunk Pelvic Cavity lesser pelvis BODY CAVITY, PELVIC true pelvis pelvis region pelvic region Pelvis, NOS PELVIS Pelvic Pelvis pelvic pelvis The bony, basin-shaped structure formed by the hipbones and the base of the backbone supporting the lower limbs in humans. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12767 Pelvis PERITONEAL CAVITY Peritoneal Cavity peritoneal cavity BODY CAVITY, PERITONEAL The potential space located between the parietal and visceral layers of the peritoneum. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12769 Peritoneal Cavity GLAND, SEMINAL VESICLE Seminal vesicle structure (body structure) SEMINAL VESICLE Seminal Vesicles Seminal Sacs seminal vesicle Seminal Vesicle One of the two paired glands in the male genitourinary system, posterior to the bladder and superior to the prostate gland, that produces fructose-rich seminal fluid which is a component of semen. These glands join the ipsilateral ductus deferens to form the ejaculatory duct. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12787 Seminal Vesicle Tissue tissue Tissues tissues TISSUE An anatomical structure consisting of similarly specialized cells and intercellular matrix, aggregated according to genetically determined spatical relationships, performing a specific function. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12801 Tissue Tonsillar structure (palatine) (body structure) TONSIL Tonsil Tonsils tonsil The two organs situated in the throat on either side of the narrow passage from the mouth to the pharynx. They are composed of lymphoid tissues. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12802 Tonsil Genitourinary GENITOURINARY SYSTEM Urogenital System genitourinary system Genitourinary Tract Genitourinary System Urogenital Tract The body system that includes all organs involved in reproduction and in the formation and voidance of urine. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12810 Genitourinary System Ductus Deferens ductus deferens deferent duct VAS DEFERENS vas deferens vas deferen Vas Deferens Duct carrying spermatozoa. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12813 Vas Deferens PLEURAL CAVITY BODY CAVITY, PLEURAL Pleural Cavity pleural cavity Pleural Space The potential space between parietal and visceral pleurae. There is a separate pleural cavity for each lung. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12840 Pleural Cavity Reproductive Tract Genital tract reproductive system Reproductive System Reproductive Body System Reproductive Organ System The organs and tissues involved in the production and maturation of gametes and in their union and subsequent development as offspring. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12841 Reproductive System Left Seminal Vesicle L SV The seminal gland that is located to the anatomical left of the bladder. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C128598 Left Seminal Vesicle Right Seminal Vesicle R SV The seminal gland that is located to the anatomical right of the bladder. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C128611 Right Seminal Vesicle Renal Pyramid A cone-shaped structure of the kidney. It is located in the medullary portion of the kidney (pyramid of Malpighi) or the cortical portion of the kidney (pyramid of Ferrein). http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12886 Renal Pyramid THORACIC CAVITY Thoracic Cavity BODY CAVITY, THORACIC The cavity in the vertebrate body enclosed by the ribs between the diaphragm and the neck and containing the lungs and heart. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12905 Thoracic Cavity Mucosa-Associated Lymphoid Tissue Lymphoid Tissue, Mucosa-associated MALT Lymphoid tissue located beneath the mucosal epithelia of those mucosal surfaces that have contact with the external environment, such as the respiratory, digestive, and urinary systems. MALT consists of a collection of predominantly small lymphocytes, fewer larger, transformed lymphocytes, and plasma cells. It protects the body from pathogens that enter via the mucosa. MALT gives rise to a distinctive type of B-cell lymphoma that usually follows an indolent clinical course. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12910 Mucosa-Associated Lymphoid Tissue Abnormal Cell An abnormal human cell type which can occur in either disease states or disease models. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12913 Abnormal Cell Body Systems body system body_system Organ System An anatomical sturcture that consists of organs and organ subclasses responsible for certain body functions. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12919 Organ System Tumor cells, NOS Neoplastic Cell Tumor cells, uncertain whether benign or malignant Tumor Cell Cells of, or derived from, a tumor. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12922 Neoplastic Cell Sentinel Lymph Node DUCT Duct duct A tube that carries various secretions from one part of the body to another. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12948 Duct Atypical Mononuclear Cell http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12979 Atypical Mononuclear Cell Interval Lymph Node Brunner's Gland GLAND, BRUNNER'S Brunner's Glands Compound, tubular, submucosal glands located in the duodenum proximal to the sphincter of Oddi; these glands produce alkaline-rich secretions that function to both protect the duodenum from the acidic content of the stomach and to enable intestinal enzymes to activate, thus enabling absorption to start. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13010 Brunner's Gland Organ Organs organ A unique macroscopic anatomic structure that performs specific functions. It is composed of various tissues. An organ is part of an anatomic system or a body region. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13018 Organ Uriniferous Tube Nephron The basic structural and functioning unit of the kidney. It is composed of the glomerulus, where waste products are filtered from the blood, the proximal and distal tubules, the loop of Henle, and the collecting ducts, where urine is produced for excretion from the body. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13048 Nephron Lymphoid Normal Lymphoid Tissue Tissue characterized by the presence of large numbers of lymphocytes in different stages of transformation. Connective tissue cells including fibroblasts and macrophages may be present. Lymphoid tissue is framed by a network of reticular fibers and may be diffuse, or densely aggregated. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13049 Lymphoid Tissue Hematopoietic Tissue hematopoietic tissue Tissue in which new blood cells are formed. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13051 Hematopoietic Tissue Nervous Tissue Human Nerve Tissue Nerve Tissue The tissue that generates and conducts electrical signals in the body. It contains the neurons. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13052 Nerve Tissue Prostatic Duct A small canal that receives prostatic secretions from the glandular tubules and discharges it through the prostatic portion of the urethra. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13102 Prostatic Duct Prostatic Stroma Stroma of the Prostate Gland The non-glandular tissue of the prostate gland, consisting of two major cell types, smooth muscle cells and fibroblasts. Stromal cells are key regulators of growth and differentiation in the prostate. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13104 Prostatic Stroma Virchow-Hassall Body Hassall's Body Hassall's Corpuscle Thymic Corpuscle Hassall's Concentric Corpuscle A small spherical body composed of keratinized squamous epithelial cells arranged in a concentric pattern in the medullary portion of the thymus. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13170 Hassall's Corpuscle A-DNA A-Form DNA A-DNA is a shorter and wider helix than B-DNA. Most RNA and RNA-DNA duplex are in this form. While deep, narrow major groove is not easily accessible to proteins but wide, shallow minor groove is accessible to proteins but with lower information content than major groove. A-DNA is the favored conformation at low water concentrations. Base pairs are tilted to helix axis and displaced from axis and sugar pucker is C3'-endo (in RNA 2'-OH inhibits C2'-endo conformation). When examined from the top of the helix, there is a large hole in the middle, the sugar phosphate backbone is at the edge of the helix, and the bases are displaced towards the edge. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13186 A-DNA AQUEOUS HUMOR aqueous humor aqueous humor of eyeball Aqueous Humor Aqueous Fluid humor aquosus EYE, AQUEOUS HUMOR aqueous humour Aqueous Humour The watery fluid which is present in the anterior and posterior chambers of the eye. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13190 Aqueous Humor BILE Bile Bile Fluid Bile Juice bile Fluid composed of waste products, bile acids, salts, cholesterol, and electrolytes. It is secreted by the liver parenchyma and stored in the gallbladder. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13192 Bile Chromosomal CHROMOSOME Chromosome chromosome A structure found in cells that is comprised of a strand of linearized double-stranded DNA plus proteins that package the DNA in a condensed coil form and regulate chromosomal function. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13202 Chromosome Human Chromosome A structure found in the nucleus of human cells that is comprised of a strand of linearized double-stranded DNA plus proteins that package the DNA in a condensed coil form and regulate chromosomal function. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13203 Human Chromosome Satellite DNA DNA that contains many tandem highly repetitive sequences, that have a base composition (and thus density) sufficiently different from that of normal DNA that it sediments as a distinct band in cesium chloride density gradients. Satellite DNA is located at very specific spots in the genome (on chromosomes 1, 9, 16 and the Y chromosome, the tiny short arms of chromosomes 13-15 and 21 and 22, and near the centromeres of chromosomes). http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13228 Satellite DNA Functional Disability An impairment that causes an individual to require assistance in order to perform an activity. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C132289 Functional Disability Gastrointestinal Tract, Feces FECES Fecal Feces STOOL Stool feces stool The material discharged from the bowel during defecation. It consists of undigested food, intestinal mucus, epithelial cells, and bacteria. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13234 Feces Body Fluids or Substances Body Fluids and Substances Body Fluid or Substance Fluid Material produced by living organism; it can be a nessesary consituent of, or product of an organismal process. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13236 Body Fluid or Substance CAPILLARY PLASMA Capillary Plasma Plasma that has been isolated from capillary blood. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C132461 Capillary Plasma VENOUS PLASMA Venous Plasma Plasma that has been isolated from venous blood. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C132462 Venous Plasma Neck Lymph Node Groups Submental Lymph Node Group (Sublevel IA) Submandibular Lymph Node Group (Sublevel IB) Long Terminal Repeat LTR Identical DNA sequences found at either end of retrovirus proviral DNA, formed by reverse transcription of viral RNA. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13251 Long Terminal Repeat Upper Jugular Lymph Node Group (Sublevels IIA and IIB) Middle Jugular Lymph Node Group (Level III) Lower Jugular Lymph Node Group (Level IV) Posterior Triangle Lymph Node Group (Sublevels VA and VB) Anterior Compartment Lymph Node Group (Level VI) Superior Mediastinal Lymph Node Group (Level VII) Reticuloendothelial System, Lymph lymphatic fluid LYMPH Lymph lymph A clear, transparent, sometimes faintly yellow and slightly opalescent fluid that is collected from the tissues throughout the body, flows in the lymphatic vessels (through the lymph nodes), and is eventually added to the venous blood circulation. Lymph consists of a clear liquid portion, varying numbers of white blood cells (chiefly lymphocytes), and a few red blood cells. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13252 Lymph MUCUS Mucus mucus The thick fluid secreted by the mucus glands in the aerodigestive tract and the vagina. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13259 Mucus Paramesonephric Duct Mullerian Duct Müllerian Duct A pair of embryonic tubular structures that extend along the genital ridge and continue toward the cloaca, which in females will develop into the vagina, uterus, and fallopian tubes, and which will degenerate and be resorbed in males. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13260 Mullerian Duct Pancreatic Secretion http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13270 Pancreatic Secretion LUNG SURFACTANT Surfactant, Lung Lung Surfactant Surfactant Pulmonary surfactant lines the lung epithelium and lowers surface tension to prevent collapse at end-expiration. Deficiency of pulmonary surfactant results in respiratory distress syndrome (RDS) in premature infants. Lung surfactant is synthesized in alveolar type II cells, stored in lamellar bodies and secreted via exocytosis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13273 Lung Surfactant Head and Neck, Saliva SALIVA Saliva saliva The watery fluid in the mouth made by the salivary glands. Saliva moistens food to help digestion and it helps protect the mouth against infections. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13275 Saliva SEBUM Sebum sebum A thick, oily substance produced by the sebaceous glands located in the dermis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13276 Sebum Human Semen (Sperm) Seminal Plasma SEMEN Semen semen The thick, whitish secretion of the male reproductive organs. It is composed of spermatozoa in their nutrient plasma, secretions from the prostate, seminal vesicles, and various other glands, epithelial cells, and minor constituents. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13277 Semen SPUTUM Sputum sputum Material containing mucus, cellular debris, microorganisms and sometimes blood or pus. It is ejected through the mouth from the lungs, bronchi, and trachea. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13278 Sputum PERSPIRATION Perspiration SWEAT Sweat Sweats The liquid secreted by the sweat glands, having a salty taste and a pH that varies from 4.5 to 7.5. Sweat produced by the eccrine sweat glands is clear with a faint characteristic odor, and contains water, sodium chloride, and traces of albumin, urea, and other compounds. Its composition varies with many factors, e.g., fluid intake, external temperature and humidity, and some hormonal activity. Sweat produced by the larger, deeper, apocrine sweat glands of the axillae contains, in addition, organic material which on bacterial decomposition produces an offensive odor. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13280 Sweat Urinary System, Urine URINE Urine urine The fluid that is excreted by the kidneys. It is stored in the bladder and discharged through the urethra. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13283 Urine Z-DNA zDNA Z-DNA can be obtained for certain sequences such as CGCGCG by increasing the salt concentration of the solution containing the sample to 4 molar NaCl. Z-DNA is left-handed and the thinnest & tallest with a diameter of about 18 Angstrom. The sugar pucker is both C(3')-endo and C(2')-endo. In Z-DNA, the Watson-Crick base pairs are perpendicular to the helix axis. When examined from the top of the helix, bases are present throughout the matrix of the helix with no exclusive domains for either the bases or the backbone. At times the sugar phosphate backbone travels very close to the center of the helix, and the bases to the very edge of the helix. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13287 Z-DNA Open Reading Frame ORF A sequence of nucleotides in that contains no termination codons and so can potentially translate as a polypeptide chain. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13292 Open Reading Frame Repeated Sequences Repetitive Sequence Repetitive Element Repeated Sequence Nucleotide sequences present in multiple copies in the genome. There are several types of repeated sequences. Interspersed (or dispersed) DNA repeats (Interspersed Repetitive Sequences) are copies of transposable elements interspersed throughout the genome. Flanking (or terminal) repeats (Terminal Repeat Sequences) are sequences that are repeated on both ends of a sequence, for example, the long terminal repeats (LTRs) on retroviruses. Direct terminal repeats are in the same direction and inverted terminal repeats are opposite to each other in direction. Tandem repeats (Tandem Repeat Sequences) are repeated copies which lie adjacent to each other. These can also be direct or inverted. The ribosomal RNA and transfer RNA genes belong to the class of middle repetitive DNA. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13298 Repetitive Sequence DNA Sequence Sequence Sequences The sequence of nucleotide residues along a DNA chain. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13299 DNA Sequence Protein Structure The amino acids and their 3-D arrangement in constituting a protein. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13303 Protein Structure Gland Glandular gland An organ that produces and secretes hormones (e.g. endocrine gland), saliva or sweat (e.g. exocrine gland). http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13319 Gland Gastrointestinal Fluids and Secretions Gastrointestinal Fluid or Secretion Fluids and secretions within the passage leading from the mouth to the anus through the pharynx, esophagus, stomach, and intestine which cause digestion. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13321 Gastrointestinal Fluid or Secretion Vitreous Humor VITREOUS HUMOR Vitreous Fluid vitreous humor The clear colorless transparent jelly that fills the posterior chamber of the eyeball. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13323 Vitreous Humor SERUM Sera Serum serum The clear portion of the blood that remains after the removal of the blood cells and the clotting proteins. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13325 Serum Plasma Product Plasma The fluid (noncellular) portion of the circulating blood, as distinguished from the serum that is the fluid portion of the blood. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C133266 Plasma Product Allogeneic Blood Product Donation Allogeneic Blood or blood product donations intended for transfusion to other than the donor. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C133267 Allogeneic Blood Product Donation Autologous Blood Product Donation Autologous Blood or blood product donations intended for transfusion at a later time to the donor. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C133268 Autologous Blood Product Donation Dedicated Blood Product Donation Dedicated Donations arranged by the collecting facility to support a specific recipient on a frequent basis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C133269 Dedicated Blood Product Donation Designated Blood Product Donation Designated Donations from a donor called by the collecting facility to provide products for a specific recipient in some future therapeutic procedure, e.g. specifically matched blood for patients with antibodies. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C133270 Designated Blood Product Donation Diagnostic Use Designated Blood Product Blood Products for Diagnostic Use Whole blood, red blood cells, or platelets intended for diagnostic use. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C133271 Diagnostic Use Designated Blood Product Directed Blood Product Donation Directed Donations from a donor who presents to the collecting facility at the request of another person intending to provide products to be used by that person during some future therapeutic procedure. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C133272 Directed Blood Product Donation Granulocytes Granulocytes Product Granulocytes collected from a single donor and suspended in a specific volume of original plasma intended for patient infusion. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C133273 Granulocytes Product Human Peripheral or Cord Blood Cell Product Human Peripheral And Cord Blood Cell Product Cells from human blood or umbilical cord blood for transplantation or infusion. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C133274 Human Peripheral or Cord Blood Cell Product Other Blood Form Product Other Another blood form product type other than the ones that are explicitly identified in this value set. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C133277 Other Blood Form Product Platelets Product Platelets Platelets collected from a single donor and suspended in a specified volume of original plasma. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C133278 Platelets Product Pooled Blood Products Pooled Individual components, e.g. cryoprecipitated antihemophilic factor (AHF), whole blood-derived platelet concentrates, that are combined using an aseptic technique. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C133279 Pooled Blood Products Red Blood Cells Red Blood Cells Product RBC Red blood cells remaining after separating plasma from human blood, or collected by apheresis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C133280 Red Blood Cells Product Source Leukocytes WBC White blood cells intended as source material for further manufacturing use. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C133281 Source Leukocytes Cardiac Tissue http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C133337 Cardiac Tissue Heart Valve Tissue Human Heart Valve Tissue derived from the heart valves that allow blood flow through the heart. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C133338 Heart Valve Tissue Variable Number of Tandem Repeats Minisatellite Repeat Minisatellite Repeats Minisatellite Variable Number Tandem Repeat Minisatellites VNTR Tandem arrays of moderately repetitive (5-50 repeats) short (10-60 bases) DNA sequences found dispersed throughout the genome and clustered near telomeres. Their degree of repetition is two to several hundred at each locus. Loci number in the thousands but each locus shows a distinctive repeat unit. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13334 Minisatellite Repeat Ocular Tissue Human Ocular Tissue Different types of tissues from the human eye. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C133340 Ocular Tissue PF24 Plasma The fluid portion of one unit of human blood intended for transfusion which has been separated from whole blood and placed at -18 degrees C or colder within 24 hours from whole blood collection. When prepared by automated apheresis the product is stored at 1 degree to 6 degrees C within 8 hours of collection and frozen at -18 degrees C or colder within 24 hours of collection. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C133342 PF24 Plasma PF24RT24 Plasma Plasma Frozen within 24 Hours after Phlebotomy held at Room Temperature Up To 24 Hours after Phlebotomy (PF24RT24). Plasma prepared from automated apheresis collections can be held at room temperature for up 24 hours after collection and then frozen at -18 degrees C or colder. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C133343 PF24RT24 Plasma Recovered Plasma Plasma that has been collected from whole blood and is intended for further manufacture. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C133344 Recovered Plasma Plasma Cryoprecipitated Reduced Plasma, Cryoprecipitated Reduced Plasma from which cryoprecipitated antihemophilic factor (AHF) has been removed. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C133345 Plasma, Cryoprecipitated Reduced Single Donor Plasma Liquid Plasma Single donor plasma separated from red donor cells within 26 days after phlebotomy (40 days when citrate phosphate dextrose adenine (CPDA-1) is used as the anticoagulant) and stored at 1-6 degrees C. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C133346 Single Donor Plasma Source Plasma Plasma collected by apheresis and is intended for further manufacturing to prepare plasma derivatives. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C133347 Source Plasma Therapeutic Exchange Plasma TEP Plasma obtained from a patient who undergoes plasma exchange (also called therapeutic plasmapheresis). http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C133348 Therapeutic Exchange Plasma Extended Dating Platelets Platelets Extended Dating Platelets that have been tested for bacteria using an FDA-cleared rapid bacterial detection device labeled as a safety measure, following testing with a growth-based quality control test cleared by the FDA for platelet components, that can support extending the expiration date of platelets past 5 days. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C133349 Extended Dating Platelets Washed Platelets Platelets, Washed Platelets Washed Whole blood derived or apheresis collected platelets washed with normal saline or saline-buffered with acid citrate dextrose formula-A (ACD-A) or citrate using manual or automated methods. The washed platelets are stored at 20-24 degrees C for up to 4 hours. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C133350 Washed Platelets Red Blood Cells, Deglycerolized Deglycerolized Red Blood Cells Red Blood Cells Deglycerolized Red blood cells washed free of the glycerol in which they have been stored. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C133351 Deglycerolized Red Blood Cells Red Blood Cells Frozen Red Blood Cells, Frozen Frozen Red Blood Cells Red blood cells stored at an ultra-low temperature in the presence of a cryoprotective agent. These may be preserved for long periods of time. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C133352 Frozen Red Blood Cells Rejuvenated Frozen Red Blood Cells Red Blood Cells, Rejuvenated, Frozen Red Blood Cells Rejuvenated Frozen Red blood cells treated with a rejuvenating solution, then frozen and stored at ultra-low temperatures in the presence of a cryoprotective agent. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C133353 Rejuvenated Frozen Red Blood Cells Red Blood Cells Reconstituted Red Blood Cells, Reconstituted Reconstituted Red Blood Cells Red blood cells to which plasma is added to prepare a whole blood product, often with a designated specific hematocrit. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C133354 Reconstituted Red Blood Cells Rejuvenated, Frozen, Deglycerolized Red Blood Cells Red Blood Cells, Rejuvenated, Frozen, Deglycerolized Red Blood Cells Rejuvenated Frozen Deglycerolized Red blood cells treated with a rejuvenating solution, then frozen using a cryoprotective agent, and finally, washed free of the rejuvenating solution and glycerol. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C133355 Rejuvenated, Frozen, Deglycerolized Red Blood Cells Rejuvenated Red Blood Cells Red Blood Cells, Rejuvenated Red Blood Cells Rejuvenated Red blood cells treated to restore cell integrity with a rejuvenating solution, such as pyruvate inosine. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C133356 Rejuvenated Red Blood Cells Washed Red Blood Cells Red Blood Cells, Washed Red Blood Cells Washed Red blood cells typically washed using normal saline with or without small amounts of dextrose using manual or automated methods. The washed red blood cells are stored at 1-6 degrees C for up to 24 hours. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C133357 Washed Red Blood Cells Germinal Center Sites in secondary lymphoid tissue where follicular dendritic cells present antigens to B-cells and follicular helper T-cells. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13337 Germinal Center Microsatellite Microsatellites Microsatellite Repeats Microsatellite Repeat microsatellite A variety of simple di-, tri-, tetra-, and pentanucleotide tandem repeats that are dispersed in the euchromatic arms of most chromosomes. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13338 Microsatellite Repeat PLASMA Plasma plasma Plasma is the fluid (noncellular) portion of the circulating blood, as distinguished from the serum that is the fluid portion of the blood obtained by removal of the fibrin clot and blood cells after coagulation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13356 Plasma Cis-Acting Locus Cis-Acting Sequence Cis-acting locus is a section of DNA that affects the activity of DNA sequences on that same molecule of DNA. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13370 Cis-Acting Sequence Intracisternal A-Particle IAP Retroviral-like intracisternal A particles. High copy number family of repeated elements in the mouse with a typical proviral organization. Expressed very early in mouse development (2-8 cell stage) and in transformed cells. Mutant alleles of various genes contain newly-integrated IAP genes. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13374 Intracisternal A-Particle Right-Handed DNA B-DNA B-Form DNA A duplex of DNA is formed by two complementary chains that are arranged in an anti-parallel manner. B-DNA is about 20 Angstrom in diameter and a right-handed double helix with a wide major groove easily accessible to proteins and narrow minor groove. B-DNA is the most common DNA conformation in vivo and the favored conformation at high water concentrations. Base pairs are nearly perpendicular to the helix axis and sugar pucker is C2'-endo. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13397 B-DNA Breast Fluid or Secretion Mammary Gland Fluids and Secretions Breast Fluids and Secretions Any of the secretions of the breast. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13401 Breast Fluid or Secretion Chromatin Structure The more readily stainable portion of the cell nucleus, forming a network of nuclear fibrils within the achromatin of a cell. It is a deoxyribonucleic acid attached to a protein (primarily histone) structure base and is the carrier of genes in inheritance. It occurs in two states, euchromatin and heterochromatin, with different staining properties, and during cell division, it coils and folds to form the chromosomes. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13402 Chromatin Structure DNA Structure The structure of a DNA molecule, consisting of its primary nucleotide sequence as well as its secondary and tertiary arrangement in space. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13404 DNA Structure Skin Fluid or Secretion Skin-Fluids, Secretions Skin Fluids and Secretions Skin Fluid and Secretion Secretions of the skin. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13409 Skin Fluid or Secretion Adrenal Fluids and Secretions Adrenal-Fluids, Secretions Adrenal Fluid or Secretion Epinephrine and norepinephrine from the medulla and steroid hormones from the cortex. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13416 Adrenal Fluid or Secretion Head and Neck-Fluids, Secretions Head and Neck, Fluids, Secretions Head and Neck Fluids and Secretions Secretions and fluids from the area of the body generally construed to comprise base of skull and facial bones, sinuses, orbits, salivary glands, oral cavity, oropharynx, larynx, thyroid, facial and neck musculature and lymph nodes draining these areas. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13418 Head and Neck Fluids and Secretions Mitotic Chromosome Condensed chromosomes observed during the M phase of the cell cycle. Individual chromosomes can be discerned and differentiated morphologically. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13430 Mitotic Chromosome Interphase Chromosome Interphase chromosomes are decondensed chromosomes that reside in the interphase nucleus in the form of chromatin. Two types of chromatin, euchromatin and heterochromatin, can be discerned microscopically. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13431 Interphase Chromosome 30 nm Fiber Chromatin Fibril Chromatin Fiber 30 nm Chromatin Fiber A level of DNA packaging in chromatin above that of the nucleosome, the fundamental subunit of chromatin structure. The chromatin fiber has a thickness of about 30 nanometers and results from the folding of a linear array of nucleosomes (thickness about 10 nm) into a more compact fiber. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13433 Chromatin Fiber Higher Order Chromatin Structure Higher Order Chromatin Folding Higher Order Structure Refers to various levels of DNA packaging in the chromosomes above that of the nucleosome. Includes the chromatin fiber and higher levels of folding such as loops. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13434 Higher Order Chromatin Structure Chromatin Loop Short Tandem Repeat Simple Sequence Repeat STR Area of repetitive DNA within the genome consisting of multiple, end-to-end copies of a short DNA sequence usually comprised of di-, tri-, or tetranucleotide repeat units. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13441 Short Tandem Repeat Pre-Condensed Chromosomes Genetics, Pre-Condensed Chromosomes It refers to the chromosome status during the prophase of mitotic division. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13451 Pre-Condensed Chromosomes Bronchial Secretion http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13465 Bronchial Secretion Nucleosomal Repeat Length Nucleosomal repeat length is approximately 200 base pairs of DNA within which 146 base pairs are highly protected. (NCI) http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13657 Nucleosomal Repeat Length Translocation Breakpoint The point on a chromosome where the normal DNA sequence is juxtaposed with DNA from another chromosome. Usually expressed as a band number designation (eg. t(9;22) (q34;q11) Philadelphia Chromosome) http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13660 Translocation Breakpoint Male Genital System Fluid or Secretion Male Genital System Fluids and Secretions Genital System, Male, Fluids, Secretions Sperm, Fluids, Secretions Sperm and the fluid it is suspended in. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13713 Male Genital System Fluid or Secretion Respiratory System Fluid or Secretion Respiratory System Fluids and Secretions Respiratory System Fluid and Secretion Respiratory System-Fluids, Secretions Fluids and secretions relating to the respiratory system. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13722 Respiratory System Fluid or Secretion Central DNA Flap Sequence In Lentivirus, a central strand displacement event consecutive to central initiation and termination of plus strand synthesis creates a plus strand overlap: the central DNA flap. This feature promotes efficient nuclear import and viral replication in non-dividing cells. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13724 Central DNA Flap Sequence G-Quadruplex G-Quadruplexes G-Quartet Structures G-Quadruplexes DNA G-Quartets G-Tetrads G4-DNA G-quadruplexes are multi-stranded structures held together by square planes of four guanines ('G-quartets') interacting by forming Hoogsteen hydrogen bonds. G-quartet structures has been developed as novel anti-HIV agents. Several critical structure-activity relationships between HIV-1 integrase and G-quartet oligonucleotides have been demonstrated. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13725 G-Quartets Minor Groove The smaller of the two types of spiral grooves found on a right-handed DNA double helix; located between the sugar phosphate backbones of two DNA strands. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13742 Minor Groove Major Groove One of the two types of grooves found in a right-handed double helix, running between the sugar phosphate backbones of each strand. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13743 Major Groove Short Interspersed Nuclear Element Short Interspersed Element SINE SINES SINEs. Short, 100-300 bases long, highly repeated sequences which contain RNA polymerase III promoters. The primate Alu and the rodent B1 SINEs are derived from 7SL RNA, the RNA component of the signal recognition particle. Most other SINEs are derived from tRNAs including the MIRs (mammalian-wide interspersed repeats). http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13804 Short Interspersed Element Upper Abdomen The superior portion of the abdomen. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C139562 Upper Abdomen Macromolecular Structure Molecular Structure Any very large complex molecule including, proteins, nucleic acids and carbohydrates, especially refering to the particular arrangement of its component atoms and groups. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C14134 Macromolecular Structure Presumed Alive Presumed Living The assumption that a person is still living. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C141463 Presumed Alive Metazoa Kingdom ANIMAL Animal Animalia Animals Metazoa A living organism that has membranous cell walls, requires oxygen and organic foods, and is capable of voluntary movement, as distinguished from a plant or mineral. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C14182 Animal Bacteria, Eubacteria BACTERIA Bacteria Bacterium Eubacteria bacteria Unicellular, prokaryotic organisms that reproduce by cell division and usually have cell walls; can be shaped like spheres, rods or spirals and can be found in virtually any environment. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C14187 Bacteria FUNGI FUNGUS Fungi Fungus fungus A kingdom of eukaryotic, heterotrophic organisms that live as saprobes or parasites, including mushrooms, yeasts, smuts, molds, etc. They reproduce either sexually or asexually, and have life cycles that range from simple to complex. Filamentous fungi refer to those that grow as multicellular colonies. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C14209 Fungus Viridiplantae Plants, General Plant Plants Any living organism that typically synthesizes its food from inorganic substances, possesses cellulose cell walls, responds slowly and often permanently to a stimulus, lacks specialized sense organs and nervous system, and has no powers of locomotion. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C14258 Plant Viruses, General VIRUS Virus Viruses virus An infectious agent which consists of two parts, genetic material and a protein coat. These organisms lack independent metabolism, and they must infect the cells of other types of organisms to reproduce. Most viruses are capable of passing through fine filters that retain bacteria, and are not visible through a light microscope. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C14283 Virus Other Organism Groupings A non-taxonomic grouping of organisms based on a shared characteristic. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C14376 Other Organism Groupings ABSCESS FLUID Abscess Fluid The fluid that is abnormally collected in localized areas of damaged tissue within the body, usually composed of living and dead white blood cells, bacteria, and dead tissue. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C150890 Abscess Fluid ALVEOLAR AIR Alveolar Air The gas located in the alveolus of the lungs, which takes part in gas exchange with the blood in the pulmonary capillaries. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C150891 Alveolar Air Cervicovaginal Secretion CERVICOVAGINAL SECRETION The watery fluid, consisting of vulvar gland, endometrium, and oviduct secretions, cervical mucus, vaginal wall plasma transudate, exfoliated cells, and bacterial and immune cell products, that hydrates and forms an antimicrobial barrier for the mucosa of the lower female genital tract. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C150892 Cervicovaginal Secretion Draining Lymph Node Left Lower Quadrant ABDOMINAL QUADRANT, LEFT LOWER Left Lower Quadrant of Abdomen LLQ The region of the abdomen that extends from the median plane to the left of the patient, and below the umbilicus. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C151399 Left Lower Quadrant of Abdomen Right Lower Quadrant ABDOMINAL QUADRANT, RIGHT LOWER Right Lower Quadrant of Abdomen RLQ The region of the abdomen that extends from the median plane to the right of the patient, and from the umbilical plane to the right inguinal ligament. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C151400 Right Lower Quadrant of Abdomen Transgender A person whose gender identity or gender expression differs from their assigned sex. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C154421 Transgender Main Pancreatic and Accessory Ducts DUCT, PANCREATIC Any of the ducts that conveys pancreatic secretions from the pancreas to the duodenum. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C154699 Main Pancreatic and Accessory Ducts Current Reformed Smoker, More than 15 Years Current reformed smoker, more than 15 years Current Reformed Smoker for > 15 yrs An individual who stopped smoking more than 15 years prior. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C156828 Current Reformed Smoker, More than 15 Years Current reformed smoker within past 15 years Current Reformed Smoker Within Past 15 Years Current Reformed Smoker for < or = 15 yrs An individual who stopped smoking within the past 15 years. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C156829 Current Reformed Smoker Within Past 15 Years Current reformed smoker, years unknown Current Reformed Smoker, Duration Not Specified Current Reformed Smoker, Years Unknown An individual who stopped smoking an unknown number of years prior. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C156830 Current Reformed Smoker, Years Unknown Polymer Branch Connection Points The chemical structures that make up the head and branch points found between repeating units in a branched polymer. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C157222 Polymer Branch Connection Points Nucleotide Bond Nucleic Acid Bond The phosphodiester bonds that are formed between nucleotides in a nucleic acid. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C157223 Nucleotide Bond Monomer Connection Points Branched structural repeat unit connection points The atoms that make up the head and branch points within a single repeating monomeric unit in a branched polymer. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C157466 Monomer Connection Points Nucleotide connection points Nucleotide Connection Points The phosphorus (P) atom found in the phosphate group and the oxygen (O) atom bound to the 3' carbon of the sugar within a single nucleotide, which can each form linkages with adjacent nucleotides during nucleic acid synthesis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C157467 Nucleotide Connection Points Fixed Lymph Node Body Mass Index Body mass index body mass index BMI bmi Quetelet Index An individual's weight in kilograms divided by the square of the height in meters. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16358 Body Mass Index Current Reformed Smoker Within 1 Year An individual who stopped smoking within the past 12 months. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C164222 Current Reformed Smoker Within 1 Year Cross-Linked Chemical Connection Points Cross-linked structural repeat unit connection points Cross-Linking Connection Points The atoms that make up the head and the tail points within a structural repeat unit that are involved in cross-links in a polymer. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C164241 Cross-Linked Chemical Connection Points AminoAcidPhysicalLocation Amino Acid Physical Location The position of an amino acid within an amino acid sequence. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C164371 Amino Acid Physical Location AminoAcidSequenceFeature Amino Acid Sequence Feature A descriptive annotation on a specified amino acid sequence. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C164372 Amino Acid Sequence Feature CytobandRange Cytoband Range A region within a nucleic acid sequence that corresponds to a region of interest bounded by cytobands. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C164377 Cytoband Range NucleicAcidPhysicalLocation Nucleic Acid Physical Location The position of an nucleic acid within an amino acid sequence. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C164397 Nucleic Acid Physical Location Nucleic Acid Sequence Feature NucleicAcidSequenceFeature A descriptive annotation on a specified nucleic acid sequence. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C164398 Nucleic Acid Sequence Feature Genetic Target geneticTarget The nucleotide or amino acid within the genetic location of interest that is to be compared to the subject's test result. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C164534 Genetic Target PerformedGeneticObservationResult.geneticTarget Performed Genetic Observation Result Genetic Target The nucleotide or amino acid within the genetic location of interest that is to be compared to the subject's test result. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C164933 Performed Genetic Observation Result Genetic Target Index Sequence A unique nucleotide sequence that is added to a sample during library preparation to serve as a unique identifier for the sample. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C165443 Index Sequence Monomer Deletion Site Monomer deletion site The location of a monomer deletion in a polymer. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C165845 Monomer Deletion Site Gene Genes gene A functional unit of heredity which occupies a specific position on a particular chromosome and serves as the template for a product that contributes to a phenotype or a biological function. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16612 Gene Patient Health Status Patient Status patient_status patient status An indicator that provides information on the current health status of a patient. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C166244 Patient Status Health Statuus General Health Status The state of a individual's mental or physical condition. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16669 Health Status Psychological Health mental health status. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16839 Psychological Health Pathologic Process A biologic function of a process having an abnormal or deeleterious effect at the subcellular, cellular, multicellular, or organismal level. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16956 Pathologic Process Patient Patieents patieent PT LAY USER/PATIENT A person who receives medical attention, care, or treatment, or who is registered with medical professional or institution with the purpose to reecieve medical care when necessary. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16960 Patient Signaling Pathway signaling pathway Signaling Pathways signaling pathways Signal Transduction Pathway An elaboration of the known or inferred interactions involved in a signal transduction pathway. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C17132 Signaling Pathway Patient_was_in_ICU Intensive Care Stay Required Intensive Care Patient requires admission to or extension of stay in an intensive care unit. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C171998 Intensive Care Stay Required Intensive Care Unit Admission Status AE_ICU An indication of whether the subject was admitted to the intensive care unit. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C173316 Intensive Care Unit Admission Status Gerder gender Caracteristics of people that are socially constructed, including norms, behaviors, and roles based on sex. As a social construct, gender varies from society to society and can change over time. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C17357 Gender Convalescent Plasma Plasma derived from patients who have recovered from an illness. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C173750 Convalescent Plasma Respiratory Droplet A respiratory fluid particle that is propelled from the mouth or nose during talking, coughing, sneezing, or other forms of exhalation which include various cells types (e.g. epithelial cells and cells of the immune system), physiological electrolytes contained in mucous and saliva (e.g. Na+, K+, Cl-), as well as, potentially, various infectious agents (e.g. bacteria, fungi and viruses). http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C173760 Respiratory Droplet BASAL TEAR Basal Tear A type of tear that is spread across the surface of the eye at regular intervals with blinking, coating the eyes to keep them moist. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C176366 Basal Tear Reflex Tear REFLEX TEAR A type of tear produced in response to irritation from foreign particles, vapors, bright lights, or peppery substances; contains higher amounts of antibodies in comparison to other tear types. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C176367 Reflex Tear Emotional Tear Psychic Tear EMOTIONAL TEAR A type of tear produced in response to negative and positive emotions; contains higher amounts of proteins and stress-related hormones in comparison to other tear types. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C176368 Emotional Tear Plasma Ultrafiltrate PLASMA ULTRAFILTRATE The fluid that is produced from the movement of whole blood across a semipermeable membrane in response to a pressure gradient, removing blood cells and large proteins. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C176370 Plasma Ultrafiltrate Reproductive Tissue REPRODUCTIVE TISSUE Tissue from any of the organs involved in reproduction. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C176412 Reproductive Tissue Birthplace Place of Birth The location where someone was born, usually referring to a town, city, or country. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C176764 Birthplace Subcellular Process Cell Process An intracellular or extracellular function, activity, or process principally involving intracellular or extracellular components. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C17710 Subcellular Process Functional Group Connection Point R-group Connection Point R-group Connection Points The pseudoatom(s) (usually denoted as *) that are involved in binding a functional group (R-group) to a larger molecule. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C177645 R-group Connection Point Biological Process Biological Function An activity occurring within an organism, between organisms or among organisms and the mechanisms underlying such events. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C17828 Biological Process Employment Status employment status The status of a person with regard to earning wages or salary. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C179143 Employment Status nutritional status Nutritional Status The state of the body as influenced by the diet and the ability of the diet to maintain an overall healthy condition. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C17993 Nutritional Status VIRUS INTEGRATION SITE Viral Integration Site Sequence Virus Integration Site VIS A DNA sequence within the host genome that is the target site of viral genome integration. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C181539 Virus Integration Site Metabolic Pathway Metabolic Pathways Metabolism An elaboration of the known steps and interactions for the metabolism of a compound. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C18611 Metabolic Pathway Fertility Status FRTLSTAT The status of an individual with respect to their ability to produce offspring. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C186214 Fertility Status Impaired Mobility Limitations in an individual's ability to maneuver in their physical environment. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C189010 Impaired Mobility COVID-19 Symptom Status COVID-19 symptom status The presence or absence of symptoms due to acute COVID-19. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C191554 COVID-19 Symptom Status Independent living difficulty Independent Living Difficulty An impairment that causes an individual to require assistance with living by themselves. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C192619 Independent Living Difficulty Self-care Difficulty Self-care difficulty An impairment that causes an individual to require assistance with caring for themselves. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C192620 Self-care Difficulty Personal Attribute Subject Characteristics Personal The distinguishing qualities or prominent aspects of an individual person. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C19332 Personal Attribute Blood and Blood Products Whole blood or any of the components into which it can be separated. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C19448 Blood and Blood Products Viral Function Viral Activity Biological functions, activities, or processes of viral elements that support the viability, propagation, or maintenance of a virus. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C19568 Viral Function Regulatory Pathway An elaboration of the known or inferred interactions controlling the expression of a product. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C19779 Regulatory Pathway Smoking Status tobacco smoking status tobacco_smoking_status Current Tobacco and Nicotine Coonsumption Status An indication of a person's current tobacco and nicotine consumption as well as some indication of smoking history. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C19796 Smoking Status Organismal Process Organism-level Process Physiological Process A biologic function, or process involving either specialized organ functions, individual organs, organ systems, body parts, or whole organisms. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C19988 Organismal Process Population Process Population-level Process Afunction or process affecting multiple organisms or organism groups. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20182 Population Process Unique Molecular Identifier Random Barcode UM Short random nucleotide sequences that are ligated to each primer molecule during amplification of a nucleotide sample during library preparation to act as a unique tag. Their use helps to identify PCR duplicates in sequencing data. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C201932 Unique Molecular Identifier Cellular Process Cellular Function Cell Process Cell Function Any process that takes place on the cellular level, though not necessaryily restricted to a single cell. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20480 Cellular Process Metabolic Network molecular pathway Biochemical Pathway Pathway Pathways A series of biocheemical reactions which occurs in a known sequence and can result in all or part of the initiation, progression or completion of a biological process or function. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20633 Biochemical Pathway DISABILITY Disability Handicap Infirmity Any physical or mental impairment that interferes with an individual's ability to perform desired activities. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C21007 Disability Multicellular Process A biologic function or process involving coordinated groups or populations of single cell types, mixed cell types, or tissues. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C21124 Multicellular Process Microscopic Anatomy Microanatomy Microanatomic Structure Those anatomic structures that are generally only visible through the use of microoscopy. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C21599 Microanatomic Structure Age age AGE Aged Postnatal Age Chronological Age How long smething has existed; slapsed time since birth. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C25150 Age Marital Status marital status marital_status MaritalStatus MARISTAT Marital or partnership status A demographic parameter indicating a person's current conjugal status. A demographic parameter indicating a person's current conjugal status. Marital Status Body Cavity BODY CAVITY Cavity cavity A natural hollow or sinus within the body. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C25444 Body Cavity Vital Status Vital_Status vital status vital_status Survival Status SURVSTAT The state or condition of being living or deceased; also includes the case where the vital status is unknown. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C25717 Vital Status Extracellular Space Interstitial space between cells, occupied by fluid as well as amorphous and fibrous substances. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C26055 Extracellular Space Gene Product Genome Encoded Entity A protein, RNA or a complex that contains proteins and/or RNA. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C26548 Gene Product Acinar Salivary Gland System The glandular portion of the salivary system whose combined secretions constitute the saliva; a clear, alkaline, somewhat viscus secretion that keeps the mouth moist and aids in swallowing and digesting food. It includes the major salivary glands - sublingual, submandibular, and parotid glands, as well as numerous minor glands. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32045 Acinar Salivary Gland System Adrenal Gland Tissue The tissue that forms the adrenal gland. It consists of the outer adrenal cortex and the inner adrenal medulla. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32051 Adrenal Gland Tissue Alveolar Duct The respiratory passage distal to the respiratory bronchiole. Alveolar sacs and alveoli arise from the alveolar duct. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32056 Alveolar Duct Alveolar Sac The terminal dilation of an alveolar duct that gives rise to alveoli in the lung. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32057 Alveolar Sac Anal Gland Paired glands located on either side of the anus of most carnivores that secrete a noxious-smelling liquid, thus allowing members of the same species to identify one another. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32068 Anal Gland Apocrine Sweat Gland A type of large, coiled, tubular, sometimes branched, specialized sweat gland that empties into the upper portion of a hair follicle instead of directly onto the skin surface. It has no secretory innervation but is sensitive to epinephrine in the bloodstream. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32132 Apocrine Sweat Gland Autosomal Autosome autosomal A chromosome not involved in sex determination. The diploid human genome consists of a total of 46 chromosomes which includes 22 pairs of autosomes. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32168 Autosome Bile Salt A bile acid compounded with a cation, often sodium. The most common human bile salts are sodium glycocholate and sodium taurocholate. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32203 Bile Salt Bladder Muscular Coat http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32206 Bladder Muscular Coat Bladder Serosal Surface http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32208 Bladder Serosal Surface Bladder Tissue The tissue that forms the bladder wall. It consists of mucosa, muscular coat, and serosal surface. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32209 Bladder Tissue Bronchial Tree The left and right bronchi considered together with their branches. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32233 Bronchial Tree Cardia Gland Simple tubular or compound racemose type glands located in the region where the esophagus attaches to the stomach which secrete mucus. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32261 Cardia Gland Central Zone of the Prostatic Parenchyma Part of the functional area of the prostate that is above and in front of the transitional zone. The central zone comprises about 20-25% of the gland and is the location of about 10% of the prostate cancers found in the gland. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32282 Central Zone of the Prostatic Parenchyma CERUMEN Cerumen Earwax A soft yellow wax secreted by glands in the ear canal. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32293 Cerumen Cervical Gland The mucous secreting glands in the cervix. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32296 Cervical Gland Cervical Gland Secretion Cervical Mucus The mucous produced by the glands in the cervix which is composed mainly of water but also contains electrolytes, amino acids, glucose, proteins and other trace elements (e.g. Mn, Fe, Cu, Zn, and Se). http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32297 Cervical Gland Secretion Cochlear Duct A membranous tube containing endolymph within the cochlea between the scala vestibuli and the scala tympani. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32335 Cochlear Duct Cortical Cell Layer http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32386 Cortical Cell Layer Duct of the Epididymis A convoluted tube connecting the efferent ductules of the testicle to the vas deferens. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32484 Duct of the Epididymis Duct of Gartner An embryonic remnant of the mesonephric duct in females that runs parallel to the uterus, cervix and vagina. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32485 Duct of Gartner Ductus Pancreaticus Accessorius Accessory Pancreatic Duct Ductus Santorini An accessory pancreatic duct with two branches, one of which opens directly to the duodenum at the minor duodenal papilla while the other connects to the pancreatic duct. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32487 Ductus Santorini eccrine gland Eccrine Sweat Gland An unbranched, coiled, tubular gland not associated with the hair follicle that promotes cooling by evaporation of its secretion. It is innervated by cholinergic nerve fibers. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32490 Eccrine Sweat Gland Efferent Ductule Efferent Duct DUCT, EFFERENT One of 12 to 14 small seminal ducts leading from the testis to the head of the epididymis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32492 Efferent Duct Ejaculatory Duct Bilateral tubes formed by the joining of the vas deferens and the excretory duct of the seminal vesicle which merge into the urethra after passing through the prostate. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32493 Ejaculatory Duct Endocrine Ovary The part of the ovary that produces hormones, mainly estrogen and progesterone, though small amounts of androgens and other protein hormones are also produced. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32508 Endocrine Ovary Endocrine Sex Organ The tissue responsible for generating and secreting hormones involved in reproduction. In males, testosterone is produced and secreted from the testes while the female ovaries produce and secrete estrogens and progestrones. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32510 Endocrine Sex Organ Endocrine Testis The part of the testis that produces testosterone. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32511 Endocrine Testis Endolymph The bodily fluid that fills the membranous labyrinth of the inner ear. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32513 Endolymph ENDOMETRIAL CAVITY Endometrial Cavity A space inside the uterus lined by a layer of mucus membranes called the endometrium. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32514 Endometrial Cavity Esophageal Gland The small, compound, unbranched exocrine glands varying in number that are located within the submucosa of the esophagus. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32536 Esophageal Gland Esophageal Tissue The tissue of the esophageal wall. It is composed of mucosa, a muscular coat, and a serosal surface. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32543 Esophageal Tissue Exocrine Pancreas PANCREAS, EXOCRINE An enzyme producing region of the pancreatic tissue containing the pancreatic acini and exocrine intralobular ducts which collectively secrete the digestive enzymes into the main pancreatic duct to drain into the duodenal part of the small intestine. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32546 Exocrine Pancreas Fascicle A small bundle of nerve fibers that is more or less associated functionally. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32586 Fascicle Female Genital System Fluid and Secretion Female Genital System Fluid or Secretion http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32589 Female Genital System Fluid or Secretion Female Urethra The 1.5 inch long tube carrying urine from the bladder to the outside of the body exiting between the clitoris and vagina. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32591 Female Urethra Fibrin A glycosylated elastic protein produced by the cleavage of fibrinogen by the protease thrombin during blood coagulation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32598 Fibrin Fundic Gland Fundus Gland Gastric Gland The tubular glands in the mucosa of the gastric fundus that can secrete mucous, hydrochloric acid, pepsinogen, or any of the digestive hormones. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32643 Fundic Gland Gastric Muscularis Externa Gastric Muscular Coat http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32657 Gastric Muscular Coat Gastric Secretion Gastric Juice The digestive secretions of the gastric glands in the stomach, consisting mainly of pepsin, hydrochloric acid, rennin, and mucin. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32661 Gastric Secretion Gastric Submucosa http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32663 Gastric Submucosa Gastric Tissue The tissue of the stomach. It is composed of a fibrous outer layer bounded by smooth muscle, the submucosa, and the mucosa. The mucosa of the stomach consists of secretory cells that produce hydrochloric acid and gastric enzymes. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32664 Gastric Tissue Gray Matter The nerve tissue composed of nerve cell bodies, unmyelinated nerve fibers and supportive tissue found in the brain and spinal cord. It is differentiated from the white matter by color of the tissues and the presence of more myelinated nerve cells in the white matter. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32695 Gray Matter Hepatic Lobule http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32732 Hepatic Lobule Hepatic Sinusoid http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32733 Hepatic Sinusoid Liver Tissue Hepatic Tissue Hepatic Parenchyma The tissue of the liver. It includes the hepatic lobules, hepatic sinusoids, perisinusoidal spaces, and portal triad. The hepatic lobules are composed of hepatocytes. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32735 Hepatic Tissue Inferior Parathyroid Gland Either of two paired parathyroid glands distal to the head. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32787 Inferior Parathyroid Gland Intercalated Duct One of two types of intercalated ducts located in either the pancreas or salivary gland. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32820 Intercalated Duct Interlobular Duct A gland duct that drains secretions from more than one lobe of an organ. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32828 Interlobular Duct Intestinal Secretion http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32875 Intestinal Secretion Juxtaglomerular Apparatus Cellular population adjacent to the renal corpuscle, composed of the macula densa, the juxtaglomerular cells, and the extraglomerular mesangial cells. It regulates the blood pressure by activating the renin-angiotensin-aldosterone system. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32891 Juxtaglomerular Apparatus Lactiferous Duct A channel conveying the milk secreted by the lobes of the breast to and through the nipple. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32910 Lactiferous Duct Large Intestinal Mucosa Mucosa consisting of the epithelium, basement membrane, lamina propria mucosae and lamina muscularis mucosae of the distal portion of the digestive tract from the small intestine to the anus. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32926 Large Intestinal Mucosa Large Intestinal Muscular Coat The portion of the intestinal covering that contracts causing peristalsis. It surrounds the weblike submucosa of the distal portion of the digestive tract from the small intestine to the anus. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32927 Large Intestinal Muscular Coat Large Intestinal Serosal Surface The membrane lining the external walls of the distal portion of the digestive tract from the small intestine to the anus. It consists of mesothelium on a connective tissue layer and it secretes a watery exudate. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32929 Large Intestinal Serosal Surface Large Intestinal Wall Tissue The tissue of the large intestine. It is composed of four layers - mucosa, submucosa, smooth muscle with inner circular and outer longitudinal layers, and serosa. The mucosa has a large number of goblet cells but does not have any villi. The longitudinal muscle layer is incomplete. The longitudinal muscle is limited to three distinct bands, called teniae coli that run the entire length of the colon. Contraction of the teniae coli exerts pressure on the wall and creates a series of pouches, called haustra, along the colon. Epiploic appendages, pieces of fat-filled connective tissue, are attached to the outer surface of the colon. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32931 Large Intestinal Wall Tissue Fallopian Tube, Left Left Fallopian Tube The fallopian tube that extends from the uterus to the ovary in the left side of the pelvic cavity. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32959 Left Fallopian Tube LUNG, LEFT Left Lung The 2-lobed lung located on the left side of the body. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32967 Left Lung Ovary, Left Left Ovary The ovary that is located in the left side of the pelvis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32969 Left Ovary Lingual tonsil Lingual Tonsil TONSIL, LINGUAL The lymphoid follicles on the dorsal surface in the posterior region of the tongue. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32988 Lingual Tonsil Lung Parenchyma Lung Tissue Tissue consisting of an external serous coat, subserous areolar tissue and lung parenchyma. The parenchyma is made up of lobules wound together by connective tissue. A primary lobule consists of a terminal bronchiole, respiratory bronchioles, and alveolar ducts, which communicate with many alveoli, each alveolus being surrounded by a network of capillary blood vessels. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33024 Lung Tissue Lymphoid Follicle Nodular structures composed of lymphocytes. In the absence of immune stimulation, they ae called primary follicles and are composed of small B-lymphocytes. With antigenic stimulation the B-lymphocytes replicate and differentiate, to give rise to secondary follicles which are composed of germinal centers and are surrounded by mantle zones. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33040 Lymphoid Follicle Male Urethra The 8 inch long tube carrying urine from the bladder to the outside of the body exiting at the end of the penis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33050 Male Urethra Mantle Zone http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33053 Mantle Zone Mesangium A thin membrane in the central part of the renal glomerulus between capillaries. It helps to support the capillary loops in the glomerulus. Mesangial cells are phagocytic and for the most part separated from capillary lumina by endothelial cells. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33101 Mesangium Nasolacrimal Duct DUCT, NASOLACRIMAL A tube-like structure that conveys tears from the lacrimal sac to the nasal cavity. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33161 Nasolacrimal Duct Organ of Special Sense Special Sense Organ Anatomic structures in the head responsible for special sensations rather than general sensations. This category includes the eyes, ears, nose, and tongue. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33224 Organ of Special Sense Otolymph http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33231 Otolymph Palatine Tonsil TONSIL, PALATINE Two masses of lymphatic tissue located one on either side of the oropharynx in the oropharyngeal isthmus. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33250 Palatine Tonsil Endocrine Pancreas Secretion Pancreatic Endocrine Secretion http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33255 Pancreatic Endocrine Secretion Pancreatic Juices Pancreatic Exocrine Secretion pancreatic juice Exocrine Pancreas Secretion Pancreatic Fluid Pancreatic fluid Secretion from the pancreas that contains digestive enzymes. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33256 Pancreatic Exocrine Secretion Human Parathyroid Parathyroid Gland Tissue Parathyroid gland tissue consists of three primary cell types - chief cells, oxyphil cells and clear cells. These glands are usually located in close proximity to the thyroid gland. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33270 Parathyroid Gland Tissue Stensen's Duct Parotid Duct A small, tubular passageway carrying saliva from the parotid gland to the oropharynx. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33277 Parotid Duct T-Cell Zone of the Spleen T-Cell Zone of Spleen Periarteriolar Lymphoid Sheath http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33294 Periarteriolar Lymphoid Sheath Perilymph The bodily fluid that fills the space between the bony labyrinth and the membranous labyrinth of the inner ear. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33297 Perilymph Peripheral Zone of the Prostatic Parenchyma PZ Prostatic parenchyma that occupies the posterior and lateral aspects of the prostate gland. The glandular architecture consists of small, round acini amid loosely woven, randomly oriented stroma. The peripheral zone contains large, so-called main glands, whose ducts run posteriorly to open into the urethra. Approximately 70% of the prostate gland lies in the peripheral zone. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33308 Peripheral Zone of the Prostatic Parenchyma Perisinusoidal Space Space of Disse The area between hepatocytes and the epithelium lining the sinusoids of the liver. The space contains reticular fibers and microvilli from the hepatocytes. Proteins produced by the hepatocytes are transferred to the blood via the perisinusoidal space as blood fluids easily move through the epithelium and microvilli. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33309 Perisinusoidal Space Periurethral Zone of the Prostatic Parenchyma The inner most portion of the prostatic parenchyma surrounding the mid and proximal portions of the prostatic urethra where the ejaculatory ducts enter the urethra. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33311 Periurethral Zone of the Prostatic Parenchyma nasopharyngeal tonsil tonsilla pharyngealis tonsil of Luschka pharyngeal tonsil TONSIL, PHARYNGEAL PHARYNGEAL TONSIL Pharyngeal Tonsil Tonsil (Pharyngeal) Adenoid adenoid A fold of lymphatic tissue covered by ciliated epithelium at the very back of the nose, in the roof of the nasopharynx. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33318 Pharyngeal Tonsil Portal Triad An anatomical unit of hepatic tissue, composed of an interlobular vein of liver, an interlobular artery of liver and an interlobular bile duct. The triads are embedded in the interlobular connective tissue and travel together throughout the liver parenchyma. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33342 Portal Triad Prostatic Duct Tissue Simple columnar epithelial tissue of the small canals that transport prostatic secretions from the glandular tubules to the urethra. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33407 Prostatic Duct Tissue Prostatic Tissue Prostatic Parenchyma Tissue composed of tubuloalveolar glands embedded in fibromuscular stroma. The stroma is smooth muscle separated by strands of connective tissue rich in collagenous and elastic fibers. The secretory alveoli of the prostate are irregularly shaped with papillary projections of the mucosa into the lumen of the gland. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33414 Prostatic Tissue Pulmonary Lobule The smallest anatomical unit of the lung, measuring 0.50 to 2.00 cm in diameter. Each lobule is composed of 4-8 terminal bronchioles and their distal alveolar ducts and sacs. The lobules are separated by fibrous interlobular septa. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33428 Pulmonary Lobule Pyloric Gland The coiled tubular glands that produce mucous and gastrin located around the pylorus in the stomach. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33431 Pyloric Gland Renal Tissue Tissue composed of the renal cortex and the renal medulla. The basic functional unit of renal tissue is the nephron. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33461 Renal Tissue Fallopian Tube, Right Right Fallopian Tube The fallopian tube that extends from the uterus to the ovary in the right side of the pelvic cavity. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33475 Right Fallopian Tube LUNG, RIGHT Right Lung The 3-lobed lung located on the right side of the body. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33483 Right Lung Right Lymphatic Duct A lymphatic vessel that drains lymph from the right side of the head and neck, the right arm, and the right thoracic cavity. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33484 Right Lymphatic Duct Right Ovary Ovary, Right The ovary that is located in the right side of the pelvis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33487 Right Ovary Salivary Gland Tissue Tissue consisting of mucous or serous secreting epithelial tissue, connective tissue, blood vessels, nerves and lymphatic tissue. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33509 Salivary Gland Tissue SEBACEOUS GLAND GLAND, SEBACEOUS Sebaceous Gland Small glands located within the epidermis, and associated with the hair follicle, that produce and secrete an oily substance that lubricates the skin and hair. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33519 Sebaceous Gland Sebaceous Gland Duct The small tube that carries sebum from the sebaceous gland to the hair follicle or skin. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33520 Sebaceous Gland Duct Semicircular Duct The membranous tube that is located within the osseous semicircular canal. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33528 Semicircular Duct Seminal fluid Seminal Fluid SEMINAL FLUID seminal fluid Part of the ejaculated fluid. It contains secretions from the seminal vesicles, Cowper's gland, and prostate gland. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33529 Seminal Fluid Small Bowel Mucosa organ mucosa of small bowel small intestine mucosa of organ mucosa of organ of small intestine small bowel mucosa Small Intestinal Mucosa tunica mucosa intestini tenuis small intestine mucous membrane mucosa of small bowel small bowel mucosa of organ SMALL INTESTINAL MUCOSA tunica mucosa (intestinum tenue) small intestinal mucosa small intestine mucosa mucous membrane of small bowel mucosa of small intestine mucosa of organ of small bowel small bowel organ mucosa small bowel mucous membrane mucous membrane of small intestine small intestine organ mucosa organ mucosa of small intestine Mucosa arranged into two fundamental structures - villi and crypts of Lieberkuhn. Villi are projections into the lumen of the small intestine, covered with simple columnar epithelium. Crypts of Lieberkuhn are moat-like invaginations of the epithelium around the villi that extend through the lamina propria down to the muscularis mucosae. Lymphocytes often invade the epithelium or form solitary lymphoid nodules in the lamina propria. Lymph nodules may form longitudinal aggregations of 30-50 nodules in the lamina propria of the ileum. These large aggregations are called Peyer's patches. The muscularis mucosae has two layers and extends into the intestinal villi, where the smooth muscle cells form a longitudinal bundle in the centre of the villi. The small intestinal mucosa secretes gastrin, somatostatin, cholecystokinin and secretin. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33568 Small Intestinal Mucosa Small Intestinal Muscular Coat Muscular coat consisting of two layers of smooth muscle - an external, longitudinal, and an internal, circular layer. The longitudinal fibers are thinly scattered over the surface of the small intestine, and are more distinct along its free border. The circular fibers form a thick, uniform layer, and are composed of plain muscle cells of considerable length. The muscular coat is thicker at the upper than at the lower part of the small intestine. Interstitial cells of Cajal are present in the small intestinal muscular coat. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33569 Small Intestinal Muscular Coat Small Intestinal Serosal Surface The thin outermost layer of loose connective tissue covering the outer surface of the small intestine. It is derived from the peritoneum. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33571 Small Intestinal Serosal Surface Small Intestinal Wall Tissue The tissue of the small intestine. It comprises four layers - mucosa with simple columnar epithelium, submucosa, smooth muscle with inner circular and outer longitudinal layers, and serosa. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33573 Small Intestinal Wall Tissue SMEGMA Smegma A white secretion of the sebaceous glands of the foreskin. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33574 Smegma Splenic Cord Splenic Lymphoid Follicle B-Cell Zone of Spleen B-Cell Zone of the Spleen http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33602 Splenic Lymphoid Follicle Splenic Pulp Splenic Sinus Splenic Trabecula Striated Duct A type of intralobular duct, which is found in some salivary glands, and which is lined by low columnar epithelial cells that have characteristic basal striations, which are formed by regions of basal membrane invaginations with mitochondrial accumulation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33635 Striated Duct Submandibular Duct Wharton's Duct A small, tubular passageway that transports saliva from the submandibular gland into the floor of the mouth, exiting adjacent to the lingual frenulum. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33649 Submandibular Duct Superior Parathyroid Gland Either of two paired parathyroid glands closest to the head. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33691 Superior Parathyroid Gland SUDORIFEROUS GLAND Sweat Gland The small coiled tubes in the skin that produce and secrete sweat. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33712 Sweat Gland Sweat Gland Duct The small tube that drains sweat from the sweat gland to the skin. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33713 Sweat Gland Duct FLUID, SYNOVIAL Synovial Fluid SYNOVIAL FLUID Fluid, Joint Fluid, synovial (Joint fluid) Synovia A viscid fluid secreted by the synovial membrane, serving as a lubricant. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33718 Synovial Fluid TEAR Tear A fluid containing oils, mucin, and proteins, which is secreted by the lacrimal gland and cleans and lubricates the eye. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33739 Tear Thoracic duct structure (body structure) Thoracic Duct The largest lymphatic vessel in the body, originating at the cisternal chyli and emptying into the junction of the left internal jugular and subclavian veins. It receives lymph from the entire body, with the exception of the right upper limb, the right side of the head and neck, and the right upper thorax. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33768 Thoracic Duct Thymic Lobule A structure in a lobe of the thymus 0.5 -2 mm in diameter. The lobule is divided into an outer cortex and inner medulla. Lobules are separated from each other by connective tissue septa, however, the medullary tissue is continuous from lobule to lobule. Lymphocytes, reticular cells and macrophages are found in the lobules. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33772 Thymic Lobule Thymic Trabecula Thymic Trabeculae http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33773 Thymic Trabecula Thymus Cortex http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33774 Thymus Cortex Thymus Medulla http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33775 Thymus Medulla Thyroid Gland Tissue The tissue that forms the thyroid gland. Its main component is the thyroid follicle. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33785 Thyroid Gland Tissue Transitional Zone of the Prostatic Parenchyma TZ The zone of the prostatic parenchyma that surrounds the proximal urethra. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33803 Transitional Zone of the Prostatic Parenchyma Utriculosaccular Duct A channel located in the membranous labyrinth of the inner ear that connects the saccule to both the utricle and to the endolymphatic duct. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33845 Utriculosaccular Duct White Matter WHITE MATTER TISSUE The nerve tissue forming the bulk of the deep parts of the brain and the superficial parts of the spinal cord. It is composed of nerve cell processes, i.e. extensions (axons), which connect various grey matter areas of the brain to each other and carry nerve impulses to and from the nerve cell bodies within the central nervous system (neurons). Cerebral and spinal white matter does not contain dendrites. White matter is distinguished in that it is composed of axonal nerve fibers covered by a myelin sheath. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33892 White Matter Other Anatomic Concept Other Anatomy Concept http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33904 Other Anatomic Concept Thymic Tissue Tissue composed of a highly cellular outer cortex, and less cellular inner medulla. Both cortex and medulla contain epithelial cells, interdigitating dendritic cells, macrophages, and lymphocytes. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33952 Thymic Tissue Right Kidney A bean-shaped retroperitoneal organ situated below the diaphragm and posterior to the liver. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C34005 Right Kidney Left Kidney A bean-shaped retroperitoneal organ situated below the diaphragm and posterior to the spleen. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C34006 Left Kidney Exocrine Gland Fluid or Secretion http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C34062 Exocrine Gland Fluid or Secretion Splenic Tissue Vernix Caseosa Vernix A white cheese-like protective material that covers the skin of a fetus. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C34328 Vernix Caseosa Lupus Erythematosus Cell LE Cell The lupus erythematosus cell, which is likely a neutrophil with denatured nuclei. It may be found in blood, bone marrow, synovial fluid, cerebrospinal fluid, pericardial and pleural effusions of individuals with lupus erythematosus. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C36716 LE Cell Cytomegalic Cell An abnormal cell that contains intranuclear and intracytoplasmic cytomegalovirus inclusion bodies. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C36735 Cytomegalic Cell Abnormal Epithelial Cell http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C36745 Abnormal Epithelial Cell Metaplastic Cell http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C36786 Metaplastic Cell Abnormal Mesothelial Cell http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C36829 Abnormal Mesothelial Cell Abnormal Connective and Soft Tissue Cell http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C36843 Abnormal Connective and Soft Tissue Cell Abnormal Hematopoietic and Lymphoid Cell http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C36987 Abnormal Hematopoietic and Lymphoid Cell ALIVE Alive Live Living alive Showing characteristics of life; displaying signs of life. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C37987 Alive Personality The complex of all the attributes——behavioral, temperemental, eemotional and mental——that characterize a unique individual. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C38002 Personality PERICARDIAL CAVITY Pericardial Cavity BODY CAVITY, PERICARDIAL The potential body space formed between the parietal and visceral layers of the pericardial sac. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C38662 Pericardial Cavity Disease Pathway A sequence of biological or biocheemical events that are manifest during the course of a disease. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C39701 Disease Pathway Cell Motility Pathway An elaboration of the known steps and interactions reequired to allow cell movement. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C39703 Cell Motility Pathway Cell Differentiation or Development Pathway A sequence of biological or biochemical events that are involved in embryological or cellular development. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C39704 Cell Differentiation or Development Pathway DNA Repair Pathway A sequence of biological or biochemical events that play a role in DNA repair. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C39705 DNA Repair Pathway Genetic Information Processing Pathway Genetic Information Processing A sequence of biological or biochemical events that are involved in the conversion of genetic information into physiologically active molecules, such as functional RNA and proteins. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C39736 Genetic Information Processing Pathway Gene Physical Location position The physical location of a gene expressed as chromosome and start and end base positions. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C40342 Gene Physical Location Hematopoietic and Lymphatic System The bodily system of organs and tissues, primarily the bone marrow, spleen, tonsils, and lymph nodes, involved in the production of blood considered together with the interconnected system of spaces and vessels between body tissues and organs by which lymph circulates throughout the body. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C41165 Hematopoietic and Lymphatic System HEMOLYMPHORETICULAR TISSUE Hematopoietic And Lymphoid Tissue Hematopoietic and Lymphoid Tissue Any of the tissues that contain hematopoietic cells and/or lymphocytes and immune system cells. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C41168 Hematopoietic, Splenic and Lymphoid Tissue Nerve Tissue, Neuroepithelial Tissue, and Nerve Sheaths The basic components of the nervous system. They contain neurons, supporting cells, and neuroepithelial cells. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C41406 Nerve Tissue, Neuroepithelial Tissue, and Nerve Sheaths Neuroepithelial Tissue Tissue composed of neuroepithelial cells. The latter include astrocytes, oligodendrocytes, ependymal cells, neuroblasts, and olfactory receptor cells. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C41409 Neuroepithelial Tissue Nerve Tissue and Nerve Sheaths Tissues that contain neurons and supporting cells that form the covers encircling nerves, nerve fibers, and axons. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C41443 Nerve Tissue and Nerve Sheaths Insert Site Cloning Site Insertion Site The specific restriction enzyme site within a vector into which an insert was placed. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C43458 Cloning Site Hepatobiliary Tissue http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C43614 Hepatobiliary Tissue Bile Duct Tissue The tissue that forms the bile duct wall. It is lined by epithelium. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C43615 Bile Duct Tissue Bile Duct Epithelium The epithelium of the bile duct, which consists of cuboidal cells called cholangiocytes. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C43616 Bile Duct Epithelium Intrahepatic Bile Duct Epithelium Epithelium composed of one or more layers of glandular epithelial cells and a basement membrane lining the lumen of the intrahepatic bile duct. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C43617 Intrahepatic Bile Duct Epithelium Extrahepatic Bile Duct Epithelium http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C43618 Extrahepatic Bile Duct Epithelium Nucleotide Sequence NUCLEOTIDE SEQUENCE Sequence The sequence of nucleotide residues along an RNA or DNA chain. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C45374 Nucleotide Sequence Male Gender, Self Reported Male Gender Male Gender, Self Report Male An individual who reports belonging to the cultural gender role distinction of male. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C46109 Male Gender Female Gender, Self Report Female Gender, Self Reported Female Gender Female An individual who reports belonging to the cultural gender role distinction of female. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C46110 Female Gender Cross Linked Cross Link Crosslink Any covalent linkage between two polymers or between two different regions of the same polymer. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C47936 Cross Link Helix A structure consisting of something wound in a continuous series of loops. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C47937 Helix DNA Replication Fork DNA replication is a process that allows two new double helixes of DNA to be created from one double helix. During replication, Y-shaped regions of replicating DNA molecules are mobilized, where the enzymes replicating a DNA molecule bind to an untwisted, single DNA strand. This Y-shaped region is referred to as a replication fork. Bacteria and viruses only process one replication fork at a time, while eukaryotic DNA has many replication forks moving along DNA strands at the same time. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C48196 DNA Replication Fork Regulatory Process Regulation Aprocess that acts to control the rate or manner in which another process progresses or a product is formed. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C48805 Regulatory Process Regional Lymph Node Xanthomatous Cell http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C49071 Xanthomatous Cell Intercalated Duct of the Salivary Gland System The tiny tubules with a very thin epithelial layer in the salivary glands running from the salivary acini into the striated duct. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C49266 Intercalated Duct of the Salivary Gland System Intercalated Duct of the Pancreas The tiny tubules with a very thin epithelial layer in the pancreas running from the pancreatic acini into the striated duct. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C49267 Intercalated Duct of the Pancreas Left Adrenal Gland The adrenal gland located on the left side of the body. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C49322 Left Adrenal Gland Left Testis The testis on the left side of the body. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C49323 Left Testis Left Ureter The ureter connecting the left kidney to the bladder. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C49324 Left Ureter Right Adrenal Gland The adrenal gland located on the right side of the body. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C49325 Right Adrenal Gland Right Testis The testis on the right side of the body. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C49326 Right Testis Right Ureter The ureter connecting the right kidney to the bladder. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C49327 Right Ureter Retina Layer EYE, RETINA The tissue that constitutes the retina. It is composed of the following layers: ganglion cell layer, inner limiting membrane, inner nuclear layer, inner plexiform layer, layer of the ophthalmic nerve fibers, layer of the rods and cones, neural retina, outer limiting membrane, outer nuclear layer, outer plexiform layer, and retinal pigment epithelium. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C49328 Retina Layer Intestinal Wall Tissue INTESTINAL WALL The tissue that forms the wall of the small and large intestine. It consists of mucosa, submucosa, muscular coat, and serosal surface. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C49478 Intestinal Wall Tissue Splenic Germinal Center Spleen Germinal Center http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C49760 Splenic Germinal Center Marginal Zone http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C49767 Marginal Zone Hospitalization Required Required hospitalization Patient_was_hospitalized A patient condition where evaluation and/or treatment in a hospital is considered mandatory. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C50414 Hospitalization Required Nasal Mucus http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C52551 Nasal Mucus Seminal Vesicle Secretion http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C52552 Seminal Vesicle Secretion Prostate Gland Secretion http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C52553 Prostate Gland Secretion Bulbourethral Gland Secretion The clear viscous liquid produced by the bulbourethral (Cowper) gland that lubricates the urethra in preparation for the passage of sperm. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C52554 Bulbourethral Gland Secretion Esophagus Secretion http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C52555 Esophagus Secretion Ovarian Follicle Fluid http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C52556 Ovarian Follicle Fluid Abnormal Germ Cell http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C54103 Abnormal Germ Cell Restriction Enzyme Site Restriction Site Restriction Enzyme Recognition Site A sequence in DNA that can be recognized by a specific restriction enzyme. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C54666 Restriction Site Restriction Enzyme Cut Site Restriction Enzyme Cleavage Site The specific DNA base that is cut by a specific restriction enzyme. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C54667 Restriction Enzyme Cleavage Site Gene Feature Physical Location The physical location of a gene feature expressed as chromosome and start and end base positions. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C54670 Gene Feature Physical Location Blood Type The sepecific reaction pattern of erythrocytes of an individual to the antisera of one blood group. The blood type is the genetic phenotype of the individual for one blood group system and may be determined using different antisera available for testing. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61009 Blood Type Archaebacteria Mendosicutes Metabacteria Archaea Single-celled organisms lacking nuclei, similar to prokaryotes in most aspects of cell structure and metabolism. However, their genetic transcription and translation do not show the typical bacterial features, but are extremely similar to those of eukaryotes. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61092 Archaea Reading Frame Frame One of the three possible ways of reading a nucleotide sequence. As the genetic code is read in nonoverlapping triplets (codons) there are three possible ways of translating a sequence of nucleotides into a protein, each with a different starting point. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C63552 Reading Frame Carboxyl Group Carboxy Carboxyl The univalent radical -COOH; present in and characteristic of organic acids. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C64369 Carboxyl Group Hydroxyl Group Hydroxy Hydroxyl The monovalent group -OH in such compounds as bases and some acids and alcohols. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C64370 Hydroxyl Group Amine Group Amine The univalent hydrocarbon radical -NH2. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C64371 Amine Group Genomic Feature Physical Location The physical location on a specified chromosome of a feature or area of interest expressed as a base pair position. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C64389 Genomic Feature Physical Location Never Smoker Never Smoked Never smoker Lifelong Non-Smoker Non-Smoker A person who has never smoked at the time of the interview or has smoked less than 100 cigarettes in their life. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C65108 Never Smoker Daily Smoker Current every day smoker Every Day Smoker Current Every Day Smoker Every day Indicates a person who has smoked at least 100 cigarettes in his or her lifetime and who currently smokes every day. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C67145 Current Every Day Smoker Non-Daily Smoker Occasional Smoker Some Day Smoker Current Some Day Smoker Current some day smoker Chipper Some days Indicates a person who has smoked at least 100 cigarettes in his or her lifetime, who smokes now, but does not smoke every day. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C67146 Current Some Day Smoker Current Smoker Smoker An adult who has smoked 100 cigarettes in his or her lifetime and who currently smokes cigarettes. Includes daily smokers and non-daily smokers (also known as occasional smokers). http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C67147 Current Smoker Prior Smoker Former smoker Former Smoker A person who has quit smoking at the time of the interview but has smoked at least 100 cigarettes in their life. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C67148 Former Smoker Smoker, current status unknown Smoker, Current Status Unknown Indicates a person who is known to have smoked but whose current smoking status is unknown. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C67150 Smoker, Current Status Unknown Unknown If Ever Smoked Unknown if ever smoked Indicates that a person's smoking status is unknown. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C67151 Unknown If Ever Smoked Inpatient Hospitalization or Prolongation of Existing Hospitalization Required Hospitalization or Prolongation of Existing Hospitalization Required SHOSP An indication or description that an extended period of hospitalization is necessary. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C68605 Hospitalization or Prolongation of Existing Hospitalization Required Persistent or Significant Disability or Incapacity SDISAB An indication or description of a continuing and significant impairment. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C68606 Persistent or Significant Disability or Incapacity Current or Former Smoker Smoker A person who inhales or has inhaled combustible products of organic material during their lifetime. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C68751 Smoker Methylase Recognition Site DNA Methylation Site Methylation Site A sequence in DNA that can be recognized by a specific methylase enzyme and that contains the specific base target for methyl transfer. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C68801 Methylation Site PERITONEAL FLUID FLUID, PERITONEAL Peritoneal Fluid peritoneal fluid The small amount of fluid that is generated in the abdominal cavity to lubricate the peritoneum. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C77612 Peritoneal Fluid CRANIAL CAVITY BODY CAVITY, CRANIAL Intracranial Cavity Cranial Cavity The atrium that is formed by the bones of the skull and containing the brain. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C77638 Cranial Cavity Protist Protista A taxonomic kingdom that includes algae, protozoa, slime molds, and water molds. Members of kingdom protista are aerobic and may be unicellular, multicellular, or colony forming. Additionally, protista require a water-based environment to survive. All protista are true eukaryotes with a nuclear membrane and mitochondria. Some protista also contain chloroplasts and can perform photosynthesis. Protists reproduce by mitosis or meiosis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C77914 Protista Left Ear The organ of hearing located on the left side of the head. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C81259 Left Ear Right Ear The organ of hearing located on the right side of the head. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C81285 Right Ear Blood Product Any natural or synthetic composition that replicates the structure or function of a native component of blood. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C81304 Blood Product Body Weight body weight patient weight patient_weight Weight weight BW The weight of a patient. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C81328 Body Weight Atypical Cell of Undetermined Significance Atypical Cell of Uncertain Significance http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C8445 Atypical Cell of Undetermined Significance Cardiorespiratory Fitness The ability of the heart and lungs to deliver blood and oxygen to the tissues during aerobic activity. It is a general measure of the relative conditioning of the heart and respiratory system. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C88164 Cardiorespiratory Fitness RNA Sequence Sequence The sequence of nucleotide residues along an RNA chain. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C89252 RNA Sequence Holliday Junction Holliday Structure A DNA structure formed between similarly oriented, homologous DNA double strands in which a single strand from one duplex crosses over to base pair with the complimentary strand on the other duplex, generating a cruciform structure. Such structures are an intermediate in homologous recombination that is conserved from yeast to humans. The branches of a Holliday junction are ordinarily resolved by cleavage of two of the DNA strands. This yields double stranded daughter DNA duplexes with combinations of genes that may be unique from those of the parent duplexes. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C89779 Holliday Junction Drug Pathway An eleboration of a sequence of physiological events that are elicited by the administration of a drug. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C91821 Drug Pathway Oropharyngeal Tissue Tissue that occupies the area between the soft palate and upper portion of the epiglottis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C92600 Oropharyngeal Tissue Chyle chyle http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C93166 Chyle Phlegm phlegm A viscous body substance produced by the mucous membranes of the respiratory system. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C93171 Phlegm methyl group Methyl Group The chemical compound composed of a carbon atom bonded to three hydrogen atoms. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C93239 Methyl Group acetyl group Acetyl Group http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C93240 Acetyl Group Gastric Acid gastric acid http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C94192 Gastric Acid Blood Glucose blood sugar glycemia Glucose present in circulating blood. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C94312 Blood Glucose Genetic Hotspot Hotspot hotspot A genetic sequence at which mutations occur with an unusually high frequency. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C94367 Genetic Hotspot Isomer isomer One of two or more compounds that have the same chemical formula but different arrangements of the atoms within the molecules and that may have different physical/chemical properties. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C94419 Isomer Breath The air that is inhaled and exhaled during respiration. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C94552 Breath Base Pair base pair The paired nucleotides in a DNA or RNA sequence. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C94634 Base Pair Intrathyroidal Parathyroid A parathyroid gland embedded within the thyroid gland parenchyma. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C96188 Intrathyroidal Parathyroid blood poisoning Systemic Sepsis Sepsis Syndrome Sepsis Septicemia sepsis septicemia toxemia Sepsis is defined as life-threatening organ dysfunction caused by a dysregulated host response to infection (Singer M, et al. The Third International Consensus Definitions for Sepsis and Septic Shock (Sepsis-3). JAMA. 2016 Feb 23;315(8):801-10). The presence of pathogenic microorganisms in the blood stream causing a rapidly progressing systemic reaction that may lead to shock. Symptoms include fever, chills, tachycardia, and increased respiratory rate. It is a medical emergency that requires urgent medical attention. Singer M, Deutschman CS, Seymour CW, Shankar-Hari M, Annane D, Bauer M, Bellomo R, Bernard GR, Chiche JD, Coopersmith CM, Hotchkiss RS, Levy MM, Marshall JC, Martin GS, Opal SM, Rubenfeld GD, van der Poll T, Vincent JL, Angus DC. The Third International Consensus Definitions for Sepsis and Septic Shock (Sepsis-3). JAMA. 2016 Feb 23;315(8):801-10. doi: 10.1001/jama.2016.0287. PMID: 26903338; PMCID: PMC4968574. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C3364 Sepsis ABO_blood_group ABO blood group system ABO type A system used to group human blood into different types, based on the presence or absence of certain markers on the surface of red blood cells. The four main blood types are A, B, O, and AB. For a blood transfusion, the ABO blood group system is used to match the blood type of the donor and the person receiving the transfusion. People with blood type O can donate blood to anyone and are called universal donors. People with blood type AB can accept blood from all donors and are called universal recipients. People with type A or B can receive matching blood or type O blood. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C76245 ABO blood group Active_Site Active Site The catalytic site of an enzyme, the part of an enzyme where the actual enzymatic function is performed. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C47935 Active Site Acute_Physiology_and_Chronic_Health_Evaluation_II_Clinical_Classification Acute Physiology and Chronic Health Evaluation II Clinical Classification APACHE II APCH1 A standardized rating scale developed by Knaus et al in 1985, which is a classification system used to measure severity of disease. This instrument uses a point score system based on physiological measurements, age and previous health status. Acute Physiology and Chronic Health Evaluation II (APACHE II) (Knaus WA, Draper EA, Wagner DP, Zimmerman JE. APACHE II: a severity of disease classification system. Critical Care Medicine 1985; 13(10):818-29). CDISC believes this instrument to be in the public domain, but you should perform your own assessment. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C121005 Acute Physiology and Chronic Health Evaluation II Clinical Classification Acyclovir 9-[(2-Hydroxyethoxy)-methyl]guanine Wellcome-248U 2-Amino-1,9-dihydro-9-[(2-hydroxyethoxy)methyl]-6H-purin-6-one 9-[(2-Hydroxyethoxy)methyl]guanine Acycloguanosine ACV ACYCLOVIR Acicloftal Aciclovir Aclovir Acyclovir BW-248U Cargosil Virorax Zovirax acyclovir A synthetic analog of the purine nucleoside, guanosine, with potent antiviral activity against herpes simplex viruses type 1 and 2, varicella-zoster virus and other viruses of the herpesvirus family. After conversion in vivo to the active metabolite acyclovir triphosphate by viral thymidine kinase, acyclovir competitively inhibits viral DNA polymerase by incorporating into the growing viral DNA chain and terminating further polymerization. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C205 Acyclovir Acyltransferase Acyltransferase Acetyltransferase EC 2.3 Class of enzymes that catalyze the transfer of acyl groups, most commonly a carboxylic acyl group forming either esters or amides. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16259 Acyltransferase Adaptor_Signaling_Protein_Gene Adaptor Signaling Protein Gene Adapter Signaling Protein Gene Adaptor Protein Gene Adapter Protein Gene A class of genes that encode signaling pathway proteins that function to mediate the coupling of multiple cell surface receptors to downstream signaling pathways in the regulation of various cellular functions. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C25997 Adaptor Signaling Protein Gene Adefovir 9-(2-Phosphonylmethoxyethyl)adenine Phosphonylmethoxyethyl-a ADEFOVIR Adefovir GS-0393 PMEA A nucleoside reverse transcriptase inhibitor analog of adenosine with activity against hepatitis B virus (HBV), herpes virus, and human immunodeficiency virus (HIV). http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61526 Adefovir Adenosine_Diphosphate Adenosine 5'-Pyrophosphate ADP Magnesium ADP ADP, Magnesium Adenosine Pyrophosphate Adenosine 5' Pyrophosphate MgADP 5'-Pyrophosphate, Adenosine Diphosphate, Adenosine Pyrophosphate, Adenosine Adenosine 5'-(trihydrogen diphosphate) Adenosine 5'-(trihydrogen diphosphate). An adenine nucleotide containing two phosphate groups esterified to the sugar moiety at the 5'-position. http://purl.bioontology.org/ontology/MESH/D000244 Adenosine Diphosphate Adult_Sepsis Adult Sepsis Adult_Sepsis_Diagnostic_Biomarker Adult Sepsis Diagnostic Biomarker Adult Sepsis Diagnostic Biomarker Adult_Sepsis_Prognostic_Biomarker Adult Sepsis Prognostic Biomarker Adult Sepsis Prognostic Biomarker Adverse_Drug_Reaction adverse drug experience Adverse Drug Experience adverse drug reaction (ADR) Adverse Drug Reaction ADR Any detrimental or unintended response associated with the use of a medication in humans. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C142385 Adverse Drug Reaction African African Descent African Ancestry AFRICAN African Denotes a person with ancestral origins are in any of the countries of Africa. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C42331 African African_Caribbean African Caribbean African Caribbean Ancestry African Caribbean Descent AFRICAN CARIBBEAN Denotes a person of African ancestral origins whose family settled in the Caribbean region. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C41226 African Caribbean Agender Agender An individual who does not identify as having any gender. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C180329 Agender Alanine_Aminotransferase_Measurement Alanine Aminotransferase Alanine Aminotransferase Measurement Alanine aminotransferase ALT SGPT A quantitative measurement of alanine aminotransferase present in a sample. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C64433 Alanine Aminotransferase Measurement Albumin_Measurement Microalbumin Albumin Level Albumin Measurement ALB Albumin A quantitative measurement of albumin present in a sample. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C64431 Albumin Measurement Albumin_to_Globulin_Ratio_Measurement Albumin to Globulin Ratio Measurement Albumin/Globulin ALBGLOB The determination of the ratio of albumin compared to globulin in a blood sample. The measurement may be expressed as a ratio or percentage. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C74894 Albumin to Globulin Ratio Measurement Alcohol_Use_History Alcohol Use History alcohol history alcohol_history Alcohol Use Alcohol History A description of an individual's current and past experience with alcoholic beverage consumption. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C81229 Alcohol Use History Alkaline_Phosphatase_Measurement Alkaline Phophatase Alkaline Phosphatase Measurement Alkaline Phosphatase ALP A quantitative measurement of alkaline phosphatase present in a sample. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C64432 Alkaline Phosphatase Measurement Alpha_Chemokine C-X-C Chemokine Chemokine, CXC 4q Chemokine CXC Chemokine Alpha Chemokine Members of the Alpha-Chemokines are referred to also as the 4q chemokine family because the genes encoding members of this family map to human chromosome 4q12-21. The first two cysteine residues of members of this family are separated by a single amino acids and these proteins, therefore, are called also CXC-Chemokines. Some members of the subgroup of the human CXC-Chemokines are defined by the conserved ELR sequence motif (glutamic acid-leucine-arginine) immediately preceding the first cysteine residue near the amino-terminal end. Chemokines with an ELR sequence motif have been found to chemoattract and activate primarily neutrophils. Chemokines without the ELR sequence motif appear to chemoattract and activate monocytes, dendritic cells, T-cells, NK-cells, B-lymphocytes, basophils, and eosinophils. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20467 Alpha Chemokine Alveolar_Septum Interalveolar Septum Alveolar Septum Alveolar Septal Wall The tissue separating adjacent alveolar air spaces. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C49473 Alveolar Septum Amantadine AMANTADINE Amantadine A synthetic tricyclic amine with antiviral, antiparkinsonian, and antihyperalgesic activities. Amantadine appears to exert its antiviral effect against the influenza A virus by interfering with the function of the transmembrane domain of the viral M2 protein, thereby preventing the release of infectious viral nucleic acids into host cells. Furthermore, this agent prevents virus assembly during virus replication. Amantadine exerts its antiparkinsonian effects by stimulating the release of dopamine from striatal dopaminergic nerve terminals and inhibiting its pre-synaptic reuptake. This agent may also exert some anticholinergic effect through inhibition of N-methyl-D-aspartic acid (NMDA) receptor-mediated stimulation of acetylcholine, resulting in antihyperalgesia. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61632 Amantadine American_Indian_or_Alaska_Native american indian or alaska native AMERICAN INDIAN OR ALASKA NATIVE First Nations Native Americans AMERICAN_INDIAN_OR_ALASKA_NATIVE Native American American Indian or Alaska Native A person having origins in any of the original peoples of North and South America (including Central America) and who maintains tribal affiliation or community attachment. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C41259 American Indian or Alaska Native Amino-Terminal_Amino_Acid Amino-Terminal Amino Acid N-Terminal Amino Acid The amino acid residing in the first position of a protein or peptide. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C54120 Amino-Terminal Amino Acid Amino_Acid_Sequence Primary Protein Structure Amino Acid Sequence amino acid sequence Protein Sequence AMINO ACID SEQUENCE The sequence of amino acids along a polypeptide chain. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13187 Amino Acid Sequence Amino_Acids Acid, Amino Acids, Amino Amino Acid Organic compounds that generally contain an amino (-NH2) and a carboxyl (-COOH) group. Twenty alpha-amino acids are the subunits which are polymerized to form proteins. http://purl.bioontology.org/ontology/MESH/D000596 Amino Acids Aminoglycoside_Antibiotic Aminoglycoside Drugs aminoglycoside antibiotic Aminoglycoside Agents Aminoglycoside Antibiotic Aminoglycosides Any antibiotic containing amino-modified sugars originally isolated from various Streptomyces and Micromonospora species. Aminoglycoside antibiotics bind to the 16S RNA of the bacterial 30S ribosomal subunit, inhibiting translation and protein synthesis. Aminoglycoside use is associated with ototoxicity, neurotxicity and nephrotoxicity. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C2363 Aminoglycoside Antibiotic Ammonia Ammonia Solution, Strong AMMONIA Ammonia An inorganic compound composed of a single nitrogen atom covalently bonded to three hydrogen atoms that is an amidase inhibitor and neurotoxin. It is both manufactured and produced naturally from bacterial processes and the breakdown of organic matter. Ammonia is used in many industrial processes, and as a fertilizer and refrigerant. It is characterized as a colorless gas or compressed liquid with a pungent odor and exposure occurs by inhalation, ingestion, or contact. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C76698 Ammonia Amprenavir Carbamic acid, (3-(((4-aminophenyl)sulfonyl)(2-methylpropyl)amino)-2-hydroxy-1-(- phenylmethyl)propyl)-, tetrahydro-3-furanyl ester, (3S-(3R*(1S*,2R*)))-141W94 AMPRENAVIR Agenerase Amprenavir KVX 478 VX 478 A synthetic derivative of hydroxyethylamine sulfonamide that selectively binds to and inhibits human immunodeficiency virus (HIV) protease. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C28824 Amprenavir Analgesic_Agent Analgesic Agent Pain-relief Medication Analgesic Drugs Antinociceptive Agents Analgesics Anodynes analgesic Compounds that alleviate pain without loss of consciousness. Analgesics act by various mechanisms including binding with opioid receptors and decreasing inflammation. Choice of analgesic may be determined by the type of pain. These compounds include opioid, non-opioid and adjuvant analgesic agents. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C241 Analgesic Agent Anesthetic_Agent Anesthetics Anesthestic Drugs Anesthesia Agent Anesthetic Agent Anaesthetics Anaesthetic Agent Anesthetic Drugs Anesthetic anesthetic A pharmacological agent that acts in a reversible fashion and can be applied either locally or systemically to cause a partial or total loss of sensation and pain or to induce unconsciousness. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C245 Anesthetic Agent Angina Chest pain - cardiac Angina pectoris Angina Paroxysms of chest pain due to reduced oxygen to the heart. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C51221 Angina Angiogenesis_Promoter Angiogenesis Promoter Natural factors which stimulate blood vessel production. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C18574 Angiogenesis Promoter Angiopoietin-2_to_Angiopoietin-1_Ratio Angiopoietin-2 to Angiopoietin-1 Ratio Angpt-2/1 ratio Angiopoietin-2 to Angiopoietin-1 Ratio Anti-HIV_Agent Anti-Human Immunodeficiency Virus Agents Anti-HIV Agent Any agent that prevents the human immunodeficiency virus (HIV) from reproducing. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C1660 Anti-HIV Agent Anti-Infective_Agent Anti-Infective Agent Anti-Infective Agents AntiInfectives AntiInfective Drugs Anti-Infective Drugs Anti-Infectives AntiInfective Agents A pharmacological agent that can kill or prevent the reproduction of infectious organisms. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C254 Anti-Infective Agent Antibiotic Antimicrobial antimicrobial Antibiotic Drugs Antibiotics Antimicrobial Agent Antibiotic Therapy Antibiotic Agents Antibiotic antibiotic Substances naturally produced by microorganisms or their derivatives that selectively target microorganisms not humans. Antibiotics kill or inhibit the growth of microorganisms by targeting components of the microbial cell absent from human cells, including bacterial cell walls, cell membrane, and 30S or 50S ribosomal subunits. These substances are used in the treatment of bacterial and other microbial infections. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C258 Antibiotic Antibiotic_Treatment Antibiotic Treatment It is a treatment that is used to treat or prevent some types of bacterial infection. http://purl.obolibrary.org/obo/CAROLIO_0003310 Antibiotic Treatment Anticoagulant_Agent Anticoagulant medication administered for VTE prophylaxis Anticoagulation Therapy Anticoagulant Drugs blood thinner Anticoagulant Agent Anticoagulants anticoagulant Any agent capable of preventing blood clot formation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C263 Anticoagulant Agent Anticonvulsant_Agent Anticonvulsant Agent Anticonvulsant Agents Antiepileptics antiepileptic Antiepileptic Agent Anti-seizure agent anticonvulsant Anticonvulsants Medicine to stop, prevent, or control seizures (convulsions). http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C264 Anticonvulsant Agent Antifungal_Agent Antifungal Agent Antifungals Antifungal Drug Antifungal antifungal Substances that treat systemic or topical infections caused by fungi. Antifungal agents kill or inhibit the growth of fungi, by various mechanisms. These mechanisms include inhibition of fungal mitosis, impairing synthesis or binding to ergosterol, inhibition of RNA or DNA synthesis, and interfering with other fungal metabolic processes. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C514 Antifungal Agent Antihelminthic_Agent Anthelminthic Agent Antihelminthic Agent Anthelmintic Agent Antihelminthic Drugs Antihelminthics Anthelminthics Vermifuges A pharmacological agent that can kill or prevent the reproduction of parasitic helminths, including nematodes, flukes and tapeworms. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C250 Antihelminthic Agent Antimalarial_Agent Anti-Malarial Drug Antimalarials Antimalarial Drugs Anti-Malarial Agent Antimalarial Agent Agents used to treat malaria, and are usually classified based on action against plasmodia at different stages in their life cycle in the human. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C271 Antimalarial Agent Antiparasitic_Agent Antiparasitic Agent antiparasitic Antiparasitics Antiparasitic Antiparasitic Drugs Any agent that is effective against infections caused by parasitic organisms and is able to inhibit their growth or kill them. This class consists of anthelmintics and antiprotozoals. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C276 Antiparasitic Agent Antiplatelet_Agent Antiplatelet Agent An agent that inhibits platelet aggregation and reduces coagulation in the circulatory system. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C1327 Antiplatelet Agent Antiprotozoal_Agent Antiprotozoal Agent Antiprotozoal Drugs A pharmacological agent that can kill or prevent the reproduction of parasitic protozoans. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C277 Antiprotozoal Agent Antisepsis Antisepsis The destruction of germs causing disease. http://purl.bioontology.org/ontology/MESH/D000985 Antisepsis Antithrombin_Activity_Measurement Antithrombin III Activity Antithrombin Activity Measurement Antithrombin Activity ANTHRMA The determination of the amount of antithrombin activity in a sample. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C81958 Antithrombin Activity Measurement Antiviral_Agent Antiviral Agent Antiviral Antivirals antiviral Any agent that can treat or prevent viral infections by interfering with the viral replication cycle. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C281 Antiviral Agent Aphagia Unable to Eat Aphagia The inability or refusal to swallow. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C121623 Aphagia Apoptosis_Regulation_Gene Apoptosis Regulation Gene Apoptosis Regulation Genes encode Apoptosis Regulator proteins, which either promote or impede the initiation, progress, or rate of apoptosis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20462 Apoptosis Regulation Gene Apoptosis_Regulator Apoptosis Regulatory Protein Regulator of Apoptosis Apoptosis Regulator A protein that either promotes or impedes the initiation, progress, or rate of apoptosis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C19928 Apoptosis Regulator Arterial_Blood_Gas_Measurement Arterial Blood Gas Measurement Blood Gas Measurement Blood Gas Analysis ABG Measures the acidity (pH) and the levels of oxygen, carbon dioxide, and bicarbonate in the blood. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C71252 Arterial Blood Gas Measurement Asepsis Asepsis The prevention of access by infecting organisms to the locus of potential infection. http://purl.bioontology.org/ontology/MESH/D001207 Asepsis Asian Asian Ancestry ASIAN Asian Asians asian A person having origins in any of the original peoples of the Far East, Southeast Asia, or the Indian subcontinent, including for example, Cambodia, China, India, Japan, Korea, Malaysia, Pakistan, the Philippine Islands, Thailand, and Vietnam. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C41260 Asian Asian_American Asian American Asian Americans ASIAN AMERICAN Denotes a person having origins in any of the original peoples of the Far East, Southeast Asia, or the Indian subcontinent, and who was either born in the United States or who was naturalized as a citizen of the United States. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16310 Asian American Aspartate_Aminotransferase_Measurement Aspartate Aminotransferase Measurement Aspartate Aminotransferase AST SGOT A quantitative measurement of aspartate aminotransferase present in a sample. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C64467 Aspartate Aminotransferase Measurement Assessment_of_Consciousness_Level Assessment of consciousness level (procedure) http://purl.bioontology.org/ontology/SNOMEDCT/444714004 Assessment of Consciousness Level Australian Australian Denotes a person whose ancestry is in the country or continent of Australia. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C126535 Australian BCL-2_Gene_Family BCL-2 Gene Family The BCL-2 Gene Family encodes proteins that contain Bcl-2 homology (BH) domains (1, 2, 3, or 4), involved in interactions among apoptotic protein factors that participate in programmed cell death. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20409 BCL-2 Gene Family BCL2L1_Gene_Product BCL2L1 Gene Product A protein encoded by the human BCL2L1 gene. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C125668 BCL2L1 Gene Product Base_Excess_Measurement Base Excess Actual Base Excess Base Excess Measurement BASEEXCS The determination of the amount of the base excess in a biological specimen. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C119270 Base Excess Measurement Basic_Nasal_Oxygen_Cannula Basic nasal oxygen cannula (physical object) nasal oxygen cannula http://purl.bioontology.org/ontology/SNOMEDCT/466713001 Basic Nasal Oxygen Cannula Behavioral_Pain_Scale Behavioral Rating Scale Behavior Rating Scale BPS Behavioral Pain Scale A range of values designed to quantify the qualitative responses of an individual to a set of challenges. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C81235 Behavioral Pain Scale Beta-Lactam_Antibiotic Lactam Antibiotics Beta-Lactam Antibiotic A compound with a four member amide ring (beta-lactam), where one member is the amide nitrogen and another is the carbonyl carbon, with bactericidal activity. Beta-lactam antibiotics act by disrupting the synthesis of the peptidoglycan layer of the bacterial cell wall. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C260 Beta-Lactam Antibiotic Beta_Chemokine Beta Chemokine CC Chemokine Chemokine, CC C-C Chemokine Encoded by CC Cytokine Genes, Beta Chemokines are CC-type dual-cysteine chemokines with adjacent cysteine residues in their primary sequence that act as chemoattractants for lymphocytes, monocytes, eosinophils, and basophils, but not for neutrophils. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20476 Beta Chemokine Biochemical_Process Biochemical Process A linked series of non-equivalent biochemical interactions and enzymatic reactions, and/or a linked series of biochemical processes. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C28498 Biochemical Process Bispectral_index Bispectral index (assessment scale) http://purl.bioontology.org/ontology/SNOMEDCT/398204001 Bispectral index Black_or_African_American black or african american BLACK OR AFRICAN AMERICAN BLACK_OR_AFRICAN_AMERICAN Black or African American A person having origins in any of the Black racial groups of Africa. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16352 Black or African American Bleeding_Diathesis Bleeding Disorder Bleeding Diathesis Bleeding diathesis Bleeding Tendency Bleeding Predisposition A coagulation disorder characterized by a tendency for excessive bleeding. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C115221 Bleeding Diathesis Bleeding_Time Bleeding Time Clotting Time Homeostasis BLEEDT The amount of time it take for a cessation of bleeding. It is a measurement of the ability of capillaries and platelets to interact to form a blood clot. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C89775 Bleeding Time Blood_Cell_Count Full Blood Count complete blood count Complete Blood Count blood cell count Blood Cell Count CBC FBC The determination of the number of red blood cells, white blood cells, and platelets in a biospecimen. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C28133 Blood Cell Count Blood_Chemistry_Measurement Blood Chemistry Evaluation blood chemistry study Blood Chemistry Measurement Blood Chemistry Test Blood Chemistry Study The determination of the measured concentrations of chemical constituents of the blood by assay in a clinical laboratory. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C47868 Blood Chemistry Measurement Blood_Group_A Blood Group A Blood Type A A A blood group indicating the presence on erythrocytes of only the A form of the H Antigen. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C76246 Blood Group A Blood_Group_AB Blood Group AB Blood Type AB AB A blood group indicating the presence on erythrocytes of both the A and B forms of the H Antigen. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C76248 Blood Group AB Blood_Group_B Blood Group B Blood Type B B A blood group indicating the presence on erythrocytes of only the B form of the H Antigen. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C76247 Blood Group B Blood_Group_O Blood Group O Blood Type O O A blood group indicating the absence on erythrocytes of both the A and B forms of the H Antigen. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C76249 Blood Group O Blood_Pressure blood pressure Blood Pressure BP The pressure of the circulating blood against the walls of the blood vessels. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C54706 Blood Pressure Blood_Safety Safety, Blood Supply Activities involved in ensuring the safety of the blood for BLOOD TRANSFUSIONS including collecting information on BLOOD DONORS and recipients, collection, testing, and storage of the blood. http://purl.bioontology.org/ontology/MESH/D058731 Blood Safety Blood_Urea_Nitrogen_Measurement Blood Urea Nitrogen Measurement Blood Urea Nitrogen BUN A quantitative measurement of the amount of urea nitrogen present in a serum sample. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61019 Blood Urea Nitrogen Measurement Bradycardia Bradycardia An abnormally slow heart rate. Thresholds for different age, gender, and patient populations exist. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C37920 Bradycardia Breast Breast, NOS Breast structure (body structure) BREAST Breast Breasts breast One of two hemispheric projections of variable size situated in the subcutaneous layer over the pectoralis major muscle on either side of the chest. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12971 Breast Bronchus-Associated_Lymphoid_Tissue Bronchus-Associated Lymphoid Tissue BRONCHUS-ASSOCIATED LYMPHOID TISSUE BALT Lymphoid tissue located in the bronchi. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32234 Bronchus-Associated Lymphoid Tissue C-reactive_Protein_to_Albumin_Ratio C-reactive Protein to Albumin Ratio CRP/Albumin CRP/Albumin Ratio C-reactive Protein to Albumin Ratio CALCA_Gene_Product CALCA Gene Product A protein encoded by the CALCA gene. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C136376 CALCA Gene Product CC_Cytokine_Gene CC Cytokine Gene CC Cytokine Genes encode Beta Chemokines, CC-type dual-cysteine chemokines with adjacent cysteine residues in their primary sequence that act as chemoattractants for lymphocytes, monocytes, eosinophils, and basophils, but not for neutrophils. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C26009 CC Cytokine Gene CD4_Cell_to_CD8_Cell_Ratio_Measurement CD4 Cell to CD8 Cell Ratio Measurement The determination of the ratio of CD4 cells compared to CD8 cells present in a sample. The measurement may be expressed as a ratio or percentage. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C103814 CD4 Cell to CD8 Cell Ratio Measurement CD4_Expressing_Cell_Count CD4 Expressing Cell Count CD4 Count cd4 count cd4_count The determination of the amount of the CD4 expressing cells in a sample. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C103810 CD4 Expressing Cell Count CD8_Expressing_Cell_Count CD8 Expressing Cell Count The determination of the amount of the CD8 expressing cells in a sample. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C103811 CD8 Expressing Cell Count CDP-choline 5'-O-[hydroxy({[2-(trimethylammonio)ethoxy]phosphinato}oxy)phosphoryl]cytidine cytidine 5'-diphosphoric choline Cytidine 5'-diphosphocholine citicolinum cytidine 5'-(choline diphosphate) CDP-colina Citicoline cyticholine [2-CYTIDYLATE-O'-PHOSPHONYLOXYL]-ETHYL-TRIMETHYL-AMMONIUM citidin difosfato de colina Cytidindiphosphocholin cytidine 5'-(cholinyl pyrophosphate) citicolina CDP-CHO A member of the class of phosphocholines that is the chloine ester of CDP. It is an intermediate obtained in the biosynthetic pathway of structural phospholipids in cell membranes. http://purl.obolibrary.org/obo/CHEBI_16436 CDP-choline CHGA_Gene_Product CHGA Gene Product A protein encoded by the CHGA gene. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C136791 CHGA Gene Product COVID-19-Associated_Thromboembolism COVID-19-Associated Thromboembolism SARS-CoV-2-Associated Thromboembolism Thromboembolism caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C171563 COVID-19-Associated Thromboembolism CS Citrate Synthase CS Synthase, Citrate Citrate oxaloacetate-lyase ((pro-3S)-CH2COO(-)--acetyl-CoA) Citrate Synthase Enzyme that catalyzes the first step of the tricarboxylic acid cycle (CITRIC ACID CYCLE). It catalyzes the reaction of oxaloacetate and acetyl CoA to form citrate and coenzyme A. This enzyme was formerly listed as EC 4.1.3.7. http://purl.bioontology.org/ontology/MESH/D002950 Citrate Synthase CXC_Cytokine_Gene CXC Cytokine Gene CXC Cytokine Genes encode Alpha Chemokines, CXC-type dual-cysteine chemokines with paired cysteine residues separated by a non-cysteine residue in their primary sequence that act as chemoattractants for neutrophils, but not for monocytes. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C26010 CXC Cytokine Gene C_Reactive_Protein_to_Mean_Platelet_Volume_Ratio C-reactive Protein to Mean Platelet Volume Ratio CRP/MPV Ratio CRP/MPV C-reactive Protein to Mean Platelet Volume Ratio Cadherin Cadherin The cadherins are transmembrane glycoproteins involved in calcium dependent specific cell-cell adhesion through homophilic binding. They are crucial for morphogenesis and synapse formation, but also are involved in tumor invasion. The classical cadherins have five homologous extracellular domains and a cytosolic domain which binds through catenin to the cytoskeleton. The extracellular domains are immunoglobulin-like beta-sandwiches comprising usually 7 strands in the two sheets. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16373 Cadherin Calcium_Measurement Calcium Measurement CA Calcium A quantitative measurement of the amount of calcium present in a sample. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C64488 Calcium Measurement Cancer_Gene Cancer Gene Cancer-Promoting Gene Normal genes, that when altered or inappropriately expressed, contribute to malignant transformation, tumor progression, or metastasis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C19540 Cancer Gene Caprini_Risk_Score Caprini Risk Score http://purl.bioontology.org/ontology/MEDDRA/10079595 Caprini Risk Score Carbon_Dioxide_Measurement Carbon Dioxide Carbon Dioxide Measurement CO2 A quantitative measurement of the gas carbon dioxide present in a sample. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C64545 Carbon Dioxide Measurement Carbon_Monoxide_Measurement Carbon Monoxide Carbon Monoxide Measurement CMONOX The determination of the amount of carbon monoxide present in a sample. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C139084 Carbon Monoxide Measurement Carboxy-Terminal_Amino_Acid Carboxy-Terminal Amino Acid C-Terminal Amino Acid C-Terminal The amino acid residing in the last position of a protein or peptide. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C54121 Carboxy-Terminal Amino Acid Cardiac_Arrest Cardiac arrest Cardiac Arrest Heart Arrest Asystole The sudden cessation of cardiac activity in an individual who becomes unresponsive, without normal breathing and no signs of circulation. Cardiac arrest may be reversed by CPR, and/or defibrillation, cardioversion or cardiac pacing. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C50479 Cardiac Arrest Cardiogenic_Shock Cardiogenic shock Cardiogenic Shock Shock resulting from primary failure of the heart in its pumping function, as in myocardial infarction, severe cardiomyopathy, or mechanical obstruction or compression of the heart. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C50482 Cardiogenic Shock Cardiovascular_History Cardiovascular History A record of a patient's medical background regarding cardiovasular disease. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C66921 Cardiovascular History Cardiovascular_System_Signs_and_Symptoms Cardiovascular System Signs and Symptoms http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C37254 Cardiovascular System Signs and Symptoms Caribbean_Indian CARIBBEAN INDIAN Caribbean Indian Denotes a person having origins in one of the indigenous people of the Caribbean. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C77810 Caribbean Indian Cell-Free_DNA cell free DNA circulating cell free DNA cell free circulating DNA cfDNA DNA that is found in blood plasma and is not associated with cells in the circulation. [url:http://purl.obolibrary.org/obo/NCIT_C128274] DNA that is found in blood plasma and is not associated with cells in the circulation. [url:http://purl.obolibrary.org/obo/NCIT_C128274] Cell-Free DNA Cell_Adhesion_Molecule Adhesion Molecule Cell Adhesion Molecule CAM CAMs A diverse family of cell surface and extracellular glycoproteins involved in cell-cell adhesion, cell-extracellular matrix adhesion, recognition, and activation. There are four main classes of cell adhesion molecules: integrins, selectins, cadherins, and immunoglobulin-like adhesion molecules. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16393 Cell Adhesion Molecule Cell_Adhesion_Molecule_Gene Cell Adhesion Molecule Gene Cell Adhesion Molecule Genes encode diverse extracellular (e.g., laminin) and cell surface (e.g., NCAM) glycoproteins involved in cell-cell and cell-extracellular matrix adhesion, recognition, activation, tissue integration, wound healing, morphogenesis, and cellular migration. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20988 Cell Adhesion Molecule Gene Cell_Count Total Cells CELLS Cell Count Cells cell count cell_count A procedure to determine the number of cells in a sample. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C48938 Cell Count Cell_Culture_Procedure Cell Culture Procedure Any laboratory procedure for growing cells or tissues in vitro. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C116004 Cell Culture Procedure Cell_Cycle_Gene Cell Cycle Gene Cell Cycle Genes encode Cell Cycle Proteins, which control the cell division cycle. This family of proteins, classified on the basis of related function, includes a wide variety of classes, including cyclin-dependent kinases, mitogen-activated kinases, cyclins, and phosphoprotein phosphatases, as well as their putative substrates, such as chromatin-associated proteins, cytoskeletal proteins, and transcription factors. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20917 Cell Cycle Gene Cell_Cycle_Protein Cell Cycle Protein Proteins involved in the process of cell division. Numerous proteins of different functionality and type are involved in this process. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C17761 Cell Cycle Protein Cephalosporin_Antibiotic Cephalosporin Antibiotic cephalosporin Cephalosporins A synthetic or semi-synthetic beta-lactam antibiotic derived from Acremonium (Cephalosporium) fungi with bactericidal activity. Cephalosporin antibiotics bind to and inactivate penicillin-binding proteins (PBPs) located on the inner membrane of the bacterial cell wall. Inactivation of PBPs interferes with the cross-linkage of peptidoglycan chains necessary for bacterial cell wall strength and rigidity. This interrupts bacterial cell wall synthesis and results in the weakening of the bacterial cell wall, eventually causing cell lysis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C357 Cephalosporin Antibiotic Charlson_Comorbidity_Index Charlson Comorbidity Index CCI A method of predicting mortality risk or disease burden for patients with specific comorbid conditions. The conditions are assigned a weight from 1 to 6, based on ICD diagnosis codes, and these weights are summed to produce a single comorbidity score. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C176422 Charlson Comorbidity Index Chemerin Chemerin http://www.drugtargetontology.org/dto/DTO_09000017 Chemerin Chemistry_Test Chemistry Procedure Chemistry Test Chemistry Measurement Chemistry Technique A laboratory test designed for the quantification of an organic or inorganic chemical within a biological specimen. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C49237 Chemistry Test Chemokine SIS cytokines Chemotactic Cytokine Chemotactic Cytokines Intercrines Homologous Chemotactic Cytokines Chemokine Chemokines Intercrine Chemokines constitute a superfamily of small (8-10 kDa), inducible, secreted, pro-inflammatory cytokines that are involved in a variety of immune and inflammatory responses as well as in viral infection. Chemokines act primarily as chemoattractants and activators of specific types of leukocytes. Some members of this family were initially identified on the basis of their biological activities (e.g., IL-8, GRO), others were discovered using subtractive hybridization (e.g., RANTES) or signal sequence trap (e.g., PBSF/SDF-1)11 cloning strategies. They attract and activate leukocytes and regulate diverse cellular systems and organs ranging from blood vessels to the central nervous system. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20466 Chemokine Chemokine_Receptor Chemokine Receptor Encoded by Chemokine Receptor Genes (GPCR Family), cell surface Chemokine Receptors are seven-transmembrane G protein-coupled receptor glycoproteins that bind to chemokines and mediate the migration of pro-inflammatory cells. Like chemokines, the chemokine receptors can be divided, according to variations in a shared cysteine motif, into at least three structural branches: CR, CCR, and CXCR. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C18018 Chemokine Receptor Chemokine_Receptor_Gene Chemokine Receptor Gene Chemokine Receptor Genes (GPCR Family) encode cell surface Chemokine Receptors, seven-transmembrane G protein-coupled receptor glycoproteins that bind to chemokines and mediate the migration of pro-inflammatory cells. Like chemokines, the chemokine receptors can be divided, according to variations in a shared cysteine motif, into at least three structural branches: CR, CCR, and CXCR. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C25775 Chemokine Receptor Gene Chest_Pain thoracodynia thoracalgia Chest Pain Pain in the chest. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C38665 Chest Pain Chief_Complaint Presenting Complaint Main Complain Chief Complaint Primary Complaint CC The primary reason for a patient visit. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C85497 Chief Complaint Chills Chill Chills Shivering or moderate tremors of the body often accompanied by a cold sensation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C35143 Chills Chloride_Measurement Chloride Measurement CL Chloride A quantitative measurement of the amount of chloride present in a sample. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C64495 Chloride Measurement Cholesterol_Measurement Total Cholesterol Cholesterol Measurement Cholesterol CHOL The determination of the amount of total cholesterol present in a sample. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C105586 Cholesterol Measurement Chromogranin Chromogranin CHG Chromogranins are acidic secretory glycoproteins with a widespread but specific distribution in neuroendocrine tissues. The chromogranin family is heterogenous, consisting of propeptides such as chromogranin-A, chromogranin-B and secretogranin II, which can either elicit an effect themselves, or serve as precursors to a large number of peptides, which are biologically more active. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16436 Chromogranin Chromogranin_Gene Chromogranin Gene Chromogranin Genes encode Chromogranins, widespread heterogenous acidic soluble glycopropolypeptide constituents of neuroendocrine and chromaffin cell secretory granules that elicit an effect themselves or serve as precursors to many biologically active peptides. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C21200 Chromogranin Gene Chronic_Active_Inflammation Active Chronic Inflammation Chronic Active Inflammation The coexistence of a chronic inflammatory process with a superimposed polymorphonuclear neutrophilic infiltration. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C82901 Chronic Active Inflammation Chronic_Inflammation Chronic Inflammation An inflammatory process characterized by the presence of lymphocytes and plasma cells and the absence of polymorphonuclear neutrophils. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C174450 Chronic Inflammation Chronic_depressive_personality_disorder Chronic depressive personality disorder (disorder) http://purl.bioontology.org/ontology/SNOMEDCT/442057004 Chronic depressive personality disorder Clinical_Assessment_Indicator Clinical Assessment Clinical Assessment Indicator An indication that a finding or diagnosis was assigned based on clinical observations. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C199178 Clinical Assessment Indicator Clinical_Diagnosis Clinical Diagnosis A diagnosis made from a study of the signs and symptoms of a disease. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C15607 Clinical Diagnosis Clinical_Frailty_Scale Clinical Frailty Scale CFS Frailty A judgement-based tool to screen for frailty and to broadly stratify degrees of fitness and frailty in elderly people. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C185373 Clinical Frailty Scale Clinical_History Clinical History A clinical history section header on a form. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C159310 Clinical History Coagulation_Assessment Coagulation Assessment Coagulation Assessment Coagulation_Disorder Coagulation Defect Coagulopathy, specify Coagulopathy Coagulation Disorder Coagulation defect, unspecified A condition in which there is a deviation from or interruption of the normal coagulation properties of the blood. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C2902 Coagulation Disorder Coagulation_Disorder_Related_to_Liver_Dysfunction Coagulation Disorder Related to Liver Dysfunction Blood Coagulation Disorder due to Liver Disease Coagulation Defects due to Liver Disease A disorder of blood clotting that is attributable to a deficiency in liver function. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C101333 Coagulation Disorder Related to Liver Dysfunction Coagulation_Factor Blood Coagulation Factor Coagulation Factor Clotting Factor Factors in the blood that are essential for blood coagulation. The absence or mutation of these factors can lead to hemophilia and blood clotting disorders. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16354 Coagulation Factor Coagulation_Factor_Deficiency Coagulation Factor Deficiency Coagulation Factor Deficiency Syndrome Congenital or acquired deficiency of one of the coagulation factors. It results in bleeding. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C27215 Coagulation Factor Deficiency Coagulation_Factor_Gene Coagulation Factor Gene Coagulation Factor Genes encode endogenous Coagulation Factors, involved in blood coagulation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C28480 Coagulation Factor Gene Coagulation_Study Coagulation Study http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C62662 Coagulation Study Collagen_Gene Collagen Gene Collagen Genes encode different forms of Collagen, the principle fibrous protein of connective tissue, all consisting of triple helix alpha-polypeptide chains. Collagen is differentiated from other fibrous proteins by its content of proline, hydroxyproline, and hydroxylysine; by its absence of tryptophan; and by its high content of polar groups. Hydroxyproline residues likely promote the triple helical fibrous structure of collagen. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C26001 Collagen Gene Colony-Stimulating_Factor_Gene Colony-Stimulating Factor Gene Colony-Stimulating Factor Genes encode Colony-Stimulating Factors, autocrine or paracrine glycoprotein growth factors that act synergistically on several bone marrow progenitor cells to regulate myeloid differentiation and stimulate production of blood cells. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C26047 Colony-Stimulating Factor Gene Colony_Stimulating_Factor colony-stimulating factor Colony-Stimulating Factors MGI-1 Protein Colony Stimulating Factor Myeloid Cell-Growth Inducer CSF MGI-1 A substance that stimulates the production of blood cells. Colony-stimulating factors include granulocyte colony-stimulating factor (G-CSF), granulocyte-macrophage colony-stimulating factor (GM-CSF), and promegapoietin. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20586 Colony Stimulating Factor Coma Coma Comatose coma A state of profound unconsciousness associated with markedly depressed cerebral activity. Causes include central nervous system damage, intoxication, and metabolic abnormalities. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C34497 Coma Complication Medical Complication Complication Complications complication Any disease or disorder that occurs during the course of, or because of, another disease, treatment, or procedure. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C2959 Complication Computed_Tomography computerized tomography computed tomography Computerized axial tomography (procedure) computerized axial tomography Computerized Axial Tomography Computed Axial Tomography Computerized Tomography Computed Tomography CAT CAT Scan CAT scan CT CT SCAN CT Scan CT scan tomography A method of examining structures within the body by scanning them with X rays and using a computer to construct a series of cross-sectional scans along a single axis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C17204 Computed Tomography Confusion_Assessment_Method_for_the_Intensive_Care_Unit Confusion Assessment Method for the Intensive Care Unit confusion assessment method for the intensive care unit CAM‐ICU http://purl.jp/bio/4/id/200906058907715609 Confusion Assessment Method for the Intensive Care Unit Connective_and_Soft_Tissue_Injury Unspecified Tissue Injury Connective and Soft Tissue Injury Damage inflicted on the soft tissues and their supporting structures as the direct or indirect result of an external force, with or without disruption of structural continuity. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C98904 Connective and Soft Tissue Injury Consumptive_Coagulopathy Consumption Coagulopathy Consumptive Coagulopathy Disorders of coagulation caused by the depletion of coagulation factors in the peripheral blood. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C131658 Consumptive Coagulopathy Contact_Tracing Close Contact Epidemiology Partner Notifications Tracing, Contact Epidemiology, Index Patient Epidemiology, Patient Zero Patient Zero Epidemiology Notification, Partner Partner Notification Contact Investigation Person Under Investigation Epidemiology Screening, Contact Communicable Disease Contact Tracing Index Patient Epidemiology PUI Epidemiology Epidemiology, Close Contact Index Case Epidemiology Epidemiology, PUI Infectious Disease Contact Tracing Epidemiology, Index Case Investigation, Contact Contact Screening Identification of those persons (or animals) who have had such an association with an infected person, animal, or contaminated environment as to have had the opportunity to acquire the infection. http://purl.bioontology.org/ontology/MESH/D016358 Contact Tracing Controlling_Nutritional_Status Controlling Nutritional Status CONUT method CONUT Controlling Nutritional Status method http://purl.jp/bio/4/id/201306065103871321 Controlling Nutritional Status Cough Cough Coughing A sudden, often repetitive, spasmodic contraction of the thoracic cavity, resulting in violent release of air from the lungs, and usually accompanied by a distinctive sound. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C37935 Cough Creatine_Kinase Adenosine Triphosphate-Creatine Transphosphorylase ATP:Creatine N-Phosphotransferase Phosphocreatine Kinase Creatine Kinase ATP:Creatine Phosphotransferase Creatine Phosphotransferase Creatine Phosphokinase CK CPK An enzyme complex that can reversibly convert ATP and creatine to phosphocreatine and ADP. Cytosolic creatine kinases are comprised of homodimers or heterodimers of creatine kinase B-type protein and creatine kinase M-type protein. Mitochondrial creatine kinases are octomers comprised of either four homodimers of creatine kinase U-type, mitochondrial protein or four creatine kinase S-type, mitochondrial protein homodimers. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C113245 Creatine Kinase Critical_Care_Pain_Observation_Tool Critical Care Pain Observation Tool CPOT Critical Care Pain Observation Tool Crosslinked_Multimeric_Type_III_Procollagen_Propeptide Cross-Linked Multimeric PRO-C3 Crosslinked Multimeric Type III Procollagen N-Terminal Peptide Crosslinked Type III Procollagen N-Terminal Peptide Multimers Crosslinked Multimeric Type III Procollagen Propeptide Crosslinked Type III Procollagen Propeptide Multimers Cross-Linked Multimeric Type III Procollagen Propeptide XM-PRO-C3 Procollagen Type III amino-terminal propeptide PIIINP COL3A1 Crosslinked complexes comprised of multiple copies of the N-terminal propeptide derived from type III procollagen. Quantitation of the level of these peptides in blood samples may serve as a marker for liver fibrosis or steatosis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C176686 Crosslinked Multimeric Type III Procollagen Propeptide Cryoglobulin_Volume_to_Serum_Volume_Ratio_Measurement Cryoglobulin Volume to Serum Volume Ratio Measurement Cryoglobulin Volume/Serum Volume CRYGLBSR The determination of the ratio of cryoglobulin volume compared to serum volume present in a sample. The measurement may be expressed as a ratio or percentage. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C147325 Cryoglobulin Volume to Serum Volume Ratio Measurement Cystatin_Family_Gene Cystatin 2 Family Gene Cystatin Family Gene Cystatin Family Genes encode (Type 2) Cystatin proteins, secreted, tight, reversible, competitive inhibitors of cysteine proteinases that contain multiple cystatin-like sequences and have 2 intrachain disulfide bonds. Cystatin Superfamily Genes comprise three subfamilies that display structural and/or functional similarities: Stefins (Type 1 Cystatins), Cystatins (Type 2 Cystatins), and Kininogens. Some members are active cysteine protease inhibitors; others have lost or never acquired inhibitory activity. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20727 Cystatin Family Gene Cystatin_Superfamily_Gene Cystatin Superfamily Gene Cystatin Superfamily Genes comprise a single evolutionary superfamily that encode protein subfamilies with functional and structural similarities that include cystatin-like sequences: Stefins (Type 1 Cystatins), Cystatins (Type 2 Cystatins), and Kininogens. Some members are active cysteine protease inhibitors; others have lost or never acquired inhibitory activity. Cystatins are intracellular or extracellular, tight, reversible, competitive inhibitors of lysosomal cysteine proteinases, such as Cathepsins B, L, H, and S, that appear to provide a protective function. Type 1 Cystatins lack disulfide bridges. Type 2 Cystatins are secreted and have 2 intrachain disulfide bonds. Kininogens contain 3 cystatin-like domains, each with 2 disulfide bonds. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20726 Cystatin Superfamily Gene Cysteine_Proteinase_Inhibitor_Gene Cysteine Proteinase Inhibitor Gene Human Cysteine Proteinase Inhibitor Genes encode Cysteine Proteinase Inhibitors, endogenous proteins that hinder the function of cysteine proteinases. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20725 Cysteine Proteinase Inhibitor Gene Cytochrome Cytochromes Cytochrome A family of membrane-associated, heme-containing proteins that catalyze oxidation and reduction to promote electron transport reactions. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16486 Cytochrome Cytochrome_P450 Cytochrome-P450 Cytochrome P450 Family Cytochrome P450 Protein Cytochrome P450 Enzyme cytochrome P450 enzyme system Cytochrome P-450 Cytochrome P450 CYP CYP450 P450 A family of cytochromes that are involved in electron transport and oxidative metabolism of drugs and other bioactive molecules. When the catalytic heme is reduced the absorbance peak for this protein occurs at 450 nm. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16484 Cytochrome P450 Cytochrome_P450_Family_Gene Cytochrome P450 Family Gene Cytochrome P450 Family Genes encode Cytochrome P450 isozymes, hemoprotein components of the mixed-function oxidase system involving electron and/or hydrogen transport through reversible valency change of the heme iron and metabolic biotransformation of substances, including foreign compounds to mutagens and carcinogens. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C26511 Cytochrome P450 Family Gene Cytokine Cytokine Cytokines cytokine A class of soluble glycoproteins which act nonenzymatically through specific receptors to regulate immune responses. Cytokines are derived from both immune and non-immune cells and are intercellular mediators that differ from hormones in that they are produced by a number of tissue or cell types rather than by specialized glands. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20464 Cytokine Cytokine_Gene Cytokine Gene Cytokines are soluble glycoproteins released by cells of the immune system, which act nonenzymatically through specific receptors to regulate immune responses. Cytokines resemble hormones in that they act at low concentrations and bind with high affinity to a specific receptor. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C21550 Cytokine Gene Cytokine_Receptor Cytokine Receptor A cytokine receptor is a protein on the cell surface that specifically binds cytokine ligands which are small proteins secreted by immune cells. These receptors mediate molecular functions such as signal transduction. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C17667 Cytokine Receptor Cytokine_Receptor_Gene Cytokine Receptor Gene Cytokine Receptor Genes encode cell surface Cytokine Receptors that bind paracrine or autocrine cytokine growth factors that stimulate humoral and cellular immune responses, as well as activation of phagocytic cells. Cytokines are secreted by inflammatory leukocytes (lymphokines), by monocytes or macrophages (monokines), and by various other cells. Interleukin lymphokines, targeted to cells of hematopoietic origin, are not secreted by leukocytes but affect the cellular responses of leukocytes. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20912 Cytokine Receptor Gene Cytoskeletal_Gene Cytoskeletal Protein Gene Cytoskeletal Gene Cytoskeletal Genes encode Cytoskeletal Proteins, diverse structural proteins including polymerizable globular subunits (actin, tubulin), "motor ATPases" (myosin, dynein), membrane-supporting linkers (spectrin, clathrin), fibrous proteins (keratin, vimentin), and many more. As constituents of the cytoskeleton, Cytoskeletal Proteins form a flexible cellular framework that provides attachment points for organelles and formed bodies and makes communication between cell parts possible. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20745 Cytoskeletal Gene Cytoskeletal_Protein Cytoskeletal Protein A protein that is a structural part of the cytoskeleton. These proteins are involved in cell shape, organelle and protein localization, cell movement, cell division, endocytosis, exocytosis, and signal transduction. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16492 Cytoskeletal Protein D-dimer_to_Platelet_Ratio D-dimer to Platelet Ratio D-dimer to Platelet Ratio DNA_Analysis DNA Analysis Any DNA based laboratory tests. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C17632 DNA Analysis De_Ritis_Ratio De Ritis Ratio DRR http://purl.bioontology.org/ontology/MEDDRA/10079977 De Ritis Ratio Deacetylase Deacetylase An enzyme that hydrolyzes N-acetyl groups. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C26503 Deacetylase Death Determination of Death End Of Life Irreversible cessation of all bodily functions, manifested by absence of spontaneous breathing and total loss of cardiovascular and cerebral functions. http://purl.bioontology.org/ontology/MESH/D003643 Death Delavirdine Delavirdine DELAVIRDINE A synthetic, non-nucleoside reverse transcriptase inhibitor. In combination with other anti-retroviral drugs, this agent has been shown to reduce HIV viral load and increase CD4 leukocyte counts in patients. As an inhibitor of the cytochrome P450 system, delavirdine may result in increased serum levels of co-administered protease inhibitors metabolized by the cytochrome P450 system. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C65366 Delavirdine Delayed_Capillary_Refill_Time Delayed Capillary Refill Delayed Capillary Refill Time A clinical finding in which a capillary nail refill test returns to pink color in greater than two seconds after pressure is removed. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C168181 Delayed Capillary Refill Time Delirium_Assessment Delirium Assessment Delirium Screening Assessment of Delirium Delirium Screen Delirium Score Delirium assessment aims to confirm the diagnosis, identify and treat the causes, and manage and relieve the symptoms, and collect information that is useful in developing treatment plans. http://www.semanticweb.org/zhenyuzhang/ontologies/2021/DREAMDNPTO#DeliriumAssessment Delirium Assessment Dendritic_Cells_Count Dendritic Cells Dendritic Cells Count DC The determination of the amount of dendritic cells present in a sample. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C181185 Dendritic Cells Count Diagnosis Diagnostic intent DIAGNOS DIAGNOSIS Diagnosed Diagnosis Diagnostic Dx diagnosis The investigation, analysis and recognition of the presence and nature of disease, condition, or injury from expressed signs and symptoms; also, the scientific determination of any kind; the concise results of such an investigation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C15220 Diagnostic Result Diagnostic_Biomarker Diagnostic Biomarker A biomarker used to detect or confirm presence of a disease or condition of interest or to identify individuals with a subtype of the disease. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C201361 Diagnostic Biomarker Diagnostic_Criteria Diagnostic Criteria DXCRIT A standard from which a judgment concerning a medical diagnosis can be established. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C117960 Diagnostic Criteria Diagnostic_Factor Diagnostic Marker Diagnostic Factor A biological, physiological, behavioral, or molecular indicator of the presence or predisposition towards development of a specific disease. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C19591 Diagnostic Factor Diagnostic_Procedure diagnostic technique Diagnostic Method Diagnostic Procedure diagnostic procedure Diagnostic Test Diagnostic Technique Evaluation Basis of Disease Status Any procedure or test to diagnose a disease or disorder. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C18020 Diagnostic Procedure Diarrhea Loose Stools Frequent Stools Diarrheal Disease Diarrhea diarrhea Watery bowel movements. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C2987 Diarrhea Diastolic_Blood_Pressure Diastolic Pressure Diastolic blood pressure Diastolic Blood Pressure DIABP The minimum pressure exerted into the systemic arterial circulation during cardiac ventricular relaxation and filling. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C25299 Diastolic Blood Pressure Differential_diagnosis Differential diagnosis (contextual qualifier) (qualifier value) http://purl.bioontology.org/ontology/SNOMEDCT/47965005 Differential diagnosis Digestive_System Organ System, Gastrointestinal Digestive System Gastrointestinal Body System Gastrointestinal GASTROINTESTINAL SYSTEM Gastrointestinal System Body System, Gastrointestinal Gastrointestinal Organ System digestive system The system that includes the esophagus, stomach, small and large intestine, anus, liver, biliary tract, and pancreas. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12378 Digestive System Digestive_System_Hemorrhage Digestive System Hemorrhage Bleeding originating from any part of the digestive system. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C119722 Digestive System Hemorrhage Digestive_System_Signs_and_Symptoms Digestive System Signs and Symptoms Gastrointestinal System Signs and Symptoms Signs and symptoms associated with disturbances within the digestive system, which includes the stomach, intestines and all associated organs that aid in digestion. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C3368 Digestive System Signs and Symptoms Diiodotyrosine Iodogorgoic Acid Tyrosine, 3,5-diiodo- Acid, Iodogorgoic A product from the iodination of MONOIODOTYROSINE. In the biosynthesis of thyroid hormones, diiodotyrosine residues are coupled with other monoiodotyrosine or diiodotyrosine residues to form T4 or T3 thyroid hormones (THYROXINE and TRIIODOTHYRONINE). http://purl.bioontology.org/ontology/MESH/D004105 Diiodotyrosine Direct_Bilirubin_Measurement Direct Bilirubin Direct Bilirubin Measurement BILDIR DB The bilirubin is bound to glucuronide to form conjugated bilirubin (direct bilirubin). Direct Bilirubin measurement is accomplished by a colorimetric method. Direct Bilirubin in biological fluids reacts with sulfanilic acid at acidic pH to produce a red colored complex. The optical density of produced color has a direct relationship with Direct Bilirubin concentration in the solution. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C64481 Direct Bilirubin Measurement Direct_Factor_Xa_Inhibitor Direct Factor Xa Inhibitor Any agent that binds to and inactivates factor Xa, with anticoagulant activity. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C173067 Direct Factor Xa Inhibitor Direct_Thrombin_Inhibitor Direct Thrombin Inhibitor DTI Any agent that directly binds to and inactivates thrombin (factor IIa), with anticoagulant activity. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C173066 Direct Thrombin Inhibitor Disease_Notification Infectious Disease Reportings Disease Notifications Exposure Notifications Disease Reporting, Infectious Reportings, Infectious Disease Reporting, Infectious Disease Infectious Disease Reporting Notification, Exposure Notifications, Exposure Notifications, Disease Notification, Disease Exposure Notification Disease Reportings, Infectious Notification or reporting by a physician or other health care provider of the occurrence of specified contagious diseases such as tuberculosis and HIV infections to designated public health agencies. The United States system of reporting notifiable diseases evolved from the Quarantine Act of 1878, which authorized the US Public Health Service to collect morbidity data on cholera, smallpox, and yellow fever; each state in the US has its own list of notifiable diseases and depends largely on reporting by the individual health care provider. http://purl.bioontology.org/ontology/MESH/D018563 Disease Notification Disinfection Disinfection Rendering pathogens harmless through the use of heat, antiseptics, antibacterial agents, etc. http://purl.bioontology.org/ontology/MESH/D004203 Disinfection Disseminated_Intravascular_Coagulation Disseminated intravascular coagulation Consumptive Coagulopathy Disseminated Intravascular Coagulation Disseminated Intravascular Coagulation (DIC) DIC A pathological process where the blood starts to coagulate throughout the whole body. This depletes the body of its platelets and coagulation factors, and there is an increased risk of hemorrhage. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C2992 Disseminated Intravascular Coagulation Disulfide_Linkage Disulfide Bond Disulfide Linkage A disulfide linkage is a covalent bond between 2 sulfide atoms from the thiol group of 2 cysteine residues (S-S). They occur both interstrand and intrastrand. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C14062 Disulfide Linkage Diuretic Diuretic Diuretics diuretic A class of agents that increases the production of urine by the kidney. Via various mechanism of actions, diuretics retain water in urine, thus provides a means of forced diuresis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C448 Diuretic Divorced Divorced Status DIVORCED Divorced Indicates a person whose marriage has been legally dissolved and has not remarried. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C51776 Divorced Dizziness Lightheadedness Dizziness Dizzy A sensation of lightheadedness, unsteadiness, turning, spinning or rocking. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C37943 Dizziness Doppler_Ultrasound Doppler Ultrasound DOPPLER ULTRASOUND Diagnostic imaging that uses sound waves (ultrasound) applying the Doppler effect, with frequency-shifted ultrasound reflections produced by moving targets (usually red blood cells) in the bloodstream along the ultrasound axis in direct proportion to the velocity of movement of the targets, to determine both direction and velocity of blood flow. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C62781 Doppler Ultrasound Dosage_Regimen Dosage Regimen dosage regimen The specific way a therapeutic drug is to be taken, including formulation, route of administration, dose, dosing interval, and treatment duration. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C142516 Dosage Regimen Drug_Interaction drug interaction INTERACTION Drug Interaction Alteration of the disposition and/or effect of a drug, owing to the presence of another factor such as a second drug, or food. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C54708 Drug Interaction Drug_Use_History Drug Use History A description of an individual's current and past use and/or abuse of drugs and chemicals. This includes prescription medication, illicit drugs and recreational substances. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C81246 Drug Use History Duct_Salivary_Gland_System Duct Salivary Gland System The portion of the salivary system that conveys the saliva produced in the acinar salivary gland system to the oral cavity. The duct salivary gland system includes the ductus parotideus, ductus submandibularis, ductus sublingualis major, and ductus sublinguales minores, as well as the ducts from the minor salivary glands. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32486 Duct Salivary Gland System Dysphagia Difficulty swallowing Dysphagia/ Odynophagia Difficulty Swallowing Dysphagia dysphagia A symptom referring to difficulty in swallowing. It may be observed in patients with stroke, motor neuron disorders, cancer of the throat or mouth, head and neck injuries, Parkinson disease, and multiple sclerosis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C2980 Dysphagia Dyspnea Shortness of breath Shortness of Breath Presence and severity of dyspnea DYSPNEA Dyspnea dyspnea An uncomfortable sensation of difficulty breathing. It may present as an acute or chronic sign of an underlying respiratory or heart disorder. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C2998 Dyspnea Efavirenz DMP-266 EFAVIRENZ Efavirenz L743726 MK-0831 Sustiva efavirenz A synthetic non-nucleoside reverse transcriptase (RT) inhibitor with antiviral activity. Efavirenz binds directly to the human immunodeficiency virus type 1 (HIV-1) RT, an RNA-dependent DNA polymerase, blocking its function in viral DNA replication. In combination with other antiretroviral drugs, this agent has been shown to significantly reduce HIV viral load, retarding or preventing damage to the immune system and reducing the risk of developing AIDS. Efavirenz induces activity of the cytochrome P450 system, accelerating its own metabolism. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C29027 Efavirenz Elastase-alpha-1-antiprotease_Complex elastase-alpha-1-antiprotease complex 2-AAT elastase alpha-1-proteinase inhibitor complex alpha-ATE complex alpha-AT elastase complex elastase alpha1-antitrypsin Neutrophilic elastase-alpha 1-antitrypsin alpha 1-antitrypsin-leukocyte elastase complex http://purl.bioontology.org/ontology/MESH/C037741 Elastase-alpha-1-antiprotease Complex Electrolyte_Measurement Electrolyte Measurement A quantitative measurement of the amount of an electrolyte present in a sample. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C74946 Electrolyte Measurement Electrolyte_Replacement_Agent Electrolyte Replacement Agent Any agent or mixture of agents that are used to replenish electrolytes in body fluids, such as sodium, potassium, calcium, magnesium, phosphorus, chloride and bicarbonate. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C29730 Electrolyte Replacement Agent Employed Employed Employment The state of being engaged in an activity or service for wages or salary. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C25172 Employed Emtricitabine 2(1H)-Pyrimidinone,4-amino-5-fluoro-1-(2-(hydroxymethyl)-1,3-oxathiolan-5-yl)-,(2R-cis)-Emtricitabine EMTRICITABINE (-)-2'-Deoxy-5-fluoro-3'-thiacytidine BW-524W91 Coviracil Emtriva FTC dOTFC A synthetic fluoro derivative of thiacytidine with potent antiviral activity. Emtricitabine is phosphorylated to form emtricitabine 5'-triphosphate within the cell. This metabolite inhibits the activity of human immunodeficiency virus (HIV) reverse transcriptase both by competing with the natural substrate deoxycytidine 5'-triphosphate and by incorporation into viral DNA causing a termination of DNA chain elongation (due to the lack of the essential 3'-OH group). http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C47509 Emtricitabine Endocrine_System_Signs_and_Symptoms Endocrine System Signs and Symptoms Patient complaints, physical findings, laboratory findings referable to the endocrinologic system. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C5033 Endocrine System Signs and Symptoms Endogenous_Etiology Endogenous Etiology Endogenous Etiology Endoscopic_Surgery endoscopic surgery endoscopic management endoscopic treatment endoscopic operation http://purl.jp/bio/4/id/200906059554249095 Endoscopic Surgery Endotoxin Bacterial Pyrogen Endotoxin Endotoxins The lipopolysaccharide complexes that are part of the outer membrane of the cell wall of Gram-negative bacteria such as E. coli, Salmonella, Shigella, Pseudomonas, Neisseria, Haemophilus, and other leading pathogens. Upon bacterial infections, the lipid component (Lipid A) of endotoxin contributes to its toxicity, while the polysaccharide components contribute to immunogenicity. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C50918 Endotoxin Endotracheal_Intubation Endotracheal Intubation A medical intervention that creates a passage of a tube through the nose or mouth into the trachea for maintenance of the airway, as during the administration of anesthesia. http://purl.obolibrary.org/obo/OAE_0001324 Endotracheal Intubation Environmental_Etiology Environmental Etiology Environmental Factor Environmenta Cause Exogenous Etiology Environmental_Risk_Factor Environmental Factor Environmental Risk Factor Health hazards at home, in the work place, or in nature (e.g., infectious agents, irritants, respiratory fibrotic agents, asphyxiants, allergens, metabolic poisons, physical agents, mutagens, teratogens, and carcinogens). (Winett et al: Health Psychology and Public Health) http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C18244 Environmental Risk Factor Enzyme Enzyme Enzymes enzyme Molecules that catalyze a chemical reaction. They are usually proteins, although catalytic RNA and DNA molecules have been identified. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16554 Enzyme Enzyme_Gene Enzyme Gene Enzyme Genes encode Enzymes, biological molecules (usually proteins) that possess catalytic activity. Catalytic RNA and catalytic DNA molecules have also been identified. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C21281 Enzyme Gene Enzyme_Inhibitor_Gene Enzyme Inhibitor Gene Enzyme Inhibitor Genes encode Enzyme Inhibitor Proteins, biological molecules that block or suppress the catalytic activity of enzymes. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C29938 Enzyme Inhibitor Gene Enzyme_Inhibitor_Protein Enzyme Inhibitor Protein A class of proteins that are involved in the inhibition of enzymes. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C18072 Enzyme Inhibitor Protein Eosinophil_Count Eosinophil Count Eosinophils EOS Eosinophil The determination of the number of eosinophils in a blood sample. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C64550 Eosinophil Count Epidemiology Epidemiology epidemiology Epidemiologic epidemiologic Epidemiological epidemiological The study of the causes, incidence and distribution of disease in the population and its application for prevention or control. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16556 Epidemiology Epinephrine Adrenaline Hydrochloride Epifrin Epinephrine Bitartrate 1,2-Benzenediol, 4-(1-hydroxy-2-(methylamino)ethyl)-, (R)- Epinephrine Hydrochloride Lyophrin Adrenaline Adrenaline Bitartrate Acetate, Epinephrine Epinephrine Acetate 4-(1-Hydroxy-2-(methylamino)ethyl)-1,2-benzenediol Epinephrine Hydrogen Tartrate Epitrate Adrenaline Acid Tartrate Medihaler-Epi The active sympathomimetic hormone from the ADRENAL MEDULLA. It stimulates both the alpha- and beta- adrenergic systems, causes systemic VASOCONSTRICTION and gastrointestinal relaxation, stimulates the HEART, and dilates BRONCHI and cerebral vessels. It is used in ASTHMA and CARDIAC FAILURE and to delay absorption of local ANESTHETICS. http://purl.bioontology.org/ontology/MESH/D004837 Epinephrine Erythrocyte_Count Red Blood Cell Count Erythrocyte Count Red Blood Cells Red Cell Count Erythrocytes RBC The determination of the number of erythrocytes in a biospecimen. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C51946 Erythrocyte Count Erythrocyte_Distribution_Width_Measurement Erythrocyte Distribution Width Measurement Erythrocytes Distribution Width Red Blood Cell Distribution Width Red Cell Volume Distribution Width RDW RDW-CV An index of the variation in the size of the red cells and can be used to detect subtle degress of anisocytosis. It is computed directly from the RBC histogram and is calculated as a standard statictical value, the coefficient of variation of the red cell volume ditribution (ratio of standard deviation and mean copuscular volume). http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C64800 Erythrocyte Distribution Width Measurement Erythrocyte_Sedimentation_Rate_Measurement Erythrocyte sedimentation rate (ESR) sedimentation rate Erythrocyte Sedimentation Rate Measurement Erythrocyte Sedimentation Rate erythrocyte sedimentation rate Biernacki Reaction ESR Sed Rate A quantitative measurement of the distance that red blood cells travel in one hour in a sample of unclotted blood. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C74611 Erythrocyte Sedimentation Rate Measurement Eskimo Eskimo Inuit The native people inhabiting the Arctic of northern Canada, Greenland, Alaska, or eastern Siberia. The two main groups referred to as Eskimo are the Yupik and Inuit. A third group, the Aleut, is related. In Canada and Greenland, the term Eskimo has fallen out of favor, as it is considered pejorative by the natives and has been replaced by the term Inuit. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C43390 Eskimo Esophageal_Mucosa ESOPHAGEAL MUCOSA tunica mucosa esophageae esophagus mucous membrane tunica mucosa esophagi esophageal mucosa lamina muscularis mucosae esophageae Esophageal Mucosa Esophagus - mucosa esophagus mucosa esophageal mucous membrane mucosa of esophagus mucous membrane of esophagus The lining of the esophagus. It is composed of non-keratinized stratified squamous epithelium, lamina propria, and muscularis mucosa. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32538 Esophageal Mucosa Esophageal_Muscular_Coat Esophageal Muscular Coat http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32539 Esophageal Muscular Coat Esophageal_Serosal_Surface Esophageal Serosal Surface http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C49224 Esophageal Serosal Surface Esterase Ester Hydrolase EC 3.1 Esterase Encoded by Esterase Genes, Esterases catalyze hydrolysis of ester bonds to produce alcohol and acid reaction products. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16561 Esterase Esterase_Gene Esterase Gene Esterase Genes encode Esterases that catalyze hydrolysis of ester bonds to produce alcohol and acid reaction products. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C25952 Esterase Gene Etiology Causation Cause Etiology etiology The cause of a disease or abnormal condition. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16390 Etiology European EUROPEAN European Denotes the inhabitants of any of the countries of Europe, a person from there, or their descendants elsewhere. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C43851 European Exocrine_System Exocrine System A system of glands that secrete fluids delivered via ducts and tubes directly to organs including the skin. Examples include the exocrine pancreas and the prostate gland. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12957 Exocrine System Exogenous_Risk_Factor risk factor risk factors Risk Factor risk_factors Any aspect of an individual's life, behavior, an environmental exposure, or an inborn or inherited characteristic that increases the likelihood of a disease, condition or injury. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C17103 Exogenous Risk Factor Extracellular_Matrix_Protein ECM Protein Extracellular Matrix Protein Encoded by Extracellular Matrix Protein Genes, Extracellular Matrix Proteins are mostly fibrous proteins (e.g., Collagen, Elastin, Fibronectins, and Laminin) typically located in the Extracellular Matrix and commonly involved in cell attachment, cell movement, cell growth, morphogenesis, organogenesis, and tissue repair, architecture, and organization. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C17351 Extracellular Matrix Protein Extracellular_Matrix_Protein_Gene Extracellular Matrix Protein Gene ECM Protein Gene Extracellular Matrix Protein Genes encode mostly fibrous Extracellular Matrix Proteins (e.g., Collagen, Elastin, Fibronectins, and Laminin), typically located in the Extracellular Matrix and commonly involved in cell attachment, cell movement, cell growth, morphogenesis, organogenesis, and tissue repair, architecture, and organization. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C26000 Extracellular Matrix Protein Gene Extracorporeal_Membrane_Oxygenation Extracorporeal Life Supports Venovenous Extracorporeal Membrane Oxygenation Oxygenation, Extracorporeal Membrane ECLS Treatment Venoarterial ECMOs ECMO Treatment ECMO Extracorporeal Membrane Oxygenation Venoarterial Extracorporeal Membrane Oxygenation Membrane Oxygenation, Extracorporeal Life Support, Extracorporeal Extracorporeal Life Support Extracorporeal Membrane Oxygenations Treatment, ECMO ECLS Treatments Treatment, ECLS ECMO, Venoarterial Venovenous ECMO Venoarterial ECMO ECMO, Venovenous ECMO Treatments Venovenous ECMOs Application of a life support system that circulates the blood through an oxygenating system, which may consist of a pump, a membrane oxygenator, and a heat exchanger. Examples of its use are to assist victims of SMOKE INHALATION INJURY; RESPIRATORY FAILURE; and CARDIAC FAILURE. http://purl.bioontology.org/ontology/MESH/D015199 Extracorporeal Membrane Oxygenation F2-Isoprostanes F2 Isoprostane F2 Isoprostanes F2-Isoprostane Isoprostanes derived from the free radical oxidation of ARACHIDONIC ACID. Although similar in structure to enzymatically synthesized prostaglandin F2alpha (DINOPROST), they occur through non-enzymatic oxidation of cell membrane lipids. http://purl.bioontology.org/ontology/MESH/D028441 F2-Isoprostanes FABP_Family_Gene FABP Family Gene These genes encode the intracellular fatty acid-binding proteins (FABPs). Fatty acid metabolism in mammalian cells depends on a flux of fatty acids, between the plasma membrane and mitochondria or peroxisomes for beta-oxidation, and between other cellular organelles for lipid synthesis. FABPs are divided into at least three distinct types, namely the hepatic-, intestinal- and cardiac-type. They form 14-15 kDa proteins and at least 3 different FABPs play a role as transport vehicles of these hydrophobic compounds throughout the cytoplasm. They may participate in the uptake, intracellular metabolism and/or transport of long-chain fatty acids. They may also be responsible in the modulation of cell growth and proliferation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20735 FABP Family Gene Family_Medical_History Family Medical History Epidemiology, Family Medical History family history Family History of Family History family medical history FAMILY HISTORY A record of a patient's background regarding health and disease events of blood relatives. A patient's family medical history may be important in diagnosing existing conditions. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C17726 Family Medical History Fatty_Acid_Measurement Fatty Acid Measurement The determination of the amount of fatty acids present in a sample. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C80157 Fatty Acid Measurement Feeding_Intolerance Feeding Intolerance Inability to achieve a full feeding volume. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C113395 Feeding Intolerance Fever FEVER Fever Pyrexia fever Elevation of body temperature above normal due to inflammatory or immune responses. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C3038 Fever Fever_Chills Fever Chills Shivering secondary to a febrile process. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C26921 Fever Chills Fibrin_Monomer Fibrin Monomer Soluble Fibrin Monomer Derivatives of thrombin-cleaved fibrinogen that are plasma soluble due to limiting amounts of the clot promoting protein factor XIII. Detection of these proteins may be used to aid in the diagnosis or exclusion of thrombotic events or determine if a patient is at risk for post-operative hemorrhage. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C107563 Fibrin Monomer Fight_Action_to_Neutralize_Sepsis_Score Fight Action to Neutralize Sepsis Score FANS FANS Score Ognibene A, Lorubbio M, Montemerani S, Tacconi D, Saracini A, Fabbroni S, Parisio EM, Zanobetti M, Mandò M, D'Urso A. Monocyte distribution width and the fighting action to neutralize sepsis (FANS) score for sepsis prediction in emergency department. Clin Chim Acta. 2022 Sep 1;534:65-70. doi: 10.1016/j.cca.2022.07.007. Epub 2022 Jul 16. PMID: 35853545. Fight Action to Neutralize Sepsis Score First_Aid Aid, First Aids, First First Aids Emergency care or treatment given to a person who suddenly becomes ill or injured before full medical services become available. http://purl.bioontology.org/ontology/MESH/D005392 First Aid Flatulence Flatulence A state of excessive gas in the alimentary canal. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C37954 Flatulence Fluoride_Measurement Fluoride Measurement FLUORIDE Fluoride The determination of the amount of fluoride present in a sample. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C64495 Fluoride Measurement Focal_Acute_Inflammation Focal Acute Inflammation An inflammatory process characterized by the localized collection of polymorphonuclear neutrophils. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C82967 Focal Acute Inflammation Frailty_Index Frailty Index (assessment scale) FI http://purl.bioontology.org/ontology/SNOMEDCT/713634000 Frailty Index Fumigation Fumigation The application of smoke, vapor, or gas for the purpose of disinfecting or destroying pests or microorganisms. http://purl.bioontology.org/ontology/MESH/D005651 Fumigation GTPase Guanosinetriphosphatase GTPase Proteins that hydrolyze guanine triphosphate to yield guanine diphosphate. This is a class of proteins that belongs to a family of high energy phosphate hydrolases. Members of this family play major roles in biological signal transduction pathways. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16650 GTPase GTPase_Gene GTPase Gene Genes (superfamily) that encode GTP hydrolyzing enzymes, which cycle between the GDP-bound inactive state and the GTP-bound active state acting as intracellular switches in various cellular pathways, such as signal transduction. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C25805 GTPase Gene G_Protein-Coupled_Receptor G Protein-Coupled Receptor G Protein Coupled Receptor G Protein-Complex Receptor G Protein-Complex Receptors G-Protein Coupled Receptor GPCR Cell surface receptors that are coupled to G-proteins (GTP-binding protein). G-protein coupled receptors are thought to have seven membrane spanning domains and have been divided into 2 subclasses: those in which the binding site is in the extracellular domain for example receptors for glycoprotein hormones, such as thyroid stimulating hormone (TSH) and follicle-stimulating hormone (FSH) and those in which the ligand binding site is likely to be in the plane of the 7 transmembrane domains for example rhodopsin and receptors for small neurotransmitters and hormones for example muscarinic acetylcholine receptor. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C18239 G Protein-Coupled Receptor G_Protein-Coupled_Receptor_Gene G Protein-Coupled Receptor Gene G Protein Coupled Receptor Gene G-Protein Coupled Receptor Gene GPCR GPR These genes encodes G protein-coupled receptors (GPRs or GPCRs). GPRs contain 7 hydrophobic transmembrane domains embedded in hydrophilic intra- and extracellular loops and transduce a variety of hormone, endogenous peptide, and neurotransmitter signals into intracellular effects via G proteins. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20923 G Protein-Coupled Receptor Gene Ganciclovir GANCICLOVIR Nordeoxyguanosine ganciclovir 9-[(1,3-Dihydroxy-2-propoxy)methyl]guanine 2-Amino-1,9-[[2-hydroxy-1-(hydroxymethyl)ethoxy]methyl]-6H-purin-6-one 2'-Nor-2'-deoxyguanosine Ganciclovir 2'NDG Cymevan DHPG GCV Virgan A synthetic guanine derivative with antiviral activity. As the active metabolite of ganciclovir, ganciclovir-5-triphosphate (ganciclovir-TP) appears to inhibit viral DNA synthesis by competitive inhibition of viral DNA polymerases and incorporation into viral DNA, resulting in eventual termination of viral DNA elongation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C517 Ganciclovir Gas_Measurement Gas Measurement A measurement of the gas in a sample. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C82624 Gas Measurement Gastric_Mucosa ventriculus mucous membrane stomach mucosa stomach mucous membrane Stomach Mucosa organ mucosa of ventriculus stomach organ mucosa mucous membrane of ventriculus Gastric Mucosa mucous membrane of stomach gastric mucous membrane gastric mucosa stomach mucosa of organ ventriculus mucosa of organ GASTRIC MUCOSA tunica mucosa (gaster) ventriculus mucosa organ mucosa of stomach tunica mucosa gastricae mucosa of stomach ventriculus organ mucosa mucosa of organ of ventriculus mucosa of ventriculus mucosa of organ of stomach The mucus membrane lining the inner surface of the stomach. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32656 Gastric Mucosa Gastric_Serosal_Surface Gastric Serosal Surface http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32662 Gastric Serosal Surface Genetic_Etiology Genetic Etiology Genetic Etiology Genitourinary_Signs_and_Symptoms Genitourinary Signs and Symptoms Genital or Reproductive Signs and Symptoms Patient complaints (symptoms), physical or laboratory findings (signs) related to the genitourinary system. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C5035 Genitourinary Signs and Symptoms Glasgow_Coma_Scale Coma Scale, Glasgow Scale, Glasgow Coma A scale that assesses the response to stimuli in patients with craniocerebral injuries. The parameters are eye opening, motor response, and verbal response. http://purl.bioontology.org/ontology/MESH/D015600 Glasgow Coma Scale Global_Burden_of_Disease Global Disease Burden Use of various metrics to measure death and loss of health due to diseases, injuries and RISK FACTORS for all regions of the world. http://purl.bioontology.org/ontology/MESH/D000071219 Global Burden of Disease Glomerular_Filtration_Rate Glomerular Filtration Rate GFR A kidney function test that measures the fluid volume that is filtered from the kidney glomeruli to the Bowman's capsule per unit of time. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C90505 Glomerular Filtration Rate Glycopeptide_Antibiotic Glycopeptide Antibiotic One of a class of antibiotics originally isolated from plant and soil bacteria with structures containing either a glycosylated cyclic or polycyclic nonribosomal peptide. These antibiotics inhibit the cell wall structure of susceptible organisms (principally Gram-positive cocci) by inhibiting peptidoglycan synthesis. First-generation glycopeptide antibiotics include vancomycin, teicoplanin, and ramoplanin; second-generation semi-synthetic glycopeptide antibiotics include oritavancin, dalbavancin, and telavancin. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61101 Glycopeptide Antibiotic Granulocyte_Count Granulocytes Granulocyte Count Polymorphonuclear Leukocytes GRAN The determination of the amount of granulocytes present in a sample. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C96654 Granulocyte Count Growth_Factor Growth Factors, Proteins Growth Agents growth factor Growth Factors Growth Factor Mitogen Growth Factors are extracellular signaling molecules (ligands) involved in control of target cell proliferation, cell survival, and cell differentiation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20424 Growth Factor Growth_Factor_Gene Proto-Oncogene, Growth Factor Growth Factor Gene Genes that code for growth factors. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C21344 Growth Factor Gene Guanine_Nucleotide_Exchange_Factor Guanine Nucleotide-Exchange Factor Guanine Nucleotide Exchange Factor Guanyl-Nucleotide Exchange Factor Guanyl-Nucleotide Releasing Factor Guanine Nucleotide-Releasing Factor GDP Exchange Factors GDP-GTP Exchange Factors GEF Proteins that catalyze the release and exchange of GDP for GTP from GTP-binding regulatory proteins, which are active in the GTP-bound form. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C17494 Guanine Nucleotide Exchange Factor Gut-Associated_Lymphoid_Tissue GUT-ASSOCIATED LYMPHOID TISSUE Gut-Associated Lymphoid Tissue Gut Associated Lymphoid Tissue GALT Non-encapsulated accumulations of lymphoid tissue in the alimentary tract that form a secretory immune system containing cells committed to IgA or IgE synthesis; It includes Peyer's patches and the lymphoid tissue which is present throughout the gastrointestinal mucosa. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12936 Gut-Associated Lymphoid Tissue HIV_Protease_Inhibitor HIV Protease Inhibitor A protease inhibitor that is designed to target the human immunodeficiency virus (HIV) protease while sparing other host cell proteases. HIV protease mediates the cleavage of viral Gag, Gag-Pol and Nef precursor polypeptides into their mature proteins. Inhibition of HIV protease results in production of noninfectious viral particles. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C97366 HIV Protease Inhibitor HMGB_Family_Gene HMGB Family Gene High Mobility Group B Gene Family Human HMGB Family Genes encode abundant DNA-binding and bending HMG-Box Family proteins (with structure, rather than sequence, specificity) that play an architectural role in nucleoprotein assembly. They have two homologous DNA-binding HMG-box domains connected by a short basic linker to an acidic C-terminus that differs in length. Tail length may be the dominant factor mediating property differences among HMGB proteins and determines DNA-binding properties of the HMG boxes. The tail is essential for DNA-binding. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20574 HMGB Family Gene HMG_Family_Gene HMG Family Gene Human HMG Family Genes encode ubiquitous non-histone HMG chromatin proteins originally named according to PAGE electrophoretic mobility, shared physical properties, and association with chromatin. Canonical HMG proteins are subdivided into 3 superfamilies with characteristic functional sequence motifs: HMGB (formerly HMG-1/-2), HMGN (formerly HMG-14/-17), and HMGA (formerly HMG-I/Y/C). DNA-binding HMG proteins appear to have roles in matrix stabilization, ssDNA protection, replication, and transcription that influence cell growth, proliferation, differentiation, and death. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20570 HMG Family Gene Headache Cephalalgia Cephalgia Headache Headaches Pain in various parts of the head, not confined to the area of distribution of any nerve. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C34661 Headache Heart_Murmur Heart Murmur Heart murmur Cardiac Murmur Murmur A periodic humming or blowing sound heard on auscultation of the heart that can indicate the presence of cardiac disease; murmurs are the result of vibrations caused by the turbulent flow of blood in the heart or great vessels. Murmurs are characterized according to the area of generation (mitral, aortic, tricuspid, or pulmonary) and according to the period of the cycle (systolic or diastolic). http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C84480 Heart Murmur Heart_Rate Vital Signs – Heart Rate HR Heart Rate Heart rate The number of heartbeats per unit of time, usually expressed as beats per minute. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C49677 Heart Rate Heat_Shock_Protein stress protein Heat Shock Protein Heat Shock Proteins heat-shock protein HSP A family of highly-conserved proteins that are synthesized in response to hyperthermia (heat shock), hypoxia, or other stresses that appear to increase cellular thermal tolerance and enable cells to recover from stress. Some heat shock proteins may protect other proteins from denaturation, degradation or perform functions essential to cell survival under these conditions. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16672 Heat Shock Protein Hematology_Test Hematology Test Hematology Procedure Blood Test A laboratory test to measure hematopoietic components and investigate hematologic disorders in a blood sample. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C49286 Hematology Test Hematopoietic_Factor_Gene Hematopoietic Factor Gene Hematopoietic Factor Genes encode growth factors that promote the development of blood cells. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C26046 Hematopoietic Factor Gene Hematopoietic_Growth_Factor Hematopoietic Cytokine hematopoietic growth factor Hematopoietic Growth Factor Endogenous growth factors which promote the development of blood cells. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20427 Hematopoietic Growth Factor Hemodialysis_Clearance Hemodialysis Clearance HDCL The rate at which a substance is removed from the blood via hemodialysis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C112287 Hemodialysis Clearance Hemodynamic_Phenotype Hemodynamic Phenotype Hemodynamic Phenotype Hemoglobin_Measurement Hemoglobin Monomer Hemoglobin Measurement HGB Hemoglobin A quantitative measurement of the amount of hemoglobin present in a biospecimen. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C64848 Hemoglobin Measurement Hemoptysis Coughing up Blood Hemoptysis hemoptysis Coughing up blood from the respiratory tract. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C3094 Hemoptysis Hepcidin_to_Ferritin_Ratio Hepcidin to Ferritin Ratio Hepcidin/Ferritin Hepcidin to Ferritin Ratio High_Density_Lipoprotein_Cholesterol_Measurement HDL Cholesterol High Density Lipoprotein Cholesterol Measurement HDL Cholesterol Measurement HDL The determination of the amount of high-density lipoprotein cholesterol present in a sample. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C105587 High Density Lipoprotein Cholesterol Measurement High_Flow_Oxygen_Nnasal_Cannula High flow oxygen nasal cannula (physical object) http://purl.bioontology.org/ontology/SNOMEDCT/426854004 High Flow Oxygen Nnasal Cannula Histone histone family histone_family HISTONE Histone histone Major protein component of chromatin. Highly conserved basic proteins, originally classified into classes based on the relative amounts of arginine and lysine in each protein. The various classes are now termed H1, H2A, H2B, H3, and H4. In chromatin, they are found in an octamer, containing two each of H2A, H2B, H3, and H4, complexed with DNA in nucleosomes. The histones in the octamer complex are also known as the core histones. The H1 class of histones, termed the linker histones, is loosely associated with the nucleosome. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16687 Histone Histone_H3 H3 HISTONE H3 Histone H3 Histone H3 is a core subunit of the eukaryotic nucleosome complex. Histones are basic nuclear proteins responsible for the nucleosome structure of chromatin. Repeating nucleosome units contain two molecules each of Histones H2A, H2B, H3, and H4 that form an octamer complex around which approximately 146 base pairs of DNA is wrapped. Linker Histone H1 interacts with DNA between nucleosome units in mediating chromatin compaction into higher order structures. (NCI) http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16685 Histone H3 History Historical History The aggregate of past events; the continuum of events occurring in succession leading from the past to the present; a record or narrative description of past events. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C54625 History History_of_Allergic_Reaction Allergic reaction History of Allergic Reaction A history of any allergic reaction that the patient has had. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C168250 History of Allergic Reaction History_of_Medication Medications History of Medication A history of the medication that the patient has taken. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C168253 History of Medication History_of_past_procedure_section History of past procedure section (record artifact) http://purl.bioontology.org/ontology/SNOMEDCT/1003640003 History of Past Procedure Section History_of_present_illness_section History of present illness section (record artifact) http://purl.bioontology.org/ontology/SNOMEDCT/422625006 History of Present Illness Section Hospitalization Hospitalized HOSPITALIZATION Hospitalization The condition of being treated as a patient in a hospital. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C25179 Hospitalization Hyaluronan_Synthases Synthase 3, Hyaluronan Synthetase, Hyaluronic Acid Synthetase, Hyaluronan HAS1 Protein Synthase 2, Hyaluronan Synthase, Hyaluronate Hyaluronan Synthase 3 Hyaluronate Synthetase Synthase 1, Hyaluronan HAS2 Protein Protein, HAS3 Hyaluronan Synthase Hyaluronic Acid Synthetase HAS3 Protein 3, Hyaluronan Synthase Hyaluronan Synthetase Hyaluronan Synthase 2 Synthase, Hyaluronan Synthetase, Hyaluronate Hyaluronate Synthase hasA Enzyme Synthases, Hyaluronan Hyaluronan Synthase 1 Membrane-associated glucuronosyltransferases that catalyze the reaction of UDP-N-acetyl-D-glucosamine and UDP-D-glucuronate to produce HYALURONAN. HYALURONAN SYNTHASE 2 (HAS2) is essential for embryogenesis and its expression by tumor cells is associated with metastasis. http://purl.bioontology.org/ontology/MESH/D000076002 Hyaluronan Synthases Hydrolase EC 3 Hydrolase Hydrolases Enzymes (EC class 3) cleaving substrates with addition of H2O at the point of cleavage; e.g., esterases, phosphatases, nucleases, peptidases. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16701 Hydrolase Hydrolase_Gene Hydrolase Gene Hydrolase Family Gene A gene that encodes an enzyme capable of catalyzing the hydrolysis of chemical bonds. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C25804 Hydrolase Gene Hydrolytic_IgG_Antibody Hydrolytic IgG Antibody Hydrolytic IgG Antibody Hypercarbia Hypercapnia Hypercarbia Excessive concentration of carbon dioxide in the blood. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C122721 Hypercarbia Hyperkinetic_Phenotype Hyperkinetic Phenotype Hyperpyrexia Hyperpyrexia Body temperature of 106 degrees Fahrenheit (41.1 degrees Celsius) or higher. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C111817 Hyperpyrexia Hypersensitivity Hypersensitivity Hypersensitive Allergic reaction Hypersensitivity/Allergic reaction Hypersensitivity Reaction hypersensitivity Sensitivity Sensitive An immune response that occurs following exposure to an innocuous antigen, but that does not require the presence of preformed antibodies to the antigen. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C3114 Hypersensitivity Hypovolemic_Shock Oligemic Shock Hypovolemic Shock Hematogenic Shock Shock resulting from insufficient blood volume for the maintenance of adequate cardiac output, blood pressure and tissue perfusion. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C50596 Hypovolemic Shock Hypoxia Hypoxia Hypoxic hypoxia hypoxic A decrease in the amount of oxygen in the body. Symptoms range from mild (impaired judgment, memory loss, impaired motor coordination) to severe (seizures and coma). http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C3890 Hypoxia IMX-SEV-2_Classifier IMX-SEV-2 Classifier Galtung N, Diehl-Wiesenecker E, Lehmann D, Markmann N, Bergström WH, Wacker J, Liesenfeld O, Mayhew M, Buturovic L, Luethy R, Sweeney TE, Tauber R, Kappert K, Somasundaram R, Bauer W. Prospective validation of a transcriptomic severity classifier among patients with suspected acute infection and sepsis in the emergency department. Eur J Emerg Med. 2022 Oct 1;29(5):357-365. doi: 10.1097/MEJ.0000000000000931. Epub 2022 Apr 21. PMID: 35467566; PMCID: PMC9432813. IMX-SEV-2 Classifier Imaging_Diagnosis Imaging Diagnosis Imaging_Finding Diagnostic Imaging Medical Imaging Any method that uses a visual display of structural or functional patterns of organs or tissues for diagnostic evaluation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16502 Diagnostic Imaging Immature_Granulocyte Immature Granulocyte A not-yet-mature white blood cell with staining granules in its cytoplasm. The staining granules may be neutrophilic, acidophilic, or basophilic in character. There are indications that an immature granulocyte count is a better measure of infection and sepsis than a total white blood cell count and comparable to absolute neutrophil count. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13113 Immature Granulocyte Immune-Mediated_Coagulopathy Immune-Mediated Coagulation Disorder Immune-Mediated Coagulopathy IMC Disorders of coagulation caused by autoantibodies generated against native coagulation factors or therapeutically-administered hemostatic agents. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C131673 Immune-Mediated Coagulopathy Immune_System_Disorder Immune Disorders Disorder of Immune System Immune disorder, NOS Immune Dysfunction Unspecified Immune System Problem Immune System Disorder Immunologic Disorder Immune Disorder A disorder resulting from an abnormality in the immune system. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C3507 Immune System Disorder Immunization Immunostimulation Immunological Stimulations Sensitization, Immunologic Sensitizations, Immunological Sensitization, Immunological Stimulation, Immunological Immunologic Sensitization Variolation Immunological Sensitization Stimulation, Immunologic Stimulations, Immunological Immunizations Immunological Stimulation Immunological Sensitizations Immunologic Stimulation Variolations Deliberate stimulation of the host's immune response. ACTIVE IMMUNIZATION involves administration of ANTIGENS or IMMUNOLOGIC ADJUVANTS. PASSIVE IMMUNIZATION involves administration of IMMUNE SERA or LYMPHOCYTES or their extracts (e.g., transfer factor, immune RNA) or transplantation of immunocompetent cell producing tissue (thymus or bone marrow). http://purl.bioontology.org/ontology/MESH/D007114 Immunization Immunodeficiency_Syndrome Immunodeficiency immunodeficiency syndrome immunodeficiency Immunodeficiency Syndrome Immunodeficiency Disorder Syndromes in which there is a deficiency or defect in the mechanisms of immunity, either cellular or humoral. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C3131 Immunodeficiency Syndrome Immunology_Test Immunological Laboratory Method Immunology Test immunoassay Laboratory test involving interaction of antigens with specific antibodies. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16723 Immunology Test Immunophenotype Immune Cell Phenotype Immunophenotype Immune Phenotype immunophenotyping Immunotype The characterization of a set of cells according to the antigens expressed. Sinha P, Meyer NJ, Calfee CS. Biological Phenotyping in Sepsis and Acute Respiratory Distress Syndrome. Annu Rev Med. 2023 Jan 27;74:457-471. doi: 10.1146/annurev-med-043021-014005. Epub 2022 Dec 5. PMID: 36469902; PMCID: PMC10617629. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20072 Immunophenotype Immunoprotein Immunoprotein Immune Regulatory Proteins A protein whose activities affect or play a role in immune system functions. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16725 Immunoprotein Immunoprotein_Gene Immunoprotein Gene Immunoprotein Genes encode proteins whose activities affect or play a role in immune system functions. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C25790 Immunoprotein Gene Immunosuppressive_Disorder Immunosuppressive Disorder Immunosuppressive_conditions A disorder in which immune function is suppressed. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C178942 Immunosuppressive Disorder Incidence Incidence incidence The relative frequency of occurence of something. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16726 Incidence Indication Indication for Use INDC Indication indication A sign, signal, circumstance, or symptom which serves to indicate or point out the cause, pathology, treatment, or issue of an attack of disease; the basis for initiation of a treatment for a disease or of a diagnostic test (causal, or symptomatic, or disease-specific indication). http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C41184 Indication Indinavir (1(1S,2R),5(S))-2,3,5-Trideoxy-N-(2,3-dihydro-2-hydroxy-1H-inden-1-yl)-5-(2-(((1,1-dimethylethyl)amino)carbonyl)-4-(3-pyridinylmethyl)-1-piperazinyl)-2-(phenylmethyl)-D-erythro-Pentonamide Compound J IDV INDINAVIR Indinavir indinavir A synthetic hydroxyaminopentane amide agent that selectively inhibits the protease of both human immunodeficiency virus 1 and 2. The incorporation of a basic amine into the hydroxyethylene backbone improves its aqueous solubility and its oral bioavailability. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C66877 Indinavir Indirect_Bilirubin_Measurement Unconjugated Bilirubin Measurement Indirect Bilirubin Indirect Bilirubin Measurement BILIND Bilirubin is in the insoluble form, unconjugated bilirubin (indirect bilirubin).The non-water soluble, free bilirubin does not react with sulfanilic acid at acidic pH to produce a red colored complex until an accelearator, alcohol, is added to the solution to perform a quantitative measurement of unconjugated bilirubin levels. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C64483 Indirect Bilirubin Measurement Indole Indole Either of two isomeric forms comprising a benzene ring fused to a pyrrole ring. http://purl.obolibrary.org/obo/CHEBI_35581 Indole Infection Infection, NOS Infection The invasion of an organism's body tissues by disease-causing agents and their multiplication, as well as the reaction by the host to these organisms and/or toxins that the organisms produce. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C128320 Infection Infection_Control Control, Infection Programs of disease surveillance, generally within health care facilities, designed to investigate, prevent, and control the spread of infections and their causative microorganisms. http://purl.bioontology.org/ontology/MESH/D017053 Infection Control Inflammation Inflammation inflammation INFLAMMATION Inflammatory Finding A finding of a localized protective response resulting from injury or destruction of tissues. Inflammation serves to destroy, dilute, or wall off both the injurious agent and the injured tissue. In the acute phase, inflammation is characterized by the signs of pain, heat, redness, swelling, and loss of function. Histologically, inflammation involves a complex series of events, including dilatation of arterioles, capillaries, and venules, with increased permeability and blood flow; exudation of fluids, including plasma proteins; and leukocyte migration into the site of inflammation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C3137 Inflammation Inflammatory_Phenotype Inflammatory Phenotype Inflammatory Phenotype Integumentary_System Organ System, Dermatologic Body System, Dermatologic Integumentary Dermatologic Body System Integumentary System Dermatologic Organ System The enveloping membrane of the body; includes, in addition to the epidermis and dermis, all the derivatives of the epidermis, e.g., hairs, nails, sudoriferous and sebaceous glands. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12907 Integumentary System Integumentary_System_Signs_and_Symptoms Integumentary System Signs and Symptoms Patient complaints (symptoms), physical and/or laboratory findings related to the skin or integument. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C5036 Integumentary System Signs and Symptoms Inter-alpha_Inhibitor serum-derived hyaluronan-associated protein, human Inter-alpha-inhibitor heavy chain 3 protein, human IGHEP1 protein, human inter-alpha (globulin) inhibitor, H1 polypeptide, human inter-alpha (globulin) inhibitor, H2 polypeptide, human ITIH3 protein, human pre-alpha (globulin) inhibitor, H3 polypeptide, human Inter-alpha-inhibitor heavy chain 1 protein, human IGHEP2 protein, human inter-alpha-trypsin inhibitor, heavy chain SHAP protein inter-alpha-trypsin inhibitor Inter-alpha-inhibitor heavy chain 2 protein, human Trypsin inhibitor, inter-alpha- ITIH2 protein, human ITIH1 protein, human Inter-alpha inhibit or proteins IalphaIp http://purl.bioontology.org/ontology/MESH/C011877 Inter-alpha Inhibitor Interfollicular_Area_of_the_Lymph_Node Interfollicular Area of the Lymph Node Lymph Node Paracortical Region Lymph Node Paracortex http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C38467 Interfollicular Area of the Lymph Node Interleukin Interleukin interleukin Interleukins IL Interleukin is the generic name for a group of well-characterized cytokines that are produced by leukocytes and other cell types. They have a broad spectrum of functional activities that regulate the activities and capabilities of a wide variety of cell types. They are particularly important as members of the cytokine networks that regulate inflammatory and immune responses. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20497 Interleukin Interleukin_Gene Interleukin Gene Interleukin Genes encode Interleukins, soluble cytokine factors produced by leukocytes and other cell types that have broad functional activities, particularly in regulating the inflammatory and immune responses of a variety of cell types. Interleukins enhance cell proliferation and differentiation, DNA synthesis, secretion of other biologically active molecules, and responses to immune and inflammatory stimuli. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C25982 Interleukin Gene Intermediate_Filament_Gene Intermediate Filament Gene Intermediate Filament Genes encode a number of different Intermediate Filament Proteins (including keratin filaments, neurofilaments, desmin, and vimentin) that form polymeric structural cytoplasmic filaments, intermediate in diameter (8-10 nanometer) between actin microfilaments and microtubules, which comprise part of the cytoskeleton of most eukaryotic cells. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C30073 Intermediate Filament Gene Intermediate_Filament_Protein Intermediate Filament Protein IFP Encoded by Intermediate Filament Genes, diverse Intermediate Filament Proteins (including keratin filaments, neurofilaments, desmin, and vimentin) form polymeric structural cytoplasmic filaments, intermediate in diameter (8-10 nanometer) between actin microfilaments and microtubules, that comprise part of the cytoskeleton of most eukaryotic cells. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20694 Intermediate Filament Protein International_Normalized_Ratio International Normalized Ratio INR A system, commonly called the INR, established by the World Health Organization (WHO) and the International Committee on Thrombosis and Hemostasis for reporting the results of blood coagulation (clotting) tests. All results are standardized using the international sensitivity index (ISI) for the particular thromboplastin reagent and instrument combination utilized to perform the test; the ratio of a patient's clotting time to the lab's mean reference value is normalized against the ISI. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C25352 International Normalized Ratio Intravenous_Equipment Intravenous Equipment http://purl.bioontology.org/ontology/NDDF/003287 Intravenous Equipment Invasive_Mechanical_Ventilator Invasive mechanical ventilator (ventilator or respirator) http://purl.bioontology.org/ontology/LNC/LA28889-6 Invasive Mechanical Ventilator Ion_Channel_Protein Ion Channel Protein Ion Channel Proteins typically aggregate in membrane-associated complexes forming pores whose activities regulate the movement of ions through cellular membranes to affect cellular homeostatic conditions and/or signaling processes. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C28505 Ion Channel Protein Ion_Channel_Protein_Gene Ion Channel Protein Gene Ion Channel Protein Genes encode Ion Channel Proteins that typically aggregate in membrane-associated complexes forming pores whose activities regulate the movement of ions through cellular membranes to affect cellular homeostatic conditions and/or signaling processes. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C25993 Ion Channel Protein Gene Ionized_Calcium_Measurement Ionized Calcium Measurement Calcium, Ionized CAION iCa The determination of the amount of ionized calcium present in a sample. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C81948 Ionized Calcium Measurement Iron_Binding_Capacity Iron Binding Capacity IBC The capacity of iron-binding protein in serum (transferrin) to bind serum iron. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C25748 Iron Binding Capacity Irritation Irritation A mild inflammatory tissue reaction; it can be caused by physical contact with an irritant or can be a local response to a systemic trigger. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C50624 Irritation Jaundice Jaundice jaundice Yellow pigmentation of the skin, mucous membranes, and the eyes due to hyperbilirubinemia. Causes include liver disease, biliary tract obstruction, and hemolysis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C3143 Jaundice Kinase_Family_Gene Kinase Family Gene Kinase Family Genes encode Kinase enzymes that covalently transfer the terminal, gamma phosphate group from ATP to a variety of substrates and typically play key regulatory roles in diverse cellular functions. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C25872 Kinase Family Gene L-tryptophan L-tryptophan residue W -Trp- Trp L-tryptophyl L-tryptophan http://purl.obolibrary.org/obo/CHEBI_29954 L-tryptophan LIP_score LIP score LIP LIP score Laboratory_Test_Result Laboratory Finding test_result Laboratory Report test result Test Result Laboratory Test Result Lab Findings TEST RESULT LAB_RESULT Lab Value Labs The outcome of a laboratory test. http://purl.bioontology.org/ontology/SNOMEDCT/15220000 Laboratory Test Laboratory_diagnosis Laboratory diagnosis (contextual qualifier) (qualifier value) http://purl.bioontology.org/ontology/SNOMEDCT/46159000 Laboratory diagnosis Lactate Lactate (substance) LACTIC ACID, UNSPECIFIED FORM lactic acid Lactic Acid Lactate A hydroxy monocarboxylic acid anion that is the conjugate base of lactic acid, arising from deprotonation of the carboxy group. http://purl.bioontology.org/ontology/SNOMEDCT/83036002 Lactate Lactate_to_Pyruvate_Ratio Lactate/pyruvate ratio measurement Lactate to pyruvate ratio L/P http://purl.bioontology.org/ontology/SNOMEDCT/104772009 Lactate to Pyruvate Ratio Lactic_Acid_Measurement 2-hydroxypropanoic acid Lactic Acid Measurement Lactic Acid LACTICAC Lactate The determination of the amount of lactic acid present in a sample. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C79450 Lactic Acid Measurement Lamivudine 2',3'-Dideoxy-3'-thiacytidine 4-Amino-1-((2R,5S)-2-(hydroxymethyl)-1,3-oxathiolan-5-yl)-2(1H)-pyrimidinone (-)-BCH-189 3'-Thia-2',3'-dideoxycytidine 3TC Epivir GR109714X LAM LAMIVUDINE Lamivudine lamivudine A synthetic nucleoside analogue with activity against hepatitis B virus (HBV) and HIV. Intracellularly, lamivudine is phosphorylated to its active metabolites, lamiduvine triphosphate (L-TP) and lamiduvine monophosphate (L-MP). In HIV, L-TP inhibits HIV-1 reverse transcriptase (RT) via DNA chain termination after incorporation of the nucleoside analogue into viral DNA. In HBV, incorporation of L-MP into viral DNA by HBV polymerase results in DNA chain termination. L-TP is a weak inhibitor of mammalian DNA polymerases alpha and beta, and mitochondrial DNA polymerase. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C1471 Lamivudine Large_Intestinal_Submucosa Large Intestinal Submucosa The layer of areolar tissue situated beneath the mucous membrane in the distal portion of the digestive tract from the small intestine to the anus. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C32930 Large Intestinal Submucosa Latin_American Latin American LATIN AMERICAN Denotes a person whose ancestry is in any of the countries of the Americas or the Caribbean where Spanish or Portuguese is spoken. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C126531 Latin American Left_Ventricle_Failure_Phenotype Left Ventricle Failure Phenotype Leukocyte_Count White Blood Cell Count White Cell Count White Blood Cells Leukocyte Count Leukocytes WBC A test to determine the number of leukocytes in a biospecimen. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C51948 Leukocyte Count Leukocyte_Phenotyping Leukocyte Phenotyping Langston JC, Yang Q, Kiani MF, Kilpatrick LE. LEUKOCYTE PHENOTYPING IN SEPSIS USING OMICS, FUNCTIONAL ANALYSIS, AND IN SILICO MODELING. Shock. 2023 Feb 1;59(2):224-231. doi: 10.1097/SHK.0000000000002047. Epub 2022 Nov 15. PMID: 36377365; PMCID: PMC9957940. Leukocyte Phenotyping Life_Change_Events Experience, Life Those occurrences, including social, psychological, and environmental, which require an adjustment or effect a change in an individual's pattern of living. http://purl.bioontology.org/ontology/MESH/D008016 Life Change Events Life_Style Factor, Lifestyle Lifestyle Factors Typical way of life or manner of living characteristic of an individual or group. http://purl.bioontology.org/ontology/MESH/D008019 Life Style Ligand_Binding_Protein Binding Protein Ligand Binding Protein General term for proteins that have binding as a major function. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C17728 Ligand Binding Protein Ligand_Binding_Protein_Gene Ligand Binding Protein Gene Ligand Binding Protein Genes encode Ligand Binding Proteins, a large class of diverse proteins for which a major function appears to be (typically high affinity) binding of some ligand for solubility, transport, bioactivity regulation, or other nonenzymatic process. Ligand interaction often alters protein molecular conformation and function. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C21295 Ligand Binding Protein Gene LightCycler_SeptiFast LightCycler SeptiFast LightCycler SeptiFast, a multipathogen probe-based real-time polymerase chain reaction, in the rapid etiological diagnosis of sepsis in patients with clinical and laboratory signs of bloodstream infections. Avolio M, Diamante P, Modolo ML, De Rosa R, Stano P, Camporese A. Direct molecular detection of pathogens in blood as specific rule-in diagnostic biomarker in patients with presumed sepsis: our experience on a heterogeneous cohort of patients with signs of infective systemic inflammatory response syndrome. Shock. 2014 Aug;42(2):86-92. doi: 10.1097/SHK.0000000000000191. PMID: 24727869. LightCycler SeptiFast Lincosamide_Antibiotic Lincosamide Antibiotic Any synthetic or semi-synthetic derivative of lincomycin, first isolated from a soil actinomycete Streptomyces lincolnensis, with antibacterial activity. Lincosamide antibiotics bind to the 23S rRNA in the large 50S subunit of bacterial ribosomes, thereby preventing the peptidyl-tRNA translocation from the A site to the P site. This results in peptidyl-tRNA dissociation from ribosomes, and leads to the release of incomplete proteins, ultimately causing cell death. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C82922 Lincosamide Antibiotic Lipid_Measurement Total Lipid Lipid Measurement LIPID Lipid A quantitative measurement of the amount of lipids (cholesterol, lipoproteins, and triglycerides) present in a sample. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C74949 Lipid Measurement Liver_Function_Test liver function test Liver Function Test LFT The quantitative measurement of liver enzymes in the blood, which is useful in assessing the functional state of a patient's liver. Liver function tests include the measurement of albumin, alanine transaminase, aspartate transaminase, alkaline phosphatase, bilirubin, and gamma glutamyl transferase. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C74954 Liver Function Test Loop_Diuretic Loop Diuretic Any agent belonging to the class of loop diuretics. Loop diuretics block and inhibit the function of the sodium-potassium-chloride (Na+, K+, Cl-) cotransporter system in the thick ascending limb of the loop of Henle, thereby inhibiting the reabsorption of sodium, potassium, and chloride ions. This leads to an increase in the excretion of sodium, potassium, chloride, calcium, magnesium, ammonium and water. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C49184 Loop Diuretic Loss_of_job Loss of job (finding) Lost job http://purl.bioontology.org/ontology/SNOMEDCT/266956001 Loss of Job Low_Density_Lipoprotein_Cholesterol_Measurement LDL Cholesterol Measurement Low Density Lipoprotein Cholesterol Measurement Low-Density Lipoprotein Cholesterol Measurement Low Density Lipoprotein-Cholesterol Measurement LDL-Cholesterol Measurement LDL Cholesterol Low-Density Lipoprotein-Cholesterol Measurement LDL-C Measurement LDL The determination of the amount of low-density lipoprotein cholesterol present in a sample. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C105588 Low Density Lipoprotein Cholesterol Measurement Low_Grade_Fever Low Grade Fever Body temperature ranging between 100.4 degrees Fahrenheit (38 degrees Celsius) and 102 degrees Fahrenheit (38.9 degrees Celsius). http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C35292 Low Grade Fever Low_Molecular_Weight_Heparin Low Molecular Weight Heparin Low-molecular-weight heparin LMWH Substances comprised of fragmented heparin molecules derived from unfractionated heparin that bind to antithrombin III with a molecular weight ranging from 1000 to 10,000 daltons, which causes changes in property from unfractionated heparin, including decreased protein binding, enhanced bioavailability, decreased platelet interaction, and decreased binding to thrombin. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C2578 Low Molecular Weight Heparin Lung_Interstitial_Tissue Lung Interstitium Lung Interstitial Tissue Lung tissue consisting of alveolar cells, pulmonary capillary endothelium, basement membrane, and perivascular tissues. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C190108 Lung Interstitial Tissue Lyase EC 4 Lyase Trivial name applied, together with dehydratase, to certain hydro-lyases (EC class 4.2.1) catalyzing hydration-dehydration. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16804 Lyase Lyase_Gene Lyase Gene Lyase Genes encode Lyases, a class of enzymes that catalyze the hydration-dehydration cleavage of C-C, C-O, C-N, and other bonds by means other than hydrolysis or oxidation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C21282 Lyase Gene Lymph_Node_Cortex Lymph Node Cortex The portion of the lymph node that contains nodules with germinal centers where B lymphocyte mature into plasma cells after activation. The nodules are separated by diffuse lymphatic tissue, lymph sinuses and trabeculae. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33029 Lymph Node Cortex Lymph_Node_Germinal_Center Lymph Node Germinal Center http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C49757 Lymph Node Germinal Center Lymph_Node_Lymphoid_Follicle Lymph Node Lymphoid Follicle http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C49586 Lymph Node Lymphoid Follicle Lymphocyte_Count Total Lymphocyte Count Lymphocyte Counts, Total Lymphocyte Number Total Lymphocyte Counts Lymphocyte Numbers Lymphocyte Counts Lymphocyte Count, Total The number of LYMPHOCYTES per unit volume of BLOOD. http://purl.bioontology.org/ontology/MESH/D018655 Lymphocyte Count Lymphoid_Cell_Count Lymphoid Cells Lymphoid Cell Count LYMPHOID The determination of the amount of lymphoid cells present in a sample. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C139064 Lymphoid Cell Count Lysophosphatidylcholine lysophosphatidylcholines monoacylglycero-3-phosphocholine LPC An acylglycerophosphocholine resulting from partial hydrolysis of a phosphatidylcholine, which removes one of the fatty acyl groups. The structure is depicted in the image where R1 = acyl, R2 = H or where R1 = H, R2 = acyl. http://purl.obolibrary.org/obo/CHEBI_60479 Lysophosphatidylcholine Lysozyme_Activity mucopeptide N-acetylmuramoylhydrolase activity muramidase activity mucopeptide glucohydrolase activity 1,4-N-acetylmuramidase activity N,O-diacetylmuramidase activity lysozyme g globulin G1 peptidoglycan N-acetylmuramoylhydrolase activity PR1-lysozyme globulin G L-7001 Catalysis of the hydrolysis of the beta-(1->4) linkages between N-acetylmuramic acid and N-acetyl-D-glucosamine residues in a peptidoglycan. http://purl.obolibrary.org/obo/GO_0003796 Lysozyme Activity MAP_Kinase_Gene Extracellular Signal-Regulated Kinase Gene Mitogen-Activated Protein Kinase Gene MAP Kinase Gene ERK MAPK MAP kinase gene products act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C26360 MAP Kinase Gene MHC_Class_II_Gene MHC Class II Gene Class II MHC MHC Class II A family of genes expressed mainly by antigen presenting cells that encode major histocompatibility complex proteins and are involved in the presentation of fragments from phagocytized extracellular proteins to cytotoxic lymphocytes. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16616 MHC Class II Gene MHC_Class_II_Protein Class II MHC Protein human lymphocyte antigen Histocompatibility Antigen, Class II Major Histocompatibility Complex Class II MHC Class II Molecule MHC Class II Protein human leukocyte antigen Human Leukocyte Antigen HLA MHC Class-II Proteins are non-covalently linked polymorphic alpha/beta transmembrane glycoproteins. The immunological function of MHC Class-II proteins is to bind and present antigenic peptides on the surfaces of cells for recognition by the antigen-specific T cell receptors of lymphocytes. These proteins plays an important role in the mediation of immune response. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20705 MHC Class II Protein MHC_Class_I_Gene Class I MHC MHC Class I MHC Class I Gene A family of genes that encode major histocompatibility complex proteins and are involved in the presentation of cytoplasmic protein fragments to cytotoxic lymphocytes. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16617 MHC Class I Gene MHC_Class_I_Protein MHC Class I Protein MHC Class I Molecule Class I MHC Protein Complex Class 1 Major Histocompatibility Complex Class 1 Histocompatibility Antigen, Class I Human Leukocyte Antigen Found on virtually every cell, MHC (Major Histocompatibility, HLA) Class-I (Antigens) Proteins consist of noncovalently bound polymorphic 44-kDa MHC membrane glycoprotein and nonpolymorphic 12-kDa b2-microglobulin. The HLA antigens are encoded by closely linked multiallelic genes of the HLA (MHC) complex, a region containing several genetic loci (HLA-A, -B, -C, -DP, -DQ, -DR, -MB, -MT, and -Te). http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20706 MHC Class I Protein Macrolide_Antibiotic Macrolide Antibiotic Macrolides An anti-microbial compound comprised of a macrocyclic lactone with a ring of twelve or more members linked to one or more monosaccharides, with bacteriostatic and potential antifungal activities. Macrolide antibiotics generally inhibit protein synthesis by binding to the 50S subunit of the bacterial ribosome. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C261 Macrolide Antibiotic Macrophage_Count Macrophage Count Macrophages MCPHG The determination of the number of macrophages present in a sample. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C74798 Macrophage Count Magnesium_Measurement Magnesium Measurement MG Magnesium A quantitative measurement of the amount of magnesium present in a sample. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C64840 Magnesium Measurement Magnetic_Resonance_Imaging Magnetic Resonance nuclear magnetic resonance imaging Medical Imaging, Magnetic Resonance / Nuclear Magnetic Resonance Magnetic Resonance Imaging Scan Structural MRI Magnetic resonance imaging (procedure) Nuclear Magnetic Resonance Imaging Magnetic Resonance Imaging NMR Imaging magnetic resonance imaging MR MR Imaging MRI MRI Scan MRIs NMRI sMRI Imaging that uses radiofrequency waves and a strong magnetic field rather than x-rays to provide detailed pictures of internal organs and tissues. The technique is valuable for the diagnosis of many pathologic conditions, including cancer, heart and vascular disease, stroke, and joint and musculoskeletal disorders. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16809 Magnetic Resonance Imaging Major_Histocompatibility_Complex_Gene HLA Complex Gene Major Histocompatibility Complex Gene A group of linked loci, collectively termed H-2 complex in the mouse and HLA complex in humans, that codes for cell-surface histocompatibility antigens and is the principal determinant of tissue type and transplant compatibility. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16812 Major Histocompatibility Complex Gene Management_of_Body_Temperature Management of body temperature (procedure) http://purl.bioontology.org/ontology/SNOMEDCT/742878008 Management of Body Temperature Mandatory_Testing Screening, Mandatory Testing, Mandatory Mandatory Screening Testing or screening required by federal, state, or local law or other agencies for the diagnosis of specified conditions. It is usually limited to specific populations such as categories of health care providers, members of the military, and prisoners or to specific situations such as premarital examinations or donor screening. http://purl.bioontology.org/ontology/MESH/D018580 Mandatory Testing Mannose-Binding_Lectin Lectin, Mannose-Binding Mannose Binding Protein Lectin, Mannan-Binding Mannose-Binding Protein Mannan Binding Lectin Mannan Binding Protein Mannose Binding Lectin Mannan-Binding Protein Mannan-Binding Lectin MBL A specific mannose-binding member of the collectin family of lectins. It binds to carbohydrate groups on invading pathogens and plays a key role in the MANNOSE-BINDING LECTIN COMPLEMENT PATHWAY. http://purl.bioontology.org/ontology/MESH/D037601 Mannose-Binding Lectin Marginal_Zone_of_the_Lymph_Node Marginal Zone of Lymph Node Marginal Zone of the Lymph Node http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33056 Marginal Zone of the Lymph Node Married Married Status MARRIED Married Indicates a person currently joined in a legally binding matrimonial union. Classify common law marriage as married. Includes married couples living together and not living together. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C51773 Married Maximum_Aggregation_Rate Maximum Aggregation Rate MAR The maximum platelet aggregation rate refers to the aggregation ability of platelets in the bloodstream, and is an indicator in platelet aggregation function testing. This value is usually divided by the maximum number of platelets divided by the diameter of platelets. Maximum Aggregation Rate Mean_Arterial_Pressure Mean Arterial Pressure MAP The mean pressure of the blood within the arterial circulation. The arterial pressure may be directly measured by insertion of an intra-arterial catheter connected to a transducer. The mean arterial pressure (MAP) can be calculated by subsequent analysis of the waveform. MAP can be approximated without an invasive procedure using the following formula: diastolic pressure plus 1/3 of the pulse pressure, where pulse pressure is systolic pressure - diastolic pressure. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C49679 Mean Arterial Pressure Mean_Neutrophil_Volume Mean Neutrophil Volume MNV The average size of the neutrophils present in a blood sample. Lee AJ, Kim SG. Mean cell volumes of neutrophils and monocytes are promising markers of sepsis in elderly patients. Blood Res. 2013 Sep;48(3):193-7. doi: 10.5045/br.2013.48.3.193. Epub 2013 Sep 25. PMID: 24086939; PMCID: PMC3786279. Mean Neutrophil Volume Mean_Platelet_Volume_Measurement Mean Platelet Volume Mean Platelet Volume Measurement MPV The determination of the average size of the platelets present in a blood sample. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C74730 Mean Platelet Volume Measurement Mean_Platelet_Volume_to_Plateletcrit_Ratio Mean Platelet Volume to Plateletcrit Ratio MPV/PCT Ratio MPV/PCT Mean Platelet Volume to Plateletcrit Ratio Medical_Contraindication contraindication Contraindication CONTRAINDICATION Medical Contraindication A symptom or medical condition that makes a particular treatment or procedure inadvisable because a person is likely to have a bad reaction. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C50646 Medical Contraindication Medical_Record Medical Report From Medical Record Medical Record Medical Records A chronological written account of a patient's examination and treatment that includes the patient's medical history and complaints, the physician's physical findings, the results of diagnostic tests and procedures, and medications and therapeutic procedures. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C45258 Medical Record Mediterranean Mediterranean MEDITERRANEAN Denotes a person having origins in any of the countries abutting the Mediterranean Sea, principally those of Europe. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C77811 Mediterranean Membrane_Protein_Gene Membrane Protein Gene A gene that encodes a protein that is associated with any of the cell membranes. These may be intrinsic, transmembrane proteins or peripheral proteins. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C26039 Membrane Protein Gene Mental_and_Behavioral_Signs_and_Symptoms Mental and Behavioral Signs and Symptoms Clinical evidence of disease resulting from mental and/or behavioral dysfunction. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C3858 Mental and Behavioral Signs and Symptoms Metallopeptidase METALLOPROTEASE Metalloproteinase Metallopeptidase A proteolytic enzyme that uses a metal ion, usually zinc, to catalyze the hydrolysis of peptide bonds. This protease is inhibited by metal chelating agents. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16843 Metallopeptidase Metallopeptidase_Gene Metalloprotease Gene Metalloproteinase Gene Metallopeptidase Gene A gene that encodes a proteolytic enzyme that depends on a metal ion to catalyze peptide bond hydrolysis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C21275 Metallopeptidase Gene Methylglyoxal_Synthase Methylglyoxal synthase (substance) http://purl.bioontology.org/ontology/SNOMEDCT/20211008 Methylglyoxal Synthase MicroRNA Small Temporal RNA MICRO RNA MIR MIRN Micro RNA MicroRNA miRNA micro-RNA microRNA A sequence of single-stranded RNA, that is 20-25 nucleotides in length, which is transcribed from DNA but is not translated into a protein. This nucleic acid may regulate the transcription or translation of other genes. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C25966 MicroRNA MicroRNA_Gene MicroRNA Gene Micro RNA Gene MiRNA Gene A gene that encodes a microRNA, which participates in the regulation of gene expression. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C80699 MicroRNA Gene Microalbuminuria Moderately increased albuminuria Microalbuminuria (finding) http://purl.bioontology.org/ontology/SNOMEDCT/312975006 Microalbuminuria Microbiology_Test Laboratory Testing, Microbiology Microbiology Test A laboratory procedure to detect microorganisms in a sample. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C49188 Microbiology Test Microcirculation Microvascular Blood Flow Blood Flow, Microvascular Microvascular Circulation Flow, Microvascular Blood Microvascular Blood Flows Microvascular Circulations Circulation, Microvascular The circulation of the BLOOD through the MICROVASCULAR NETWORK. http://purl.bioontology.org/ontology/MESH/D008833 Microcirculation Microparticle Microvesicle Circulating Microparticle Microparticle Cell-Derived Microparticle Circulating Microvesicle Ectosome A small, membrane-bound vesicle between 100 nm to 1000 nm in size found in the circulatory system. These vesicles are plasma membrane fragments shed from cells. The protein composition is similar to that of the cell that shed the particle. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C120025 Microparticle Middle_Eastern_or_North_African Middle Eastern or North African Denotes a person from any of the countries of southwest Asia and northeastern Africa; this region includes those countries east of Egypt and south of Turkey and extending to Iran in the east. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C43866 Middle Eastern or North African Mild_Chronic_Inflammation Mild Chronic Inflammation A chronic inflammatory process characterized by the accumulation of a small number of lymphocytes and plasma cells. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C82907 Mild Chronic Inflammation Mitogen-Activated_Protein_Kinase Extracellular Signal-Regulated Kinases Mitogen-Activated Protein Kinase EC 2.7.2- ERK MAPK Map Kinase Mitogen-activated protein kinases (MAPKs) are serine-threonine protein kinases activated in response to a variety of extracellular stimuli and encoded by a multigene family. The MAPKs are part of complex protein kinase cascades. One of the several classes of MAPKs includes (among other ERKs) the extracellular signal-regulated kinases ERK1 (p44MAPK) and ERK2 (p42MAPK), activated by the RAF/MEK/ERK signaling pathway. ERK1/2 are widely involved in eukaryotic signal transduction. Upon activation, ERKs translocate to the nucleus and phosphorylate nuclear targets. Phosphorylated ERKs form essential dimers with phosphorylated and unphosphorylated ERK partners. Dimerization is part of the mechanism of MAP kinase family action. Mitogen-activated protein kinases (MAPKs) promote entry in the cell cycle. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16376 Mitogen-Activated Protein Kinase Moderate_Grade_Fever Moderate Grade Fever Body temperature ranging between 102.1 degrees Fahrenheit (39 degrees Celsius) and 103.9 degrees Fahrenheit (39.9 degrees Celsius). http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C176699 Moderate Grade Fever Monocyte_Count Monocyte Count MONO Monocytes The determination of the number of monocytes in a blood sample. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C64823 Monocyte Count Monocyte_Distribution_Width Monocyte Distribution Width MDW The amount of monocyte dispersion present in a sample. http://purl.bioontology.org/ontology/LNC/LP265957-3 Monocyte Distribution Width Monocyte_Distribution_Width_Measurement Monocyte Distribution Width Measurement Monocyte Distribution Width MDW The determination of the amount of monocyte dispersion present in a sample. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C201429 Monocyte Distribution Width Measurement Monocyte_to_HDL_Ratio Monocyte to HDL Ratio Monocyte/HDL Monocyte to HDL Ratio Mononuclear_Cell_Count Mononuclear Cells Mononucleated Cells Mononuclear Cell Count MNC The determination of the amount of mononuclear cells present in a sample. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C154757 Mononuclear Cell Count Morbidity Morbidity morbidity The relative incidence of a particular disease in a population. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16877 Morbidity Mortality mortality rate Mortality Rate Death Rate Mortality mortality The proportion of deaths occurring in a population over a specified time. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16880 Mortality Rate Motor_Activity_Assessment_Scale MAAS Motor assessment scale (assessment scale) http://purl.bioontology.org/ontology/SNOMEDCT/273633002 Motor Activity Assessment Scale Multiple_Organ_Dysfunction_Syndrome Multiple Organ Dysfunction Syndrome MODS Progressive, potentially reversible physiologic dysfunction in two or more organ systems in response to severe physiologic insult. Dysregulated immunological response is the critical pathophysiologic factor in most cases. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C179648 Multiple Organ Dysfunction Syndrome Multiracial Multiracial Having ancestors of several or various races. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C67109 Multiracial Myelin_Sheath Myelin Sheath Myelin Myelinated myelin A layer of phospholipids and protein found on neuronal axons. This structure acts as an electrical insulator that allows nerve impulses to travel faster by increasing the resistance and decreasing the capacitance over that found in unmyelinated nerve fibers. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13261 Myelin Sheath Myeloid-Derived_Suppressor_Cell Myeloid-Derived Suppressor Cell MDSC A population of myeloid cells, mainly dendritic cells, macrophages and neutrophils, that have immunosuppressive activity. During inflammation, chronic infection or cancer, these cells may promote angiogenesis or tumor cell invasion. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C129908 Myeloid-Derived Suppressor Cell Native_Hawaiian_or_Other_Pacific_Islander NATIVE_HAWAIIAN_OR_OTHER_PACIFIC_ISLANDER Native Hawaiian or Other Pacific Islander native hawaiian or other pacific islander NATIVE HAWAIIAN OR OTHER PACIFIC ISLANDER A person having origins in any of the original peoples of Hawaii, Guam, Samoa, or other Pacific Islands. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C41219 Native Hawaiian or Other Pacific Islander Natural_Product Natural Product Natural Products Any whole or part of a plant (including plant exudates), animal or microorganism that is unprocessed (raw material), or that has been processed, pulverized or extracted. Many of the natural products have some biological and/or pharmacological activity or are used for a specific purpose, not necessarily medicinal (food, aroma therapy, research and etc.). This class does not include any individual substance derived from plants/animals or other organisms with specific pharmacologic activity http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C66892 Natural Product Nausea Nausea nausea Upper abdominal discomfort associated with an urge to vomit. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C3258 Nausea Nelfinavir NELFINAVIR Nelfinavir A synthetic antiviral agent that selectively binds to and inhibits human immunodeficiency virus (HIV) protease. Nelfinavir has activity against HIV 1 and 2. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C29285 Nelfinavir Neonatal_Sepsis Neonatal Sepsis An infectious disorder of newborn infants that is characterized by a systemic inflammatory response most commonly caused by bacteria. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C116802 Neonatal Sepsis Neonatal_Sepsis_Biomarker Neonatal Sepsis Diagnostic Biomarker Diagnostic Biomarker of Neonatal Sepsis Diagnostic Biomarker of NS Neonatal Sepsis Diagnostic Biomarker Neonatal_Sepsis_Prognostic_Biomarker Neonatal Sepsis Prognostic Biomarker Prognostic Biomarker of Neonatal Sepsis Prognostic Biomarker of NS Neonatal Sepsis Prognostic Biomarker Nerve_Sheath Nerve Sheath A protective cover encircling a nerve, nerve fiber or axon. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C41439 Nerve Sheath Neurogenic_Shock Vasogenic Shock Neurogenic Shock Shock resulting from neurogenic vasodilation, which can be produced by cerebral trauma or hemorrhage, spinal cord injury, deep general or spinal anesthesia, or toxic central nervous system depression. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C50671 Neurogenic Shock Neurological_Signs_and_Symptoms Neurological Signs and Symptoms A term that refers to the clinical manifestations resulting from pathologic processes that affect the central and peripheral nervous system. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C3837 Neurological Signs and Symptoms Neutrophil_Count Neutrophils Neutrophil Count A test to determine the number of neutrophils in a sample of blood. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C51950 Neutrophil Count Neutrophil_Percentage_to_Albumin_Ratio Neutrophil Percentage to Albumin Ratio NPAR NPAR was calculated as neutrophil percentage numerator divided by albumin in the admission blood samples. http://www.semanticweb.org/admin/ontologies/2022/7/MIO:00766 Neutrophil Percentage to Albumin Ratio Neutrophil_to_Lymphocyte_Ratio_Measurement Neutrophil to Lymphocyte Ratio Measurement Neutrophils/Lymphocytes NEUTLY NLR The determination of the ratio of neutrophils compared to lymphocytes present in a biological sample. The measurement may be expressed as a ratio or percentage. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C141271 Neutrophil to Lymphocyte Ratio Measurement Nevirapine 11-Cyclopropyl-5,11-dihydro-4-methyl-6H-dipyrido(3,2-b:2',3'-e)(1,4)diazepin-6-one BI-RG-587 BIRG 0587 NEVIRAPINE NVP Nevirapine Viramune A benzodiazepine non-nucleoside reverse transcriptase inhibitor. In combination with other antiretroviral drugs, nevirapine reduces HIV viral loads and increases CD4 counts, thereby retarding or preventing the damage to the immune system and reducing the risk of developing AIDS. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C29277 Nevirapine New_Zealander New Zealander Denotes a person whose ancestry is in the country of New Zealand. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C126536 New Zealander Nitric_Oxide Nitric Oxide Mononitrogen Monoxide Endothelium-Derived Relaxing Factor NITRIC OXIDE Nitrogen Oxide Nitrogen Monoxide EDRF Inomax NO An unstable free-radical gas which reacts rapidly with oxygen to form nitrogen oxides. Water soluble, NO is produced normally in numerous tissues and is considered to be a mediator of cell-to cell communication; it functions in numerous processes including vasodilation, inflammation, and neurotransmission. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C695 Nitric Oxide Non-invasive_mechanical_ventilator Non-invasive mechanical ventilator http://purl.bioontology.org/ontology/LNC/LA30281-2 Non-invasive Mechanical Ventilator Non-nucleoside_Reverse_Transcriptase_Inhibitor Non-nucleoside Reverse Transcriptase Inhibitor NNRTI A substance structurally unlike a nucleoside molecule that is capable of inhibiting the function of a reverse transcriptase. These compounds do not bind to the active site of the polymerase but in a less conserved pocket near the active site, causing a distortion in the shape of the active site and resulting in inhibition of enzymatic function, chain termination, and inhibition of viral replication. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C97453 Non-nucleoside Reverse Transcriptase Inhibitor North_American North American Denotes a person of European, Middle Eastern, or North African ancestral origins whose family settled in a North American country such as the United States of America or Canada. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C77812 North American Novel_Clinical_Phenotype Novel Clinical Phenotype In this retrospective analysis of data sets from patients with sepsis, 4 novel clinical phenotypes were identified that correlated with host-response patterns and clinical outcomes, and simulations suggested these phenotypes may help in understanding heterogeneity of treatment effects. Seymour CW, Kennedy JN, Wang S, Chang CH, Elliott CF, Xu Z, Berry S, Clermont G, Cooper G, Gomez H, Huang DT, Kellum JA, Mi Q, Opal SM, Talisa V, van der Poll T, Visweswaran S, Vodovotz Y, Weiss JC, Yealy DM, Yende S, Angus DC. Derivation, Validation, and Potential Treatment Implications of Novel Clinical Phenotypes for Sepsis. JAMA. 2019 May 28;321(20):2003-2017. doi: 10.1001/jama.2019.5791. PMID: 31104070; PMCID: PMC6537818. Novel Clinical Phenotype Nuclear_Receptor Receptor, Nuclear Nuclear Receptor Proteins that regulate transcription via interaction with chromatin and basal transcription machinery at the promoter regions of genes. Nuclear receptors are ligand-dependent transcription factors including steroids, retinoids, vitamin D, unliganded thyroid hormone, and orphan receptors (unknown ligands). Coregulators (coactivators or corepressors) are important in mediating these interactions and thereby modulate positive or negative receptor activity. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C17671 Nuclear Receptor Nuclear_Receptor_Gene Nuclear Receptor Gene Nuclear Receptor Genes (NR Superfamily) encode over 300 ligand-dependent Nuclear Receptor (NRs) transcription factors: steroid, retinoid, vitamin D, TH, and orphan receptors (unknown ligands). Transducing hormone signals into gene transcription, NRs regulate development, pattern formation, cell proliferation, cell differentiation, and homeostasis in target tissues. NRs share a common organization: an (N) modulatory domain, a conserved central Cys-rich region of two C4 zinc fingers that bind to specific upstream ligand-responsive target DNA elements, and a (C) ligand-binding domain. Stabilizing hydrophobic zinc finger interactions contribute to DNA binding specificity, homodimerization, and interaction with other proteins. Ligand-bound NR conformation allows coactivator interaction with the hormone-binding domain that mediates interaction with heat shock proteins, cyclophilins, and hormone. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20709 Nuclear Receptor Gene Nucleoside_Reverse_Transcriptase_Inhibitor Nucleoside Analog Reverse Transcriptase Inhibitor Nucleoside Reverse Transcriptase Inhibitor NRTI A substance with a structure similar to a nucleoside molecule that is capable of occupying the active catalytic site of a reverse transcriptase resulting in inhibition of enzyme function, chain termination, and inhibition of viral replication. These compounds are converted to their active phosphorylated forms by cellular kinases. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C97452 Nucleoside Reverse Transcriptase Inhibitor Nucleosomes Nucleosome Polynucleosome Dinucleosome Dinucleosomes Polynucleosomes The repeating structural units of chromatin, each consisting of approximately 200 base pairs of DNA wound around a protein core. This core is composed of the histones H2A, H2B, H3, and H4. http://purl.bioontology.org/ontology/MESH/D009707 Nucleosomes Numeric_Rating_Scale Numeric Rating Scale NRS A psychometric response scale to assess subjective characteristics or symptoms, which relies upon a scale of numeric result values in between two fixed end-points. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C121548 Numeric Rating Scale Nutrition_Assessment Nutrition Assessment http://purl.bioontology.org/ontology/LNC/MTHU048058 Nutrition Assessment Nutrition_Therapy Nutrition therapy (regime/therapy) Nutrition treatments and procedures http://purl.bioontology.org/ontology/SNOMEDCT/386373004 Nutrition Therapy Nutritional_Risk_Screening_2002_Panel Nutritional Risk Screening 2002 Panel Nutritional Risk Screening 2002 NRS-2002 NRS2002 http://purl.bioontology.org/ontology/LNC/LP429725-7 Nutritional Risk Screening 2002 Panel Observation Observational Observation Visual Inspection OBSERVATION Inspection Watching something and taking note of what happens. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C25598 Observation Organism BiologicEntity Organism Organismal Organisms Taxon organism A living entity. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C14250 Organism Oropharyngeal_Lymphoid_Tissue Oropharyngeal Lymphoid Tissue http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C49596 Oropharyngeal Lymphoid Tissue Oseltamivir OSELTAMIVIR Oseltamivir A synthetic derivative prodrug of ethyl ester with antiviral activity. Osetamivir blocks neuraminidases on the surfaces of influenza viruses, interfering with host cell release of complete viral particles. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C62061 Oseltamivir Other_Race OTHER RACE Other Race RACEOTH Individuals who do not necessarily identify with any particular race or others who do not wish to self select into a racial category(ies). http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C104495 Other Race Oxidoreductase Oxidoreductase EC 1 The class of all enzymes catalyzing oxidoreduction reactions (EC class 1). The substrate that is oxidized is regarded as a hydrogen donor. The systematic name is based on donor: acceptor oxidoreductase. The recommended name will be dehydrogenase, wherever this is possible; as an alternative, reductase can be used. Oxidase is only used in cases where O2 is the acceptor. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16946 Oxidoreductase Oxidoreductase_Gene Oxidoreductase Gene Oxidoreductase Genes encode the class of enzymes that catalyze oxidation/reduction reactions (Oxidoreductases). The oxidized substrate is regarded as a hydrogen donor. Systematic enzyme names employ dehydrogenase wherever possible, or reductase; oxidase is only used where O2 is the acceptor. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C25939 Oxidoreductase Gene Oxygen_Mask Oxygen mask (physical object) http://purl.bioontology.org/ontology/SNOMEDCT/336602003 Oxygen Mask Oxygen_Saturation StO2 Saturation of Peripheral Oxygen Oxygen Saturation Extent to which HEMOGLOBIN is saturated with OXYGEN typically as measured in arterial blood. It can be measured by various methods (e.g., PULSE OXYMETER, blood gas analysis). A low blood oxygen saturation level indicates a condition called HYPOXEMIA. http://purl.bioontology.org/ontology/MESH/D000089382 Oxygen Saturation Oxygenase Oxygenase Enzymes that oxidize substrates through transfer of oxygen from molecular oxygen. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C28459 Oxygenase P2Y12_Inhibitor P2Y12 Inhibitor P2Y12 Receptor Blocker P2Y12 inhibitor Platelet P2Y12 Receptor Antagonist Any agent that inhibits the adenosine diphosphate (ADP) receptor P2Y12. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C190801 P2Y12 Inhibitor Paediatric_Sepsis Pediatric Sepsis Paediatric_Sepsis_Diagnostic_Biomarker Paediatric Sepsis Diagnostic Biomarker Paediatric Sepsis Diagnostic Biomarker Paediatric_Sepsis_Prognostic_Biomarker Paediatric Sepsis Prognostic Biomarker Paediatric Sepsis Prognostic Biomarker Pain_Assessment Pain Measurement Pain Assessment Pain Score Analgesia Measurement Analgesia Assessment Analgesia Score The evaluation of pain complaints. Measurements should be objective on the part of the practitioner, based on subjective information from the patient. Measurements may also be indirect, by such assessments as respiratory rate and effort, withdrawal, guarding, or other appropriate assessment techniques. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20992 Pain Assessment Pain_Therapy Pain, Pain Management Pain Therapy Pain Control Pain Management Analgesia analgesia (i) the systematic study of clinical and basic science and its application for the reduction of pain and suffering; (ii) the blending of tools, techniques and principles taken from the discrete healing art disciplines and reformulated as a holistic application for the reduction of pain and suffering; and (iii) a newly emerging discipline emphasizing an interdisciplinary approach with a goal of reduction of pain and suffering. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C15180 Pain Therapy Palpitation palpitation Heart Palpitations Palpitations Palpitation An unpleasant sensation of irregular and/or forceful beating of the heart. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C37999 Palpitation Partial_Pressure_Arterial_Oxygen_to_Fraction_Inspired_Oxygen_Ratio_Measurement Partial Pressure Arterial Oxygen to Fraction Inspired Oxygen Ratio Measurement PP Arterial O2/Fraction Inspired O2 PAO2/FIO2 PO2FIO2 The determination of the ratio of the pressure of oxygen dissolved in arterial blood to the percentage oxygen of an inhaled mixture of gasses in a biological specimen. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C119293 Partial Pressure Arterial Oxygen to Fraction Inspired Oxygen Ratio Measurement Partial_Pressure_of_Carbon_Dioxide_Measurement Partial Pressure of Carbon Dioxide Measurement Partial Pressure Carbon Dioxide PCO2 A measurement of the partial pressure of carbon dioxide in a sample. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C82625 Partial Pressure of Carbon Dioxide Measurement Partial_Pressure_of_Oxygen_Measurement Partial Pressure of Oxygen Partial Pressure Oxygen Partial Pressure O2 Partial Pressure of Oxygen Measurement PO2 PaO2 Po2 pO2 Measures the pressure of oxygen dissolved in the blood and how well oxygen is able to move from the airspace of the lungs into the blood. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C71251 Partial Pressure of Oxygen Measurement Pathology_diagnosis AP diagnosis http://purl.bioontology.org/ontology/SNOMEDCT/88101002 Pathology diagnosis Pathophysiological_Etiology Pathophysiological Etiology Pathophysiological Etiology Patient_Isolation Negative Pressure Patient Isolation The segregation of patients with communicable or other diseases for a specified time. Isolation may be strict, in which movement and social contacts are limited; modified, where an effort to control specified aspects of care is made in order to prevent cross infection; or reverse, where the patient is secluded in a controlled or germ-free environment in order to protect him or her from cross infection. http://purl.bioontology.org/ontology/MESH/D010356 Patient Isolation Peak_Systolic_Blood_Velocity Peak Systolic Blood Velocity Peak Systolic Blood Velocity Pediatric_Index_of_Mortality_2 Pediatric Index of Mortality 2 PIM2 Pediatric Index of Mortality 2 Penicillin_Antibiotic Penicillin Antibioti penicillin Any beta-lactam antibiotic derived from Penicillium fungi with bactericidal activity. Penicillin antibiotics bind to and inactivate penicillin-binding proteins (PBPs) located on the inner membrane of the bacterial cell wall. Inactivation of PBPs interferes with the cross-linkage of peptidoglycan chains necessary for bacterial cell wall strength and rigidity. This interrupts bacterial cell wall synthesis and results in the weakening of the bacterial cell wall, eventually causing cell lysis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C1500 Penicillin Antibiotic Peptidase Proteolytic Enzyme Peptide Hydrolase Peptidase Protease Proteases Proteinase Enzymes acting on peptide bonds. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16965 Peptidase Peptidase_Gene Peptidase Gene Proteinase Gene Protease Gene A gene that encodes an enzyme that is capable of hydrolyzing the peptide bonds found between amino acids in proteins. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C26003 Peptidase Gene Peptide_Hormone Peptide Hormone Small proteins that function as hormonal signals, synthesized and secreted by one tissue or organ with physiological effects on other tissues or organs. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C1746 Peptide Hormone Peptide_Hormone_Gene Peptide Hormone Gene Peptide Hormone Genes encode Peptide Hormones, typically synthesized as larger precursor molecules from which are derived smaller active proteins that function as hormonal signals secreted by one tissue or organ and have physiological effects on other tissues or organs. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C25994 Peptide Hormone Gene Peptidoglycan Pseudomurein Murein A structural polymer of the bacterial cell envelope consisting of sugars and amino acids which is responsible for both shape determination and cellular integrity under osmotic stress in virtually all bacteria. http://purl.bioontology.org/ontology/MESH/D010457 Peptidoglycan Perineural_Tissue Perineural Tissue Tissue that surrounds nerves. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C41407 Perineural Tissue Peripheral_Nerve_Sheath Peripheral Nerve Sheath The protective covering surrounding the axon of neurons in the peripheral nervous system. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12972 Peripheral Nerve Sheath Personal_Medical_History Medical History Personal History MEDICAL_HISTORY General Medical History Personal Medical History personal medical history Past Medical History personal health record personal history History PMH A record of a patient's background regarding health and the occurrence of disease events of the individual. In addition, personal medical history may be a variable in epidemiologic studies. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C18772 Personal Medical History Pest_Control Pest Management Control, Pest The reduction or regulation of the population of noxious, destructive, or dangerous plants, insects, or other animals. This includes control of plants that serve as habitats or food sources for animal pests http://purl.bioontology.org/ontology/MESH/D010571 Pest Control Peyer_Patch_Germinal_Center Peyer's Patch Germinal Center Peyer Patch Germinal Center http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C49600 Peyer Patch Germinal Center Peyer_Patch_Lymphoid_Follicle Peyer's Patch Lymphoid Follicle Peyer Patch Lymphoid Follicle http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C49599 Peyer Patch Lymphoid Follicle Pharmacokinetics Pharmacokinetics pharmacokinetics PK The characteristic movements of drugs within biological systems, as affected by absorption, distribution, binding, elimination, biotransformation, and excretion; particularly the rates of such movements. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C15299 Pharmacokinetics Pharmacologic_Substance Therapeutic Agent therapeutic agents Pharmacologic Agent Pharmacologic Substance Pharmaceutical Agent Pharmaceuticals Pharmacological Substance Drug Substance therapeutic_agents Agent DRUG Drug drug Any natural, endogenously-derived, synthetic or semi-synthetic compound with pharmacologic activity. A pharmacologic substance has one or more specific mechanism of action(s) through which it exerts one or more effect(s) on the human or animal body. They can be used to potentially prevent, diagnose, treat or relieve symptoms of a disease. Formulation specific agents and some combination agents are also classified as pharmacologic substances. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C1909 Pharmacologic Substance Pharmacology Pharmacologic Pharmacological pharmacology Pharmacology P The study of pharmacologic agents. This includes the preparation, compounding, and dispensing of drugs, as well as the characteristics and properties of drugs, their effects on the body, and how they are metabolized and eliminated from the body. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16974 Pharmacology Pharmacotherapy Pharmacological Treatments Treatment With Medication drug therapy Pharmacological Treatment Pharmaceutical Therapy Drug Therapy Pharmaceutical Therapy, NOS Pharmacotherapy Treatment of disease through the use of drugs. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C15986 Pharmacotherapy Phenotype Phenotype phenotype The assemblage of traits or outward appearance of an individual. It is the product of interactions between genes and between genes and the environment. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16977 Phenotype Phenylethylamine Phenylethylamine http://purl.obolibrary.org/obo/CHEBI_50048 Phenylethylamine Phosphate Phosphate Salts and esters of phosphoric and oligophosphoric acids and their chalcogen analogues. In inorganic chemistry, the term is also used to describe anionic coordination entities with phosphorus as central atom. http://purl.obolibrary.org/obo/CHEBI_26020 Phosphate Phosphate_Measurement Phosphate Measurement Inorganic Phosphate PHOS Phosphate Phosphorus A quantitative measurement of the amount of phosphate present in a sample. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C64857 Phosphate Measurement Phospholipase Phospholipase Lecithinase Enzymes that catalyze the cleavage of a phospholipid molecule by the addition of water, thereby causing hydrolysis. The classification is based on the specificity of the bond cleaved. Hydrolytic activity initiates signaling cascades in the cell. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16980 Phospholipase Phospholipid_Measurement Phospholipid Phospholipid Measurement PHOSLPD The determination of the amount of phospholipid present in a sample. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C96623 Phospholipid Measurement Phosphotransferase Phosphotransferase Phosphotransferases EC 2.7 A class of enzymes that transfer phosphate or phosphate-containing molecules to organic substrates. These proteins play a role in the regulation of many cellular processes. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16984 Phosphotransferase Phosphotransferase_Gene Phosphotransferase Gene A Phosphotransferase Gene encodes one of a large group of enzymes that transfer phosphate, diphosphate, nucleotidyl residues, and other groups. Many phosphotransferases catalyze the conversion of a proenzyme to an active enzyme or catalyze the transfer of phosphate groups to form triphosphates (e.g., ATP). Phosphotransferases have also been subdivided according to the acceptor group. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C25871 Phosphotransferase Gene Physical_Distancing Distance, Physical Distancing, Physical Physical Distance Distancing, Social Social Distancing Distances, Physical Physical Distances Maintaining recommended amount of spacial separation between self and others. http://purl.bioontology.org/ontology/MESH/D000085762 Physical Distancing Plasma_Cell_Count Plasma Cells Plasma Cell Count Total Plasma Cells PC PLSTCE The determination of the amount of plasma cells present in a sample. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C128974 Plasma Cell Count Plasma_DNA Plasma DNA http://purl.jp/bio/4/id/201306093899955789 Plasma DNA Plasminogen_Activator Plasminogen Activator A family of serine proteases that catalyze the proteolytic conversion of plasminogen to plasmin. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16996 Plasminogen Activator Plasminogen_Activator_Inhibitor Plasminogen Activator Inhibitor A member of the serpin family of serine protease inhibitor proteins that inhibits plasminogen activator type proteases. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16997 Plasminogen Activator Inhibitor Platelet_Count Platelet count Anucleated Thrombocytes Platelet Count PLAT PLT Platelets The determination of the number of platelets in a biospecimen. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C51951 Platelet Count Platelet_Disorder Platelet Disorder Platelet Abnormality A disorder of platelet function or platelet production that may cause increased bleeding. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C131634 Platelet Disorder Platelet_Distribution_Width Platelet Distribution Width PDW A measurement of the range of platelet sizes in a blood specimen. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C81962 Platelet Distribution Width Platelet_to_Lymphocyte_Ratio Platelet to Lymphocyte Ratio PLR The ratio of platelet count to lymphocyte count, quantified in a blood sample. Both neutrophil-to-lymphocyte ratio and platelet-to-lymphocyte ratio have been proposed as biomarkers for the diagnosis or prognostic prediction of disease. http://www.semanticweb.org/admin/ontologies/2022/7/MIO:00780 Platelet to Lymphocyte Ratio Polymyxin_Antibiotic Polymyxin Antibiotic Any of the polymyxin antibiotics, cyclic peptides with long hydrophobic ends, obtained from Bacillus polymyxa strains. Polymyxin antibiotics exert their antimicrobial effect through their cationic detergent actions on cell membranes. Specifically, they bind to the negatively charged site in the lipopolysaccharide (LPS) layer of the bacterial cell membrane via electrostatic affinity with the positively charged amino groups in the cyclic peptide portion of the polymyxin antibiotic. Subsequently, the fatty acid portion of the polymyxin antibiotic dissolves in the hydrophobic region of the bacterial cell membrane. This results in an alteration in cell membrane structure, an increase in permeability for water and other molecules and disruption of cell wall integrity. This leads to bacterial cell death. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C78160 Polymyxin Antibiotic Post-Translational_Modification_Site Post-Translational Protein Modification Site Posttranslational Protein Modification Site STRUCTURAL ATTACHMENT POINT Post-Translational Modification Site Posttranslational Modification Site A post-translational modification site refers to amino acid residues within a peptide that act as acceptors for any modifications that do not happen concurrent with translation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C14050 Post-Translational Modification Site Potassium-Sparing_Diuretic Potassium-Sparing Diuretic Any diuretic agent that produces diuresis without increasing potassium excretion. Potassium sparing diuretics are generally either aldosterone antagonists and thus prevent the aldosterone-mediated promotion of sodium and water retention, or are epithelial sodium channel blockers and prevent the exchange of potassium for sodium in the distal convoluted tubule. These agents cause diuresis without increasing potassium secretion and thus do not cause hypokalemia. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C49186 Potassium-Sparing Diuretic Potassium_Measurement Potassium Measurement K Potassium A quantitative measurement of the amount of potassium present in a sample. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C64853 Potassium Measurement PpvCO2_and_PaCO2_Diffenrence PpvCO2 and PaCO2 Difference Ppv-aCO2 PpvCO2 and PaCO2 Difference Prediction_of_Response_to_Therapy Prediction of Response to Therapy http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C18954 Prediction of Response to Therapy Pro-Hyp L-prolyl-(4R)-4-hydroxy-L-proline Prolylhydroxyproline L-Pro-L-Hyp L-Prolyl-L-hydroxyproline A dipeptide composed of L-proline and L-hydroxyproline residues. It is a biomarker for bone collagen degradation. http://purl.obolibrary.org/obo/CHEBI_74767 Pro-Hyp Prognosis Prediction of Outcome Prognosis prognosis Prediction of the probable course and outcome of a disease. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C17013 Prognostic Procedure Prognostic_Biomarker Prognostic Biomarker A biomarker used to identify likelihood of a clinical event, disease recurrence, or progression in patients who have the disease or medical condition of interest. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C201363 Prognostic Biomarker Prognostic_Nutritional_Index PNI prognostic nutritional index http://purl.jp/bio/4/id/201006007350221648 Prognostic Nutritional Index Protein Protein (NOS) Protein Proteins protein A group of complex organic macromolecules composed of one or more chains (linear polymers) of alpha-L-amino acids linked by peptide bonds and ranging in size from a few thousand to over 1 million Daltons. Proteins are fundamental genetically encoded components of living cells with specific structures and functions dictated by amino acid sequence. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C17021 Protein Protein_C_Deficiency_Disease Protein C Deficiency Disease Protein C Deficiency A rare thrombophilia disorder characterized by deficiency of protein C. It results in venous thromboembolism. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C99025 Protein C Deficiency Disease Protein_Domain Protein Feature Protein Motif Protein Domain Protein Region Domain Feature Motif Region Signature domain A structurally or functionally defined protein region. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13379 Protein Domain Protein_Family Protein Family Collection of proteins that are evolutionarily related. This is reflected in the structural and functional similarities as well as in the extent of sequence conservation or residue identity. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20130 Protein Family Protein_Kinase Protein Kinase A class of phosphotransferase proteins that posttranslationally modify protein substrates through the addition of phosphate groups. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C17018 Protein Kinase Protein_S_Deficiency_Disease Protein S Deficiency Disease Protein S Deficiency A rare thrombophilia disorder characterized by deficiency of protein S. It results in venous thromboembolism. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C99026 Protein S Deficiency Disease Protein_or_Riboprotein_Complex Protein or Riboprotein Complex Multimeric subcellular structures containing proteins, and possibly, RNA. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C21176 Protein or Riboprotein Complex Proteinase_Inhibitor_Gene Proteinase Inhibitor Gene Proteinase Inhibitor Genes encode Proteinase Inhibitor Proteins that block the activity of proteases, endopeptidases that catalyze the cleavage of internal peptide bonds in a polypeptide or protein substrate (Serine Endopeptidases, Cysteine Endopeptidases, Aspartic Endopeptidases, Metalloendopeptidases, and other Endopeptidases). http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C29936 Proteinase Inhibitor Gene Prothrombin_Time Prothrombin Time Test Prothrombin Time PT A measurement of the clotting time of plasma recalcified in the presence of excess tissue thromboplastin; it is a measure of the extrinsic pathway of coagulation. It is used to determine the clotting tendency of blood, in the measure of warfarin dosage, liver damage and vitamin K status. Factors measured are fibrinogen, prothrombin, and factors V, VII, and X. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C62656 Prothrombin Time Public_Health_Practice Health Practice, Public Public Health Practices The activities and endeavors of the public health services in a community on any level. http://purl.bioontology.org/ontology/MESH/D015980 Public Health Practice Pulse_Rate PULSE Pulse Rate The rate of the pulse as observed in an artery, expressed as beats per minute. It can be measured at several anatomic sites, including the wrist, neck, temple, groin, behind the knees, or on top of the foot. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C49676 Pulse Rate Quarantine Health Lockdown Health Travel Restrictions Border Travel Restrictions, Health-Related Lockdown, Health Self-Quarantine Stay at Home Orders Travel Restriction, Health Self Quarantine Health Related Border Travel Restrictions Border Closing, Health Related Health-Related Travel Restriction Health Related Travel Restrictions Cordon Sanitaire Travel Restrictions, Health-Related Health Related Travel Restriction Travel Restrictions, Health Related Health-Related Travel Restrictions Border Closing, Health-Related Health-Related Border Closings Health-Related Border Closing Travel Restrictions, Health Health Travel Restriction Quarantines Border Closings, Health-Related Health Lockdowns Health-Related Border Travel Restrictions Travel Restriction, Health-Related Border Travel Restrictions, Health Related Limited freedom of movement of individuals to reduce the risk of spread of communicable disease by those who have been exposed to infectious or communicable disease in order to prevent its spread; a period of detention of vessels, vehicles, or travelers coming from infected or suspected places; and detention or isolation on account of suspected contagion. It includes government regulations on travel restrictions, border security measures to mitigate spread of a contagion and the detention of animals at frontiers or ports of entrance for the prevention of infectious disease. http://purl.bioontology.org/ontology/MESH/D011790 Quarantine Quick_Sequential_Organ_Failure_Assessment Quick Sequential Organ Failure Assessment qSOFA A diagnostic criteria for sepsis. Singer M, Deutschman CS, Seymour CW, Shankar-Hari M, Annane D, Bauer M, Bellomo R, Bernard GR, Chiche JD, Coopersmith CM, Hotchkiss RS, Levy MM, Marshall JC, Martin GS, Opal SM, Rubenfeld GD, van der Poll T, Vincent JL, Angus DC. The Third International Consensus Definitions for Sepsis and Septic Shock (Sepsis-3). JAMA. 2016 Feb 23;315(8):801-10. doi: 10.1001/jama.2016.0287. PMID: 26903338; PMCID: PMC4968574. Quick Sequential Organ Failure Assessment Quinolone_Antibiotic Quinolone Antibiotic The basic structure of quinolone is nalidixic acid that has limited therapeutic value. However, the development of fluorinated quinolones led to new derivative compounds with broad antibacterial activity. Both DNA gyrase and topoisomerase IV are targets of quinolones. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C795 Quinolone Antibiotic RALIS RALIS RALIS Race Racial Group Patient Reported Race RACE Race race A geographic ancestral origin category that is assigned to a population group based mainly on physical characteristics that are thought to be distinct and inherent. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C17049 Race Ramsay_Sedation_Scale Ramsay sedation scale (assessment scale) http://purl.bioontology.org/ontology/SNOMEDCT/281400004 Ramsay Sedation Scale Receptor Receptor Protein Receptor receptor A protein located on the cell surface, or in the cytoplasm, that binds to a specific signaling factor, such as a hormone, antigen, or neurotransmitter, causing a conformational and functional change in the receptor molecule. The ligand-bound receptor then alters its interaction with target molecules, which leads to changes in cellular physiology through modification of the activity of one or more signal transduction pathways. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C18106 Receptor Receptor_Gene Receptor Gene Receptor Genes encode cell surface or cytoplasmic receptor proteins that each bind to specific signaling factors (such as a hormone, antigen, or neurotransmitter) causing a conformational and functional change in the ligand-bound receptor, altering its interaction with target molecules and leading to changes in cellular physiology through modification of the activity of one or more signal transduction pathways. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20103 Receptor Gene Receptor_Tyrosine_Kinase Tyrosine Receptor Kinase Tyrosine Kinase Receptor EGF Receptor-Tyrosine Kinase Family Receptor Tyrosine Kinase Receptor-Tyrosine Kinase Tyrosine Kinase Growth Factor Receptor EC 2.7.10.1 Receptor-Type Protein-Tyrosine Kinase Receptor Protein-Tyrosine Kinase Transmembrane Receptor Protein Tyrosine Kinase RTK TKR TRK A class of membrane receptors that contain protein tyrosine kinase activity. This enzymatic activity is integral to the function of the receptor as a signal transducer; the phosphorylation event alters the functional activity of its protein substrate. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C17660 Receptor Tyrosine Kinase Receptor_Tyrosine_Kinase_Gene Receptor Tyrosine Kinase Gene Tyrosine kinase receptors (TRKs) are a family of genes encoding neurotrophin receptors that include trkA, trkB, and trkC, which are related to development, differentiation, and survival of neural crest-derived neurons and central cholinergic neurons in normal tissue. The genes encoding trkA, trkB, and trkC are designated NTRK1, NTRK2, and NTRK3 and map to chromosomes 1, 9, and 15, respectively. A member of the TRK gene family, trkE, encodes a non-neuronal receptor for nerve growth factor. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20719 Receptor Tyrosine Kinase Gene Recombinant_Cytokine Recombinant Cytokine Cytokines http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C1283 Recombinant Cytokine Red_Blood_Cell_Distribution_Width_to_Platelet_Ratio Red Blood Cell Distribution Width to Platelet Ratio RPR The ratio between the red blood cell distribution and platelet. http://www.semanticweb.org/admin/ontologies/2022/7/MIO:01858 Red Blood Cell Distribution Width to Platelet Ratio Regulatory_Gene Regulatory Gene Regulatory Genes encode products that regulate or circumscribe the activity of diverse cellular functions. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20194 Regulatory Gene Regulatory_Protein Regulatory Protein Encoded by Regulatory Genes, Regulatory Proteins regulate or circumscribe the activity of many cellular functions. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C18466 Regulatory Protein Remarried Remarried An indication that an individual has married, after already having been married at least once. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C150747 Remarried Renal_Clearance Renal Clearance RENALCL Renal CL The rate at which a substance is removed from the blood via the kidneys. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C75913 Renal Clearance Renal_Function_Test kidney function test renal function test Renal Function Test A laboratory procedure that evaluates the kidney function. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C74972 Renal Function Test Renal_Interstitial_Tissue Renal Interstitial Tissue Renal tissue consisting of peritubular and periarterial spaces. The relative contribution of each of these two spaces to interstitial volume varies, but increases in size from the cortex to the papilla. In the cortex there is little interstitium because the peritubular capillaries occupy most of the space between the tubules. The cortical interstitial cells and outer medula consist mainly of fibroblastic cells and mononuclear cells. The inner medulla consists primarily of pericytes, lipid-laden cells and mononuclear cells arranged like rungs of a ladder. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33459 Renal Interstitial Tissue Reproductive_History Reproductive Issues Reproductive History Reproductive Factors An account of all reproductive events and problems a person has experienced. An important aggregate factor in epidemiological studies of women's health. The concept usually includes the number and timing of pregnancies and their outcomes, the incidence of breast feeding, and may include age of menarche and menopause, regularity of menstruation, fertility, gynecological or obstetric problems, or contraceptive usage. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C17655 Reproductive History Respiratory_Rate respiration_rate respiration rate Respiratory rate Respiratory Rate Vital Signs – Respiratory Rate RESP RESPRATE The rate of breathing (inhalation and exhalation) measured within in a unit time, usually expressed as breaths per minute. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C49678 Respiratory Rate Respiratory_System Respiratory Organ System, Pulmonary Pulmonary Body System respiratory tract Respiratory System Pulmonary Organ System Body System, Pulmonary respiratory system RESPIRATORY SYSTEM The organs involved in the exchange of carbon dioxide and oxygen including the trachea, bronchi, and lung parenchyma. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12779 Respiratory System Respiratory_System_Signs_and_Symptoms Respiratory System Signs and Symptoms http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C85403 Respiratory System Signs and Symptoms Respiratory_Therapy Respiratory Therapy respiratory therapy RT Any form of treatment that acts to improve or assist with respiratory function. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C15322 Respiratory Therapy Retired RT - Retired Retired, life event http://purl.bioontology.org/ontology/SNOMEDCT/105493001 Retired Reverse_Transcriptase_Inhibitor Viral Reverse Transcriptase Inhibitor Reverse Transcriptase Inhibitor Any substance that inhibits the activity of viral reverse transcriptase, an RNA-dependent DNA polymerase that transcribes viral RNA into DNA during virus replication. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C1589 Reverse Transcriptase Inhibitor Ribavirin 1-Beta-D-ribofuranosyl-1,2,4-triazolo-3-carboxamide 1-Beta-D-ribofuranosyl-1H-1,2,4-triazole-3-carboxamide 1-.beta.-D-Ribofuranosyl-1H-1,2, 4-triazole-3-carboxamide Copegus ICN 1229 ICN-1229 RIBA RIBAVIRIN RTCA Rebetol Ribavirin Viramide Virazid Virazole ribavirin A synthetic nucleoside analog of ribofuranose with activity against hepatitis C virus and other RNA viruses. Ribavirin is incorporated into viral RNA, thereby inhibiting viral RNA synthesis, inducing viral genome mutations, and inhibiting normal viral replication. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C807 Ribavirin Richmond_Agitation-Sedation_Scale Richmond Agitation-Sedation Scale RASS http://purl.bioontology.org/ontology/SNOMEDCT/457441000124102 Richmond Agitation-Sedation Scale Right_Ventricle_Failure_Phenotype Right Ventricle Failure Phenotype Rigor Repeated shaking with chills Rigor Rigors Severe chills accompanied by vigorous shaking. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C111658 Rigor Riker_Sedation-Agitation_Scale_Clinical_Classification Riker Sedation-Agitation Scale Clinical Classification SAS SAS01 A standardized seven-point rating scale developed by Riker et al. 1999 to assess the level of alertness and agitation in critically ill patients. The assigned score ranges from 1 to 7, with three levels of sedation ranging from unarousable to sedated, one level indicating calm and cooperative, and three levels of agitation, ranging from agitated to dangerous agitation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C171418 Riker Sedation-Agitation Scale Clinical Classification Risk_Factor risk factor risk factors Risk Factor risk_factors Any aspect of an individual's life, behavior, an environmental exposure, or an inborn or inherited characteristic that increases the likelihood of a disease, condition or injury. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C17103 Endogenous Risk Factor Ritonavir Norvir RIT RITONAVIR Ritonavir ritonavir A peptidomimetic agent that inhibits both HIV-1 and HIV-2 proteases. Ritonavir is highly inhibited by serum proteins but boosts the effect of other HIV proteases by blocking their degradation by cytochrome P450. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C1609 Ritonavir S100_Calcium_Binding_Protein S100 Calcium Binding Protein S100 Protein S-100 Protein S100 A family of low molecular weight proteins that are characterized by the presence of two EF-hand calcium binding domains. These proteins form homodimers that localize either in the cytoplasm or nucleus of neural crest-derived cells and are involved in the regulation of many cellular processes such as cell cycle progression and differentiation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C29924 S100 Calcium Binding Protein S100_Family_Gene S100 Family Gene S100 Family Gene members, many clustered on chromosome 1q21, encode S100 Calcium Binding Proteins localized in the cytoplasm and/or nucleus of many cells that often regulate cellular processes such as cell cycle progression and differentiation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20849 S100 Family Gene Sanitation Sanitation The development and establishment of environmental conditions favorable to the health of the public. http://purl.bioontology.org/ontology/MESH/D012499 Sanitation Saquinavir Fortovase SAQUINAVIR Saquinavir A peptidomimetic inhibitor of human immunodeficiency virus (HIV) protease. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C29444 Saquinavir Secondary_Protein_Structure Secondary Protein Structure Secondary Structure The specific 3-dimensional folded protein structure that is determined by the hydrogen bonds formed between amino acids in the polypeptide chain. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13302 Secondary Protein Structure Sedation Sedation The process of allaying nervous excitement or the state of being calmed. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C21097 Sedation Sedation_Assessment Sedation Assessment Sedentary_Behavior Lack of Physical Activity Less than 150 minutes of moderate to vigorous intensity physical activity per week or 75 minutes of vigorous intensity physical activity per week. http://purl.bioontology.org/ontology/MESH/D057185 Sedentary Behavior Selenium SELENIUM Se Selenium selenium A nonmetallic chemical element found in trace amounts in human body. Selenium primarily occurs in vivo as selenocompounds, mostly selenoproteins such as glutathione peroxidase and thioredoxin reductase (enzymes responsible for detoxification). Alone or in combination with Vitamin E, selenocompounds act as antioxidants. These agents scavenge free radicals; prevent blood clots by inhibiting platelet aggregation; strengthen the immune system; and have been shown, in some instances, to inhibit chromosomal damage and mutations. Exhibiting chemopreventive activity, selenocompounds also inhibit the induction of protein kinase C. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C825 Selenium Sepsis-induced_Coagulopathy_Score Sepsis-induced Coagulopathy Score SIC Score SIC Sepsis-induced Coagulopathy Score Sepsis_Prognosis Sepsis Prognosis Prognosis A forecast of the probable course and outcome of sepsis. Prognostic Prediction Septic_Shock Septic Shock Systemic Septic Shock Septic shock is a subset of sepsis in which underlying circulatory and cellular/metabolic abnormalities are profound enough to substantially increase mortality. Singer M, Deutschman CS, Seymour CW, Shankar-Hari M, Annane D, Bauer M, Bellomo R, Bernard GR, Chiche JD, Coopersmith CM, Hotchkiss RS, Levy MM, Marshall JC, Martin GS, Opal SM, Rubenfeld GD, van der Poll T, Vincent JL, Angus DC. The Third International Consensus Definitions for Sepsis and Septic Shock (Sepsis-3). JAMA. 2016 Feb 23;315(8):801-10. doi: 10.1001/jama.2016.0287. PMID: 26903338; PMCID: PMC4968574. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C35018 Septic Shock Sequential_Organ_Failure_Assessment SOFA Sequential Organ Failure Assessment A diagnostic criteria for sepsis. Singer M, Deutschman CS, Seymour CW, Shankar-Hari M, Annane D, Bauer M, Bellomo R, Bernard GR, Chiche JD, Coopersmith CM, Hotchkiss RS, Levy MM, Marshall JC, Martin GS, Opal SM, Rubenfeld GD, van der Poll T, Vincent JL, Angus DC. The Third International Consensus Definitions for Sepsis and Septic Shock (Sepsis-3). JAMA. 2016 Feb 23;315(8):801-10. doi: 10.1001/jama.2016.0287. PMID: 26903338; PMCID: PMC4968574. http://purl.bioontology.org/ontology/SNOMEDCT/459231000124102 Sequential Organ Failure Assessment Serine_Protease Serine Proteinase Serine Protease Serine Peptidase Proteases that have a serine residue in the active center of the enzyme. These enzymes catalyze the hydrolysis of covalent peptidic bonds by serine nucleophilic attack. Serine proteases participate in a wide range of functions in the body, including blood clotting, inflammation, and digestion. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C17123 Serine Protease Serine_Proteinase_Inhibitor_Protein Serine Proteinase Inhibitor Protein Serine Proteinase Inhibitor Serine Protease Inhibitor A protein that plays a role in the inhibition of serine proteinases. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C17122 Serine Proteinase Inhibitor Protein Serum_Alanine_Aminotransferase_Measurement Serum Alanine Transaminase Measurement Serum SGPT Measurement Serum Alanine Aminotransferase Measurement A quantitative measurement of the amount of alanine aminotransferase present in a sample of serum. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61017 Serum Alanine Aminotransferase Measurement Serum_Albumin_Measurement Serum Albumin Measurement A quantitative measurement of the amount of albumin present in a sample of serum. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61015 Serum Albumin Measurement Serum_Alkaline_Phosphatase_Measurement Serum Alkaline Phosphatase Measurement A quantitative measurement of the amount of alkaline phosphatase present in a sample of serum. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61016 Serum Alkaline Phosphatase Measurement Serum_Amyloid_A1_Measurement Serum Amyloid A1 Serum Amyloid A1 Measurement SAA Measurement Serum Amyloid A-1 Protein SAA1 Measurement PIG4 SAA1 The determination of the amount of serum amyloid A1 present in a sample. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C165982 Serum Amyloid A1 Measurement Serum_Aspartate_Aminotransferase_Measurement Serum Aspartate Transaminase Measurement Serum Aspartate Aminotransferase Measurement Serum SGOT Measurement A quantitative measurement of the amount of aspartate aminotransferase present in a sample of serum. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61018 Serum Aspartate Aminotransferase Measurement Serum_Bicarbonate Serum Bicarbonate Measurement A quantitative measurement of the amount of bicarbonate present in a sample of serum. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61022 Serum Bicarbonate Serum_Bicarbonate_Measurement Serum Bicarbonate Measurement A quantitative measurement of the amount of bicarbonate present in a sample of serum. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61022 Serum Bicarbonate Measurement Serum_Calcium_Measurement Serum Calcium Serum Calcium Measurement A quantitative measurement of the amount of calcium present in a sample of serum. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61020 Serum Calcium Measurement Serum_Chemistry_Measurement Serum Chemistry Measurement A quantitative measurement of a particular substance present in a sample of serum. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61014 Serum Chemistry Measurement Serum_Chloride_Measurement Serum Chloride Measurement A quantitative measurement of the amount of chloride present in a sample of serum. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61021 Serum Chloride Measurement Serum_Creatinine_Measurement Serum Creatinine Measurement A quantitative measurement of the amount of creatinine present in a sample of serum. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61023 Serum Creatinine Measurement Serum_Direct_Bilirubin_Measurement Serum Direct Bilirubin Measurement A quantitative measurement of the amount of conjugated or water-soluble bilirubin present in a sample of serum. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61024 Serum Direct Bilirubin Measurement Serum_Gamma_Glutamyl_Transpeptidase_Measurement Serum Gamma Glutamyl Transpeptidase Measurement A quantitative measurement of the amount of gamma glutamyl transpeptidase present in a sample of serum. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61025 Serum Gamma Glutamyl Transpeptidase Measurement Serum_Glucose_Measurement Serum Glucose Measurement A quantitative measurement of the amount of glucose present in a sample of serum. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61027 Serum Glucose Measurement Serum_HDL_Cholesterol_Measurement Serum HDL Cholesterol Measurement HDL Cholesterol Serum HDL Cholesterol A quantitative measurement of the amount of HDL cholesterol present in a sample of serum. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61041 Serum HDL Cholesterol Measurement Serum_LDL_Cholesterol_Measurement Serum LDL Cholesterol Serum LDL Cholesterol Measurement LDL Cholesterol A quantitative measurement of the amount of LDL cholesterol present in a sample of serum. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61042 Serum LDL Cholesterol Measurement Serum_Lactate_Dehydrogenase_Measurement Serum Lactate Dehydrogenase Measurement A quantitative measurement of the amount of lactate dehydrogenase present in a sample of serum. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61026 Serum Lactate Dehydrogenase Measurement Serum_Magnesium_Measurement Serum Magnesium Measurement Serum Mg Measurement A quantitative measurement of the amount of magnesium present in a sample of serum. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61035 Serum Magnesium Measurement Serum_Mesothelin_Measurement Serum Mesothelin Serum MSLN Measurement Serum Mesothelin Measurement A quantitative measurement of the amount of mesothelin present in a sample of serum. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C184798 Serum Mesothelin Measurement Serum_Neuron_Specific_Enolase_Measurement Serum ENO2 Measurement Serum neuron-specific enolase Serum Neuron Specific Enolase Measurement Serum Enolase 2 Measurement Serum Gamma-Enolase Measurement Serum Neuron-Specific Enolase Measurement Serum NSE Measurement The determination of the amount of neuron specific enolase present in a serum sample. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C189749 Serum Neuron Specific Enolase Measurement Serum_Phosphate_Measurement Serum Phosphate Measurement A quantitative measurement of the amount of phosphate present in a sample of serum. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61028 Serum Phosphate Measurement Serum_Potassium_Measurement Serum Potassium Measurement A quantitative measurement of the amount of potassium present in a sample of serum. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61030 Serum Potassium Measurement Serum_Sodium_Measurement Serum Sodium Measurement A quantitative measurement of the amount of sodium present in a sample of serum. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61029 Serum Sodium Measurement Serum_Total_Bilirubin_Measurement Serum Total Bilirubin Measurement A quantitative measurement of the total amount of bilirubin present in a sample of serum. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61031 Serum Total Bilirubin Measurement Serum_Total_Cholesterol_Measurement Total Cholesterol Serum Total Cholesterol Measurement A quantitative measurement of the total amount of cholesterol present in a sample of serum. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61032 Serum Total Cholesterol Measurement Serum_Total_Protein_Measurement Serum Total Protein Measurement Total Serum Protein Measurement Serum Protein Total Measurement A quantitative measurement of the total amount of protein present in a sample of serum. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61033 Serum Total Protein Measurement Serum_Triglyceride_Measurement Serum Triglyceride Measurement A quantitative measurement of the amount of triglycerides present in a sample of serum. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61037 Serum Triglyceride Measurement Serum_Uric_Acid_Measurement Serum Uric Acid Measurement A quantitative measurement of the amount of uric acid present in a sample of serum. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61034 Serum Uric Acid Measurement Serum_VLDL_Cholesterol_Measurement Serum VLDL Cholesterol Measurement A quantitative measurement of the amount of very-low-density-lipid (VLDL) cholesterol present in a sample of serum. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C64806 Serum VLDL Cholesterol Measurement Sheath_of_Schwann Sheath of Schwann Neurilemma Nerve sheath that is part of the myelinated segment of an axon. It is composed of Schwann cells. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33544 Sheath of Schwann Shock Circulatory Collapse Shock A life-threatening condition that requires immediate medical intervention. It is characterized by reduced blood flow that may result in damage of multiple organs. Types of shock include cardiogenic, hemorrhagic, septic, anaphylactic, and traumatic shock. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C35016 Shock Sialic_Acid Sialic Acid sialic acid http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C28188 Sialic Acid Siderophore siderophore siderochrome siderophores ferrioxamines ironophore siderochromes ferrioxamine Any of low-molecular-mass iron(III)-chelating compounds produced by microorganisms for the purpose of the transport and sequestration of iron. http://purl.obolibrary.org/obo/CHEBI_26672 Siderophore Sign_or_Symptom Clinical Signs Sign or Symptom CLINICAL SIGNS Signs or Symptoms Clinical Signs or Symptoms CLINICAL FINDING Clinical Finding DESC Objective evidence of disease perceptible to the examining practitioner (sign) and subjective evidence of disease perceived by the patient (symptom). http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C100104 Sign or Symptom Signaling_Pathway_Gene Signaling Gene Proto-Oncogene, Signaling Factor Signaling Pathway Gene Signaling Pathway Genes encode proteins or peptides that participate in intracellular signal transduction processes. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20921 Signaling Pathway Gene Signaling_Pathway_Protein Signaling Pathway Protein Signaling Protein Proteins or peptides that participate in signal transduction processes in the cell. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C18515 Signaling Protein Single Single Person Single Unwed. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C150721 Single Single-cell_Mitochondrial_Mass_plus_CD4 Single-cell Mitochondrial Mass plus CD4 SCMM plus CD4 Single-cell Mitochondrial Mass plus CD4 Skin_Irritation Skin Irritation A mild inflammatory dermal tissue reaction; it can be caused by physical contact with an irritant or can be a local response to a systemic trigger. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C50743 Skin Irritation Small_Intestinal_Submucosa Small Intestinal Submucosa Loose, filamentous areolar connective tissue between the muscularis mucosa and the muscular coat of the small intestine. It contains blood vessels, lymphatics, and nerves. The duodenal submucosa contains mucus-secreting Brunner's glands. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C33572 Small Intestinal Submucosa Smoking_History Smoking History The history of when and what an individual smoke(s) or smoked. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C156825 Smoking History Sodium_Measurement Sodium Measurement SODIUM Sodium NA A quantitative measurement of the amount of sodium present in a sample. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C64809 Sodium Measurement Sodium_to_Potassium_Ratio_Measurement Sodium to Potassium Ratio Measurement Sodium/Potassium NAK The determination of the ratio of sodium to potassium present in a sample. The measurement by be expressed as a ratio or percentage. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C122137 Sodium to Potassium Ratio Measurement South_American South American SOUTH AMERICAN Denotes a person whose ancestry is in any of the countries of South America. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C126532 South American South_or_Central_American_Indian South or Central American Indian Denotes a person having origins in one of the indigenous people of South or Central America such as Mayans or Incas. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C77809 South or Central American Indian Splenic_Marginal_Zone Spleen Marginal Zone Splenic Marginal Zone http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C49769 Splenic Marginal Zone Sterilization Sterilization The destroying of all forms of life, especially microorganisms, by heat, chemical, or other means. http://purl.bioontology.org/ontology/MESH/D013242 Sterilization Still_Hypovolemic_Phenotype Still Hypovolemic Phenotype Stomach_Pain Stomach Pain Stomach pain Gastric Pain A painful sensation in the stomach. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C78630 Stomach Pain Stopped_work Stopped work (finding) http://purl.bioontology.org/ontology/SNOMEDCT/160895006 Stopped Work Stress Stress stress The negative mental, emotional, and physical reactions that occur when environmental stressors are perceived as exceeding the individual's adaptive capacities. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C35041 Stress Structural_Protein Structural Protein Proteins whose major function is to give shape and support to tissues, cells, and subcellular structures. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C18073 Structural Protein Structural_Protein_Gene Structural Gene Structural Protein Gene A gene that encodes a protein with a chief function as part of a physical structure within a cell. This is in contrast to genes that encode proteins with a function that is enzymatic or regulatory. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20744 Structural Protein Gene Subtype Subtype A group forming a type within a larger type. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C25696 Age Subtype Sulfate_Measurement Sulfate Measurement SULFATE Sulfate Sulphate The determination of the amount of sulfate present in a sample. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C122153 Sulfate Measurement Sulfonamide_Anti-Infective_Agent Sulfonamides Sulfonamide Anti-Infective Agent sulfonamide sulfa drug A class of natural or synthetic sulfanilamide derivatives with antibacterial activity. Sulfonamides are structural analogs of para-aminobenzoic acid (essential for microbial folate synthesis). Sulfonamides inhibit bacterial metabolism by competing with PABA for dihydropteroate synthase, thereby resulting in disruption of folic acid metabolism and ultimately DNA synthesis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C29739 Sulfonamide Anti-Infective Agent Superego Superegos The component of the personality associated with ethics, standards, and self-criticism - the "conscience". It is derived mainly from identification with parents and parent substitutes. http://purl.bioontology.org/ontology/MESH/D013475 Superego Surgery Surgical Specialty Surgical Specialties Surgical Profession Surgery The branch of medical science that treats disease or injury by operative procedures. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C17173 Surgery Surgical_History history of surgery Surgical History A clinical history that is about surgical operations performed on an individual. http://purl.obolibrary.org/obo/GECKO_0000092 Surgical History Surgical_Shock Surgical Shock Hypoperfusion of body tissues occurring during or after a surgical procedure, and resulting in cellular injury and vital organ dysfunction. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C35019 Surgical Shock Surviving_Sepsis_Campaign_Guidelines ＳＳＣガイドライン SSCガイドライン ＳＳＣＧ Surviving Sepsis Campaign：International Guidelines for Management of Sepsis and Septic Shock 2021 Surviving Sepsis Campaign Guidelines Evans L, Rhodes A, Alhazzani W, Antonelli M, Coopersmith CM, French C, Machado FR, Mcintyre L, Ostermann M, Prescott HC, Schorr C, Simpson S, Wiersinga WJ, Alshamsi F, Angus DC, Arabi Y, Azevedo L, Beale R, Beilman G, Belley-Cote E, Burry L, Cecconi M, Centofanti J, Coz Yataco A, De Waele J, Dellinger RP, Doi K, Du B, Estenssoro E, Ferrer R, Gomersall C, Hodgson C, Hylander Møller M, Iwashyna T, Jacob S, Kleinpell R, Klompas M, Koh Y, Kumar A, Kwizera A, Lobo S, Masur H, McGloughlin S, Mehta S, Mehta Y, Mer M, Nunnally M, Oczkowski S, Osborn T, Papathanassoglou E, Perner A, Puskarich M, Roberts J, Schweickert W, Seckel M, Sevransky J, Sprung CL, Welte T, Zimmerman J, Levy M. Surviving Sepsis Campaign: International Guidelines for Management of Sepsis and Septic Shock 2021. Crit Care Med. 2021 Nov 1;49(11):e1063-e1143. doi: 10.1097/CCM.0000000000005337. PMID: 34605781. http://purl.jp/bio/4/id/200906088274974886 Surviving Sepsis Campaign：International Guidelines for Management of Sepsis and Septic Shock 2021 Syndrome Syndrome syndrome A group of signs, symptoms, and clinicopathological characteristics that may or may not have a genetic basis and collectively define an abnormal condition. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C28193 Syndrome Systemic_Immune-inflammation_Index Systemic Immune-inflammation Index SII SII is an inflammation-related indicator that integrates neutrophil, platelet, and lymphocyte counts and can reflect the comprehensive immune and inflammation situation in the body.[url:https://pubmed.ncbi.nlm.nih.gov/31849367/] The SII was defined as follows: SII = P × N/L, where P, N, and L were the preoperative peripheral platelet, neutrophil, and lymphocyte counts, respectively. [url:https://pubmed.ncbi.nlm.nih.gov/25271081/] http://www.semanticweb.org/admin/ontologies/2022/7/MIO:02388 Systemic Immune-inflammation Index Systemic_Inflammatory_Response_Syndrome systemic inflammatory response syndrome Systemic Inflammatory Response Syndrome SIRS A generalized state of dysregulated inflammation induced by noninfectious processes. It is characterized by two or more of the following signs and symptoms: fever or hypothermia, increased heart rate, increased respiratory rate, and abnormal white blood cell count. Singer M, Deutschman CS, Seymour CW, Shankar-Hari M, Annane D, Bauer M, Bellomo R, Bernard GR, Chiche JD, Coopersmith CM, Hotchkiss RS, Levy MM, Marshall JC, Martin GS, Opal SM, Rubenfeld GD, van der Poll T, Vincent JL, Angus DC. The Third International Consensus Definitions for Sepsis and Septic Shock (Sepsis-3). JAMA. 2016 Feb 23;315(8):801-10. doi: 10.1001/jama.2016.0287. PMID: 26903338; PMCID: PMC4968574. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C94832 Systemic Inflammatory Response Syndrome Systolic_Blood_Pressure Systolic blood pressure Systolic Pressure systolic_bp systolic bp Systolic Blood Pressure SYSBP The maximum pressure exerted into the systemic arterial circulation during the contraction of the left ventricle of the heart. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C25298 Systolic Blood Pressure TIMP-1_to_MMP-9_Ratio TIMP-1 to MMP-9 Ratio TIMP-1/MMP-9 ratio TIMP-1/MMP-9 TIMP-1 to MMP-9 Ratio Tachycardia Tachycardia tachycardia An abnormally rapid heart rate. Thresholds for different age, gender, and patient populations exist. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C38029 Tachycardia Tenofovir (((1R)-2-(6-Amino-9H-purin-9-yl)-1-methylethoxy)methyl)phosphonic Acid, Monohydrate Tenofovir Hydrate Phosphonic Acid, ((2-(6-Amino-9H-purin-9-yl)-1-methylethoxy)methyl)-, Monohydrate, (R)- (R)-9-(Phosphonomethoxypropyl)adenine Hydrate (R)-9-(2-Phosphonomethoxypropyl)adenine Hydrate GS-1275 GS-1278 PMPA TENOFOVIR Tenofovir A nucleoside reverse transcriptase inhibitor analog of adenosine. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C29490 Tenofovir Tertiary_Protein_Structure Tertiary Protein Structure Tertiary structure describes the folding of the polypeptide chain to assemble the different secondary structure elements in a particular arrangement. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C14064 Tertiary Protein Structure Tetracycline_Antibiotic Tetracycline Antibiotic Tetracycline Antibiotics Tetracyclines Any of a group of broad spectrum naphthacene antibiotics isolated from various species of Streptomyces or produced semisynthetically. In bacteria, tetracycline antibiotics block binding of aminoacyl-tRNA to the mRNA-ribosome complex, thereby inhibiting protein synthesis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C1595 Tetracycline Antibiotic Therapeutic_Glucocorticoid Glucocorticoid Therapeutic Glucocorticoid Synthetically derived forms of the naturally occurring Glucocorticoids. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C521 Therapeutic Glucocorticoid Therapeutic_Procedure Therapeutic Procedure Therapeutic Therapeutic Technique any_therapy treatment or therapy Therapeutic Method Therapeutic Interventions treatment_or_therapy any therapy TREAT TX Therapy Treatment therapy treatment An action or administration of therapeutic agents to produce an effect that is intended to alter or stop a pathologic process. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C49236 Therapeutic Procedure Therapy treatment Used with diseases for therapeutic interventions except drug therapy, diet therapy, radiotherapy, and surgery, for which specific subheadings exist. The concept is also used for articles and books dealing with multiple therapies. http://purl.bioontology.org/ontology/MESH/Q000628 Therapy Thiazide_Diuretic Thiazide Diuretic Any benzothiadiazide derivative or other thiazide-like agent with diuretic and anti-hypertensive activity. Thiazide diuretics inhibit the sodium-chloride transporter in the distal tubule in the kidneys, thereby suppressing sodium and chloride reabsorption from the distal convoluted tubules (DCT) and increasing the excretion of sodium, chloride, potassium and water. In addition, thiazide diuretics decrease excretion of calcium and uric acid. These agents cause vasodilation possibly by activating calcium-activated potassium channels in vascular smooth muscle and inhibiting various carbonic anhydrases in vascular tissue. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C49185 Thiazide Diuretic Thiobarbituric_Acid_Reactive_Substances TBARs Low-molecular-weight end products, probably malondialdehyde, that are formed during the decomposition of lipid peroxidation products. These compounds react with thiobarbituric acid to form a fluorescent red adduct. http://purl.bioontology.org/ontology/MESH/D017392 Thiobarbituric Acid Reactive Substances Thrombin_Time Thrombin Clotting Time Thrombin Time TCT TT A measurement of the time it takes a plasma sample to clot after adding the active enzyme thrombin. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C80365 Thrombin Time Thrombophilia Hypercoagulability Excessive Blood Clotting Hypercoagulable Thrombophilia Hypercoagulability State A condition characterized by an abnormally high level of thrombi. Causes include thrombotic thrombocytopenic purpura, disseminated intravascular coagulation, bone marrow disorders, and antiphospholipid antibody syndrome. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C84479 Thrombophilia Thrombophilia_Related_to_COVID-19 Thrombophilia Thrombophilia Related to COVID-19 Thrombophilia in a patient with probable or confirmed acute COVID-19. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C191638 Thrombophilia Related to COVID-19 Thrombospondin Thrombospondin THBS TSP A glycoprotein that is incorporated into cells, including blood platelets (thrombocytes) from which they are named. Five distinct forms have been identified, and they play roles in a variety of processes such as: blood coagulation, cell adhesion, platelet aggregation, cell proliferation, angiogenesis, tumor metastasis, and tissue repair. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C17339 Thrombospondin Thrombotic_Disorder Thrombotic Disorder A disorder in which there is pathological development of blood clots within the cardiovascular system. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C180553 Thrombotic Disorder Thrombotic_Microangiopathy Thrombotic Microangiopathy Thrombotic microangiopathy TMA A microvascular coagulopathy that may result from systemic vascular endothelial injury triggering the development of a procoagulant state, activation of the complement cascade, and microthrombi formation. Signs may include hemolytic anemia, thrombocytopenia, hypertension and renal dysfunction. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C62605 Thrombotic Microangiopathy Thymic_Epithelial_Tissue Thymic Epithelial Tissue http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C45713 Thymic Epithelial Tissue Thyroid_Hormone Thyroid Hormone thyroid hormone Thyroid Gland Hormone Any of several closely related compounds that are produced by the thyroid gland and are active metabolically. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C886 Thyroid Hormone Tissue_Inhibitor_of_Metalloproteinases Tissue Inhibitor of Metalloproteinases TIMP Tissue inhibitors of metalloproteinase. A family of proteins of around 200 residues that can inhibit enzymes of the metalloprotease type, for example collagenase, by binding to them. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C17544 Tissue Inhibitor of Metalloproteinases Total_Bilirubin_Measurement Total Bilirubin Measurement Total Bilirubin Level Total Bilirubin BILI Bilirubin The measurement of the total amount of bilirubin present in a particular substrate. The substrate most often tested is blood, but other fluids extracted from the body may be used periodically depending on the purpose of the test. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C38037 Total Bilirubin Measurement Trace_Metal_Storage_Protein Trace Metal Storage Protein A protein that binds to and stores essential metals in the body both to make them available for biological processes and to prevent the toxic effects of free metals in an organism. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20315 Trace Metal Storage Protein Tracheotomy Tracheostomy Procedure TRACHEOSTOMY Tracheostomy Tracheotomy tracheostomy Creation of a surgical opening into the trachea. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C15341 Tracheotomy Transcription_Regulation_Gene Transcription Regulation Gene A gene that plays a role in the control of gene expression at the level of RNA transcription. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C54362 Transcription Regulation Gene Transcription_Regulatory_Protein Transcriptional Regulators Transcription Regulatory Protein Transcription Regulation Protein Transcriptional Regulatory Protein A protein that is involved in the regulation of transcription. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C26199 Transcription Regulatory Protein Transferase Transferase EC 2 Transferases are enzymes transferring a group, for example, the methyl group or a glycosyl group, from one compound (generally regarded as donor) to another compound (generally regarded as acceptor). The classification is based on the scheme "donor: acceptor group transferase". http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C17210 Transferase Transferase_Gene Transferase Gene Transferase Genes encode enzymes (Transferases) that transfer a group, such as a methyl group or a glycosyl group, from one compound (donor) to another (acceptor). http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C25870 Transferase Gene Transforming_Growth_Factor-Beta_Family_Gene Transforming Growth Factor-Beta Family Gene Expressed in a variety of tissues, Transforming Growth Factor-Beta Family Genes encode Transforming Growth Factor-Beta, an autocrine growth factor that can act synergistically with TGF-alpha in embryonic development, cellular differentiation, hormone secretion, and immune function. There are at least three forms of TGF-beta: TGF-beta 1, TGF-beta 2, and TGF-beta 1.2. The latter is a heterodimer of TGF-beta 1 and TGF-beta 2. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C21345 Transforming Growth Factor-Beta Family Gene Transforming_Growth_Factor-Beta_Superfamily Transforming Growth Factor-Beta Superfamily Tumor Growth Factor B Transforming Growth Factor-Beta Transforming Growth Factor Beta Bone-Derived Transforming Growth Factor Tumor Growth Factor Beta Milk Growth Factor TGF B TGF Beta TGF-B TGF-Beta A family of structurally-related cytokines that bind to their cognate serine/threonine kinase receptors as homodimers or heterodimers linked by a single disulfide bond. These proteins play a role in embryonic development, hematopoiesis, tissue repair and extracellular matrix remodeling. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20455 Transforming Growth Factor-Beta Superfamily Transmembrane_Activator_and_CAML_Interactor_Protein Transmembrane Activator and CAML Interactor Protein TACI Antigen, CD267 CD267 Antigen TACI Receptor CD267 Antigens Antigens, CD267 Tumor Necrosis Factor Receptor Superfamily, Member 13b A tumor necrosis factor receptor superfamily member found expressed on peripheral B-LYMPHOCYTES. It has specificity for B-CELL MATURATION ANTIGEN and TUMOR NECROSIS FACTOR LIGAND SUPERFAMILY MEMBER 13. http://purl.bioontology.org/ontology/MESH/D053303 Transmembrane Activator and CAML Interactor Protein Transport_Protein Transport Protein Transporter Protein Carrier Protein A protein that is involved in the directed movement of substances into, out of, within or between cells. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16386 Transport Protein Transport_Protein_Gene Transport Protein Gene Transport Protein Genes encode a diverse group of proteins that function as carriers of ligands through solubility barriers such as aqueous body fluids or in active transport across cell membranes. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C28533 Transport Protein Gene Trauma Nurses in this specialty provide emergency care to patients of all ages. These nurses work to maintain vital signs and prevent complications and death http://purl.bioontology.org/ontology/LNC/LA17058-1 Trauma Traumatic_Shock Traumatic Shock Any shock produced by trauma. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C50782 Traumatic Shock Treatment_Regimen regimen_or_line_of_therapy Treatment Regimen Treatment Schedule Treatment Protocol regimen or line of therapy Regimen regimen A treatment plan that specifies the dosage, the schedule, and the duration of treatment. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C15697 Treatment Regimen Triglyceride_Measurement Triglycerides Triglyceride Measurement TRIG A quantitative measurement of the amount of triglyceride present in a sample. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C64812 Triglyceride Measurement Troponin_I TNNI TnI Troponin I Troponin I, troponin T, and troponin C are the three closely associated subunits of the troponin complex of thin filaments in muscle. The complex serves as a calcium-sensitive switch that regulates muscle contraction. In the absence of calcium, Troponin I binds actin, inhibits actomyosin ATPase activity, and inhibits F-actin-myosin interactions. The troponin I gene family comprises three isoforms: skeletal TNI-fast, skeletal TNI-slow, and TNI-cardiac. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C17343 Troponin I Tumor_Necrosis_Factor_Family_Gene TNF Family Gene Tumor Necrosis Factor Superfamily Gene Tumor Necrosis Factor Family Gene TNFSF Gene Tumor Necrosis Factor Family Genes encode Tumor Necrosis Factor Family Protein, structurally related cell surface proteins involved in lymphocyte homeostasis by induction of apoptosis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C21114 Tumor Necrosis Factor Family Gene Tumor_Necrosis_Factor_Family_Protein Tumor Necrosis Factors Tumor Necrosis Factor Superfamily Protein TNFSF Protein Tumor Necrosis Factor Family Protein Family of cell surface proteins structurally related to tumor necrosis factor. They are involved in lymphocyte homeostasis by their ability to induce apoptosis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20500 Tumor Necrosis Factor Family Protein Type_A_Personality Personality, Type A Established behavior pattern characterized by excessive drive and ambition, impatience, competitiveness, sense of time urgency, and poorly contained aggression. http://purl.bioontology.org/ontology/MESH/D014434 Type A Personality Type_B_Personality B Personalities, Type Behavior pattern characterized by a generally calm and even-tempered demeanor. Emotionally, such personality types show less frequent irritation, anger, hostility, and aggression than Type A individuals. http://purl.bioontology.org/ontology/MESH/D064414 Type B Personality Type_D_Personality Personality Type Ds Behavior pattern characterized by negative emotionality, an inability to express emotions, and social isolation, which has been linked to greater cardiovascular disease and increased mortality. http://purl.bioontology.org/ontology/MESH/D064415 Type D Personality Underlying_Infection Underlying Disease Underlying Condition Underlying Disease Unemployed UE - Unemployed U/E - Unemployed http://purl.bioontology.org/ontology/SNOMEDCT/73438004 Unemployed Uninsured_Medical_Expenses Uninsured medical expenses (finding) http://purl.bioontology.org/ontology/SNOMEDCT/424553001 Medical Costs Uric_Acid 1H-Purine-2,6,8-triol 7,9-Dihydro-1H-purine-2,6,8(3H)-trione 2,6,8-Trihydroxypurine 2,6,8-Trioxypurine 2,6,8-Trioxopurine URIC ACID Urate Uric Acid uric acid A white tasteless odorless crystalline product of protein metabolism, found in the blood and urine, as well as trace amounts found in the various organs of the body. It can build up and form stones or crystals in various disease states. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C62652 Uric Acid Urinary_Bilirubin_Oxidative_Metabolites Urinary Bilirubin Oxidative Metabolites Urinary BOM Urinary Bilirubin Oxidative Metabolites Urinary_Calculi-associated_Septic_Shock_Score Urinary Calculi-associated Septic Shock Score UCSS Score Urinary Calculi-associated Septic Shock Score Urinary_System Body System, Renal/Urologic URINARY SYSTEM Organ System, Renal/Urologic Renal/Urologic Organ System Urinary system, NOS Urologic/Renal Body System Renal/Urologic Body System urinary tract Urinary System urinary system The organs involved in the creation and excretion of urine. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C12413 Urinary System Urine_Chemistry_Measurement Urine Chemistry Measurement A quantitative measurement of a particular substance present in a sample of urine. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61044 Urine Chemistry Measurement Urokinase Urokinase http://purl.obolibrary.org/obo/DRON_00013611 Urokinase Vaccination Active Immunization Immunization, Active Immunizations, Active Active Immunizations Vaccinations Administration of vaccines to stimulate the host's immune response. This includes any preparation intended for active immunological prophylaxis. http://purl.bioontology.org/ontology/MESH/D014611 Vaccination Valacyclovir valacyclovir L-Valine ester with 9-((2-hydroxyethoxy)methyl)guanine Valaciclovir Valacyclovir VALACYCLOVIR ValACV Zelitrex The hydrochloride salt of the L-valyl ester of the antiviral drug acyclovir. Orally administered, valacyclovir is rapidly converted to acyclovir which inhibits viral DNA replication after further conversion to the nucleotide analog acyclovir triphosphate by viral thymidine kinase, cellular guanyl cyclase, and a number of other cellular enzymes. Acyclovir triphosphate competitively inhibits viral DNA polymerase; incorporates into and terminates the growing viral DNA chain; and inactivates viral DNA polymerase. The greater antiviral activity of acyclovir against herpes simplex virus (HSV) compared with varicella-zoster virus (VZV) is due to its more efficient phosphorylation by HSV thymidine kinase. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C28235 Valacyclovir Vasodilating_Agent Vasodilator Vasodilating Agent Any agent that causes widening of blood vessels as a result of smooth muscle relaxation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C29707 Vasodilating Agent Vasopressor Antihypotensive Agent Anti-hypotensive Agent Vasopressor IV vasopressors Any substance used in the treatment of hypotension. A vasopressor agent increases reduced blood pressure. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C126567 Vasopressor Venous-arterial_Carbon_Dioxide_Saturation_Difference_to_Arterial-venous_Oxygen_Saturation_Difference_Ratio Venous-arterial Carbon Dioxide Saturation Difference to Arterial-venous Oxygen Saturation Difference Ratio Cv-aCO2/Da-vO2 ratio Venous-arterial Carbon Dioxide Saturation Difference to Arterial-venous Oxygen Saturation Difference Ratio Ventilation_or_Perfusion_Signs_and_Symptoms Ventilation or Perfusion Signs and Symptoms http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C5043 Ventilation or Perfusion Signs and Symptoms Very_Low_Density_Lipoprotein_Cholesterol_Measurement VLDL Cholesterol VLDL Cholesterol Measurement Very Low Density Lipoprotein Cholesterol Measurement VLDL The determination of the amount of very low-density lipoprotein cholesterol present in a sample. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C105589 Very Low Density Lipoprotein Cholesterol Measurement Vital_Signs_Measurement Vital Signs Test Vital Signs Vital Signs Measurement VITALS_TEST Vital Sign Measurement VS VSTEST The act of assessing an individual's current temperature, heart rate, respiratory rate, pulse oxygenation, and blood pressure. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C49672 Vital Signs Measurement Vital_Statistics Vital Stastistics Government records of live births, fetal deaths, marriges, divorces, and deaths that occur within that jurisdction. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C17258 Vital Statistics Vitamin_K_Antagonist Vitamin K Antagonist VKA Any agent that inhibits the function of vitamin K, with anticoagulant activity. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C173064 Vitamin K Antagonist Vomiting Emesis Vomiting emesis vomit Forceful ejection of the contents of the stomach through the mouth. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C3442 Vomiting Water-Electrolyte_Balance Balance, Water-Electrolyte Balance, Fluid The balance of fluid in the BODY FLUID COMPARTMENTS; total BODY WATER; BLOOD VOLUME; EXTRACELLULAR SPACE; INTRACELLULAR SPACE, maintained by processes in the body that regulate the intake and excretion of WATER and ELECTROLYTES, particularly SODIUM and POTASSIUM. http://purl.bioontology.org/ontology/MESH/D014882 Water-Electrolyte Balance Well_Resusitated_Phenotype Well Resusitated Phenotype Wheal Hive Welt Wheal Wheal(s) A smooth, slightly elevated area on the body surface, which is redder or paler than the surrounding skin. It is the typical lesion of urticaria, the dermal evidence of allergy, and in sensitive persons may be provoked by mechanical irritation of the skin. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C50811 Wheal White Caucasian Caucasians Caucasoid Occidental WHITE White Whites white A person having origins in any of the original peoples of Europe, the Middle East, or North Africa. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C41261 White X-Ray_Imaging Static X-Ray X-Ray Imaging Radiographic imaging procedure (procedure) Conventional X-Ray Medical Imaging, X-Ray Diagnostic Radiology Radiographic Imaging Radiography Plain film radiographs RG X-RAY X-Ray A radiographic procedure using the emission of x-rays to form an image of the structure penetrated by the radiation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C38101 X-Ray Imaging Xanthine xanthine 2,6-dioxopurine 2,6-dioxopurines xanthines A purine nucleobase found in humans and other organisms. http://purl.obolibrary.org/obo/CHEBI_15318 Xanthine Zanamivir 4-Guanidino-2,4-dideoxy-2,3-dehydro-N-acetylneuraminic Acid 5-Acetamido-2,6-anhydro-3,4,5-trideoxy-4-guanidino-D-glycero-D-galacto-non-2-enonic Acid GANA GG 167 Relenza ZANAMIVIR Zanamivir zanamivir A sialic acid-analogue neuraminidase inhibitor with antiviral activity. Administered into the respiratory tract by aerosol inhalation, zanamivir selectively binds to and inhibits influenza A and B virus neuraminidase-mediated cleavage of sialic acid residues in host cell membrane-bound glycoprotein receptors for influenza viruses, preventing the release of progeny viruses from host cell surfaces and, so, further viral replication. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C47786 Zanamivir Zidovudine 3'-Azido-3'-deoxythymidine 1-(3-Azido-2,3-dideoxy-beta-D-ribofuranosyl)-5-methylpyrimidine-2,4-(1H,3H)-dione Azidothymidine AZT Aztec BW A509U BW-A 509U BW-A509U Compound S DRG-0004 Retrovir ZDV ZIDOVUDINE Zidovudine zidovudine A synthetic dideoxynucleoside. After intracellular phosphorylation to its active metabolite, zidovudine inhibits DNA polymerase, resulting in the inhibition of DNA replication and cell death. This agent also decreases levels of available pyrimidines. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C947 Zidovudine cfDNA_or_ctDNA_Measurement cfDNA/ctdDNA Measurement cfDNA or ctDNA Measurement Circulating Cell-Free DNA/Circulating Tumor-Derived DNA Measurement Cell-Free DNA/Circulating Tumor DNA Measurement cfDNA/ctDNA Measurement cfDNA/ctDNA The determination of the amount of circulating cell free or tumor DNA present in a blood, plasma or serum sample. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C177304 cfDNA or ctDNA Measurement emotional_lability Mood swings Emotional instability Mood changes Mood lability Mood alterations Unstable emotional experiences and frequent mood changes; emotions that are easily aroused, intense, and/or disproportionate to events and circumstances. http://purl.obolibrary.org/obo/HP_0000712 Emotional Lability lncRNA long non-coding RNA INSDC_qualifier:lncRNA lncRNA_transcript INSDC_feature:ncRNA Updated the definition of lncRNA (SO:0001877) from "A non-coding RNA over 200nucleotides in length." to "A non-coding RNA generally longer than 200 nucleotides that cannot be classified as any other ncRNA subtype. Similar to mRNAs, lncRNAs are mainly transcribed by RNA polymerase II, are often capped by 7-methyl guanosine at their 5' ends, polyadenylated at their 3' ends and may be spliced." See GitHub Issue #575 A non-coding RNA generally longer than 200 nucleotides that cannot be classified as any other ncRNA subtype. Similar to mRNAs, lncRNAs are mainly transcribed by RNA polymerase II, are often capped by 7-methyl guanosine at their 5' ends, polyadenylated at their 3' ends and may be spliced. http://purl.obolibrary.org/obo/SO_0001877 LncRNA ncRNA known_ncrna noncoding RNA INSDC_qualifier:other A ncRNA is a processed_transcript, so it may not contain parts such as transcribed_spacer_regions that are removed in the act of processing. For the corresponding primary_transcripts, please see term SO:0000483 nc_primary_transcript. An RNA transcript that does not encode for a protein rather the RNA molecule is the gene product. http://purl.obolibrary.org/obo/SO_0000655 ncRNA qSOFA_plus_IL-8 qSOFA plus IL-8 qSOFA plus IL-8 qSOFA_plus_PCT qSOFA plus PCT qSOFA plus PCT α_phenotype α phenotype α phenotype β_phenotype β phenotype β phenotype γ_phenotype γ phenotype γ phenotype δ_phenotype δ phenotype δ phenotype (-)-Methyl jasmonate methyl {(1R,2R)-3-oxo-2-[(2Z)-pent-2-en-1-yl]cyclopentyl}acetate 3-oxo-2-(2-pentenyl)cyclopentaneacetic acid methyl ester methyl (-)-jasmonate Methyl jasmonate A jasmonate ester that is the methyl ester of jasmonic acid. http://purl.obolibrary.org/obo/CHEBI_15929 Methyl Jasmonate 1107116 Li Y, Wang C, Chen M. Metabolomics-based study of potential biomarkers of sepsis. Sci Rep. 2023 Jan 11;13(1):585. doi: 10.1038/s41598-022-24878-z. PMID: 36631483; PMCID: PMC9834301. 1107116 20S Proteosome 20S Core Proteasome 20S Catalytic Proteasome 20S Proteasome The 20S proteasome, as proteolytic core of the proteasome system, is essential in ATP dependent ubiquitin protein complex degradation and in antigen processing in antigen presenting cell. It has 13-15 subunits each of which has three or four different peptidase activities. 26S proteasomes may be formed in an ATP dependent fashion from a 20S proteasome and additional components, CF1 (660 kD), CF2 (250 kD) and CF3 (600 kD). The 20S proteasome interacts with additional subunits, PA700 and PA28, to form an ATP-dependent multicatalytic proteinase complex (MPC) involved in the ATP ubiquitin degradation pathway. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C13737 20S Proteasome 8-OHdG Measurement 8-Hydroxydeoxyguanosine 8-Hydroxydeoxyguanosine Measurement 8-OHdG OHDG8 The determination of the amount of 8-hydroxydeoxyguanosine in a sample. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C172492 8-Hydroxydeoxyguanosine Blood Urea Nitrogen/Creatinine Ratio plus SOFA Score BCR plus SOFA Blood Urea Nitrogen/Creatinine Ratio plus SOFA Score CD3+CD4+CD69+/CD3+CD8+CD69+ T-Cell Ratio CD3+CD4+CD69+/CD3+CD8+CD69+ T-Cell Ratio CD3+CD8+HLA-DR+ T Cell CD3+CD8+HLA-DR+ T Cell CD39+ Regulatory T Cells CD39+ Regulatory T Cells CD4/CD8 T-Cell Ratio CD4/CD8 http://purl.bioontology.org/ontology/OMIM/601083 CD4/CD8 T-Cell Ratio Chemical or Occupational Exposure History Chemical/Occupational Exposure History History of Chemical/Occupational Exposures A record of the individual's history of exposure to chemicals and/or occupational hazard. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C157151 Chemical/Occupational Exposure History Extroversion, Psychology A state in which attention is largely directed outward from the self. http://purl.bioontology.org/ontology/MESH/D005120 Extraversion, Psychological Transfer, Passive Antibody Serotherapy Immunotherapy, Passive Normal Serum Globulin Therapy Passive Transfer of Immunity Antibody Transfer, Passive Therapy, Immunoglobulin Convalescent Plasma Therapy Passive Immunization Therapy, Convalescent Plasma Passive Immunotherapy Passive Antibody Transfer Immunoglobulin Therapy Transfer of immunity from immunized to non-immune host by administration of serum antibodies, or transplantation of lymphocytes (ADOPTIVE TRANSFER). http://purl.bioontology.org/ontology/MESH/D007116 Immunization, Passive Control, Dental Infection Efforts to prevent and control the spread of infections within dental health facilities or those involving provision of dental care. http://purl.bioontology.org/ontology/MESH/D019552 Infection Control, Dental Psychological Introversion A state in which attention is largely directed inward upon one's self. http://purl.bioontology.org/ontology/MESH/D007439 Introversion, Psychological Cells, NK Killer Cell, Natural Cells, Natural Killer NK Cells NK Cell Cell, NK Natural Killer Cells Natural Killer Cell Cell, Natural Killer Bone marrow-derived lymphocytes that possess cytotoxic properties, classically directed against transformed and virus-infected cells. Unlike T CELLS; and B CELLS; NK CELLS are not antigen specific. The cytotoxicity of natural killer cells is determined by the collective signaling of an array of inhibitory and stimulatory CELL SURFACE RECEPTORS. A subset of T-LYMPHOCYTES referred to as NATURAL KILLER T CELLS shares some of the properties of this cell type. http://purl.bioontology.org/ontology/MESH/D007694 Killer Cells, Natural N(2)-(phenylacetyl)glutamine Phenylacetylglutamine http://purl.obolibrary.org/obo/CHEBI_8087 N(2)-phenylacetylglutamine Early-Onset Neonatal Sepsis Neonatal Sepsis, Early-Onset An infectious disorder of newborn infants that is characterized by a systemic inflammatory response within 72 hours of life and is most commonly caused by bacteria. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C116803 Neonatal Sepsis, Early-Onset Neonatal Sepsis, Hybrid Hybrid Neonatal Sepsis An infectious disorder of newborn infants that is characterized by a systemic inflammatory response within and beyond 72 hours of life and is most commonly caused by bacteria. Neonatal Sepsis, Hybrid Neonatal Sepsis, Late-Onset Late-Onset Neonatal Sepsis An infectious disorder of newborn infants that is characterized by a systemic inflammatory response beyond 72 hours of life and is most commonly caused by bacteria. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C116805 Neonatal Sepsis, Late-Onset Serine/Threonine-Protein Kinase Serine/Threonine Protein Kinase Serine-Threonine Protein Kinase EC 2.7.11 STK A class of enzymes that transfer phosphate groups to serine or threonine residues in peptides or proteins. These proteins are involved in the progression of signal transduction pathways. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C17325 Serine/Threonine Protein Kinase Serine/Threonine Kinase Gene Serine/Threonine Protein Kinase Gene Serine/Threonine-Protein Kinase Gene STK Serine/Threonine Protein Kinase Genes encode enzymes (Serine/Threonine Protein Kinases) that catalyze phosphorylation of serine or threonine residues in proteins, with ATP or other nucleotides as phosphate donors. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C25873 Serine/Threonine Protein Kinase Gene Type 1 T Helper Cell/Type 2 T Helper Cell Ratio Measurement Th1/Th2 Ratio Measurement Th1 Cell/Th2 Cell Ratio Measurement Th1/Th2 The determination of the ratio of type 1 T helper cells (Th1) compared to type 2 T helper cells (Th2) present in a sample. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C129775 Th1 Cell/Th2 Cell Ratio Measurement mTOR+CD4+ T-cell Count mTOR+CD4+ T-cell Count OPMI:0000436 PATO:0000308 SNOMED:49808004 An age which is relatively high. [ PATOC:GVG ] [url:http://purl.obolibrary.org/obo/PATO_0000308] old age advanced age elderly old old age old-age older older age age under 70 years age 69 years or younger age </=69 years age <70 years age below 70 years age ≤69 years aged </=69 years aged <70 years aged under 70 years under 70 years of age under 70 years old PATO:0000309 An age which is relatively low. [ PATOC:GVG ] [url:http://purl.obolibrary.org/obo/PATO_0000309] young EFO:0004704 NCIT:C106497 The age at which permanent cessation of menses occurs. [url:http://purl.obolibrary.org/obo/NCIT_C106497] age at menopause MENOAGE menopause age age 55 years or older above 54 years of age age >/=55 years age >54 years age above 54 years age of more than 54 age over 54 years age ≥55 years aged >54 years aged over 54 aged over 54 years at least 55 years of age at least 55 years old over 54 years of age over 54 years old age under 65 years age 64 years or younger age </=64 years age <65 years age below 65 years age ≤64 years aged <65 years aged under 65 years under 65 years of age under 65 years old age above 40 years above 40 years of age age 41 years or older age >/=41 years age >40 years age of more than 40 age over 40 years age ≥41 years aged >40 years aged over 40 aged over 40 years at least 41 years of age at least 41 years old over 40 years of age over 40 years old age 60 years or older age >/=60 years age >59 years age above 59 years age over 59 years age ≥60 years aged >59 years aged over 59 years at least 60 years of age at least 60 years old over 59 years of age over 59 years old age under 60 years age 59 years or younger age </=59 years age <60 years age below 60 years age ≤59 years aged <60 years aged under 60 years under 60 years of age under 60 years old age above 45 years above 45 years of age age 46 years or older age >/=46 years age >45 years age of more than 45 age over 45 years age ≥46 years aged >45 years aged over 45 aged over 45 years at least 46 years of age at least 46 years old over 45 years of age over 45 years old age above 60 years above 60 years of age age >/=61 years age >60 years age of more than 60 age over 60 years aged >60 years aged over 60 aged over 60 years at least 61 years of age at least 61 years old over 60 years of age age between 60 and 75 years 60-75 years old age 60-75 age 58 years or younger age </=58 years age <59 years age under 59 years age ≤58 years aged </=58 years aged <59 years aged under 59 years under 59 years of age under 59 years old age above 50 years above 50 years of age age 51 years or older age >/=51 years age >50 years age of more than 50 age over 50 years age ≥51 years aged >50 years aged over 50 aged over 50 years at least 51 years of age at least 51 years old over 50 years of age over 50 years old age 65 years or older age >/=65 years age >64 years age above 64 years age over 64 years age ≥65 years aged >64 years aged over 64 years at least 65 years of age at least 65 years old over 64 years of age over 64 years old age between 60 and 69 years 60-69 years old age 60-69 age under 55 years age 54 years or younger age </=54 years age <55 years age below 55 years age ≤54 years aged </=54 years aged <55 years aged under 55 years under 55 years of age under 55 years old age above 65 years above 65 years of age age >/=66 years age >65 years age of more than 65 age ≥66 years aged >65 years aged over 65 aged over 65 years at least 66 years of age at least 66 years old over 65 years of age over 65 years old age between 65 and 74 years 65-74 years old age 65-74 age 50 years or younger age </=50 years age ≤50 years age 70 years or older age >/=70 years age >69 years age above 69 years age over 69 years age ≥70 years aged >69 years aged over 69 years at least 70 years of age at least 70 years old over 69 years of age age between 66 and 75 years 66-75 years old age 66-75 age under 50 years age 49 years or younger age </=49 years age <50 years age below 50 years age ≤49 years aged <50 years aged under 50 years under 50 years of age under 50 years old age above 70 years above 70 years of age age >70 years age of more than 70 aged >70 years aged over 70 aged over 70 years over 70 years of age over 70 years old age between 70 and 79 years 70-79 years old age 70-79 age 45 years or younger age </= 45 years age ≤45 years age 74 years or older age >/=74 years age ≥74 years at least 74 years of age at least 74 years old age under 45 years age 44 years or younger age </=44 years age <45 years age below 45 years age ≤44 years aged <45 years aged under 45 years under 45 years of age under 45 years old age 75 years or older age >/=75 years age ≥75 years at least 75 years of age at least 75 years years age between 75 and 84 years 75-84 years old age 75-84 age between 30 and 34 years 30-34 years old age 30-34 age between 35 and 39 years 35-39 years old age 35-39 age above 75 years above 75 years old age >75 years age of more than 75 aged >75 years aged over 75 aged over 75 years over 75 years of age over 75 years old age 80 years or older above 79 years of age age >/=80 years age >79 years age above 79 years age of more than 79 age over 79 years age ≥80 years aged >79 years aged over 79 aged over 79 years at least 80 years of age at least 80 years old over 79 years of age over 79 years old age above 80 years above 80 years of age above 80 years old age >80 years age of more than 80 aged >80 years aged over 80 aged over 80 years over 80 years of age over 80 years old age 85 years or older age >/=85 years age >84 years age over 84 years age ≥85 years aged >84 years aged over 84 years at least 85 years of age at least 85 years old over 84 years of age over 84 years old V1.0.0 Chi Zhang, West China Hospital, Sichuan University, China Bairong Shen, West China Hospital, Sichuan University, China English Sepsis Ontology (SO) The Sepsis Ontology (SEPON) is a disease-specific ontology that defines the concepts and relationships between concepts in the field of sepsis and related diseases, contributing to data standardization and providing precise and personalized diagnosis, treatment and prognosis recommandations for sepsis. V1.0.0 A2M_Gene Alpha-2-Macroglobulin Gene A2M A2M Gene This gene has activity as a protease inhibitor. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C105922 A2M Gene ACLY_Gene ATP Citrate Lyase Gene ACLY ACLY Gene This gene is involved in acetyl-CoA metabolism. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C107107 ACLY Gene ADM Preproadrenomedullin ADM Precursor Adrenomedullin ADM PreproAM ProAM ADM (185 aa, ~20 kDa) is encoded by the human ADM gene. This protein plays a role in both signal transduction and vasodilation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C113266 Adrenomedullin ADM_Gene Adrenomedullin Gene ADM ADM Gene This gene plays a role in both hormone signaling and vasodilation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C113264 ADM Gene ANGPT1_Gene Angiopoietin 1 Gene ANGPT1 Gene ANGPT1 This gene plays a role in blood vessel maturation and stability. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C21311 ANGPT1 Gene ANGPT2_Gene Angiopoietin 2 Gene ANGPT2 Gene ANGPT2 This gene is involved in vascular remodeling. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C21312 ANGPT2 Gene ANXA5_Gene Annexin A5 Gene ANXA5 ANXA5 Gene This gene is involved in anticoagulation processes and mediates lipid binding. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C24245 ANXA5 Gene APLN_Gene Apelin Gene APLN APLN Gene This gene is involved in the regulation of both immune responses and HIV-1 infection. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C104096 APLN Gene APOA1_Gene Apolipoprotein A1 Gene APOA1 APOA1 Gene This gene is involved in cholesterol transport and metabolism. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C116417 APOA1 Gene APOA5_Gene Apolipoprotein A5 Gene APOA5 APOA5 Gene This gene is involved in the modulation of plasma triglyceride metabolism. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C190086 APOA5 Gene APOB_Gene Apolipoprotein B Gene APOB APOB Gene This gene plays a role in lipid transport. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C106030 APOB Gene APOM_Gene Apolipoprotein M Gene APOM APOM Gene This gene is involved in fatty acid transport. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C178703 APOM Gene ATP-Citrate_Synthase ATP-Citrate Synthase ATP Citrate Lyase Citrate Cleavage Enzyme ATP-Citrate (Pro-S-)-Lyase ACLY EC 2.3.3.8 ATP-citrate synthase (1101 aa, ~121 kDa) is encoded by the human ACLY gene. This protein is involved in both the synthesis of cytosolic acetyl-CoA and the de novo lipid synthesis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C107109 ATP-Citrate Synthase AVP_Gene Arginine Vasopressin Gene AVP AVP Gene This gene is involved in growth factor regulation and vasoconstriction. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C24248 AVP Gene AZU1_Gene Azurocidin 1 (Cationic Antimicrobial Protein 37) Gene AZU1 AZU1 Gene This gene plays a role in neutrophil differentiation and is involved in inflammatory processes. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C28531 AZU1 Gene Acetaminophen ACETAMINOPHEN N-(4-Hydroxyphenyl)acetamide Acetaminophen acetaminophen Paracetamol 4-Hydroxyacetanilide APAP Tylenol A p-aminophenol derivative with analgesic and antipyretic activities. Although the exact mechanism through which acetaminophen exert its effects has yet to be fully determined, acetaminophen may inhibit the nitric oxide (NO) pathway mediated by a variety of neurotransmitter receptors including N-methyl-D-aspartate (NMDA) and substance P, resulting in elevation of the pain threshold. The antipyretic activity may result from inhibition of prostaglandin synthesis and release in the central nervous system (CNS) and prostaglandin-mediated effects on the heat-regulating center in the anterior hypothalamus. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C198 Acetaminophen Albendazole Carbamic Acid,(5-(Propylthio)-1H-benzimidazol-2-yl)-, Methyl Ester Albendazole ALBENDAZOLE Albenza Bilutac Proftril SKF 62979 Zentel A broad-spectrum, synthetic benzimidazole-derivative anthelmintic. Albendazole interferes with the reproduction and survival of helminths by inhibiting the formation of microtubules from tubulin. This leads to an impaired uptake of glucose, a depletion of glycogen stores, and results in the worm's death. Albendazole is used in the treatment of dog and pork tapeworm-causing diseases, including hydatid disease and neurocysticercosis. Albendazole may also be used to treat a variety of other roundworm infections. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C47384 Albendazole Alpha-1-Acid_Glycoprotein_1 Alpha-1 Acid Glycoprotein Alpha-1-Acid Glycoprotein Orosomucoid-1 Alpha-1-Acid Glycoprotein 1 Orosomucoid 1 Epididymis Secretory Sperm Binding Protein Li 153w AGP 1 OMD 1 ORM1 Alpha-1-acid glycoprotein 1 (201 aa, ~24 kDa) is encoded by the human ORM1 gene. This protein may play a role in immunosuppression and small molecule transport. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C126967 Alpha-1-Acid Glycoprotein 1 Alpha-1-Antitrypsin Serpin Peptidase Inhibitor Clade A Member 1 Serine (or Cysteine) Proteinase Inhibitor, Clade A, Member 1 Alpha-1-Antitrypsin Anti-Elastase Serpin Family A Member 1 Alpha-1 Antitrypsin Alpha-1 Protease Inhibitor Protease Inhibitor 1 Alpha-1-Antiproteinase Alpha1AT SERPINA1 Serpin A1 Alpha-1-antitrypsin (418 aa, ~47 kDa) is encoded by the human SERPINA1 gene. This protein plays a role in regulation of proteolysis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C105012 Alpha-1-Antitrypsin Alpha-2-Macroglobulin Alpha-2-Macroglobulin C3 and PZP-Like Alpha-2-Macroglobulin Domain-Containing Protein 5 A2M Alpha-2-M Alpha-2-macroglobulin (1474 aa, ~163 kDa) is encoded by the human A2M gene. This protein has activity as a protease inhibitor. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C105924 Alpha-2-Macroglobulin Amikacin AMIKACIN Amikacin amikacin A broad-spectrum semi-synthetic aminoglycoside antibiotic, derived from kanamycin with antimicrobial property. Amikacin irreversibly binds to the bacterial 30S ribosomal subunit, specifically locking 16S rRNA and S12 protein within the 30S subunit. This leads to interference with translational initiation complex and misreading of mRNA, thereby hampering protein synthesis and resulting in bactericidal effect. This agent is usually used in short-term treatment of serious infections due to susceptible strains of Gram-negative bacteria. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61615 Amikacin Amiloride AMILORIDE Amiloride A synthetic pyrazine derivative with antikaliuretic and diuretic properties. Amiloride inhibits sodium channels located in the distal tubules and collecting ducts of the kidney, thereby preventing the absorption of sodium and increasing its excretion along with water, to produce naturesis. In response to the hypernatremic conditions in the kidney, the plasma membrane becomes hyperpolarized and electrochemical forces are reduced, which then prevents the excretion of potassium and hydrogen into the lumen. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61633 Amiloride Amorolfine AMOROLFINE Amorolfin Amorolfine Curanail Loceryl Locetar Odenil A morpholine antifungal agent for topical use. Amorolfine inhibits delta-14-reductase and delta-7,8-isomerase, which depletes ergosterol and causes ignosterol to accumulate in the fungal cytoplasmic cell membrane. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C81332 Amorolfine Amoxicillin amoxicillin Amoxicillin Trihydrate Amoxicillin AMOXICILLIN AMOX Amoxil Polymox Trimox Utimox Wymox A broad-spectrum, semisynthetic aminopenicillin antibiotic with bactericidal activity. Amoxicillin binds to and inactivates penicillin-binding protein (PBP) 1A located on the inner membrane of the bacterial cell wall. Inactivation of PBPs interferes with the cross-linkage of peptidoglycan chains necessary for bacterial cell wall strength and rigidity. This interrupts bacterial cell wall synthesis and results in the weakening of the bacterial cell wall and causes cell lysis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C237 Amoxicillin Amphotericin_B Amphotericin B amphotericin B AMPHOTERICIN B Amphotericin b AmB Amphocil Amphotec A polyene antifungal antibiotic produced by Streptomyces nodosus, with antifungal activity. Amphotericin B binds to ergosterol, an essential component of the fungal cell membrane, thereby causing depolarization of the membrane and altering cell membrane permeability. This leads to leakage of important intracellular components, cell rupture, and eventually cell death. This agent may also induce oxidative damage in fungal cells and has been reported to stimulate host immune cells. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C238 Amphotericin B Ampicillin (2S,5R,6R)-6-((R)-2-Amino-2-phenylacetamido)-3,3-dimethyl-7-oxo-4-thia-1-azabicyclo(3.2.0)heptane-2-carboxylic Acid AMPICILLIN Ampicillin A broad-spectrum, semi-synthetic, beta-lactam penicillin antibiotic with bactericidal activity. Ampicillin binds to and inactivates penicillin-binding proteins (PBP) located on the inner membrane of the bacterial cell wall. Inactivation of PBPs interferes with the cross-linkage of peptidoglycan chains necessary for bacterial cell wall strength and rigidity. This interrupts bacterial cell wall synthesis and results in the weakening of the bacterial cell wall and causes cell lysis. Ampicillin is stable against hydrolysis by a variety of beta-lactamases, therefore, can be used in wide range of gram-positive and -negative infections. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C239 Ampicillin Angiopoietin-1 Angiopoietin-1 Angiopoietin 1 ANG-1 ANG1 ANGPT1 Angiopoietin-1 (498 aa, ~58 kDa) is encoded by the human ANGPT1 gene. This protein is involved in both signal transduction and angiogenesis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C18042 Angiopoietin-1 Angiopoietin-2 Angiopoietin 2 Tie2-Ligand Angiopoietin-2 ANGPT2 Ang-2 Ang2 Angiopoietin-2 (496 aa, ~57 kDa) is encoded by the human ANGPT2 gene. This protein plays a role in the regulation of endothelial cell apoptosis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C18056 Angiopoietin-2 Annexin_A5 Endonexin II Anchorin CII Lipocortin V Placental Anticoagulant Protein I Placental Anticoagulant Protein 4 Placental Protein 4 Thromboplastin Inhibitor Vascular Anticoagulant-Alpha Calphobindin I ANNEXIN A5 ANXA5 Annexin A5 Annexin V Annexin-5 CBP-I PAP-I PP4 VAC-Alpha Annexin A5 (320 aa, ~36 kDa) is encoded by the human ANXA5 gene. This protein plays a role in the inhibition of blood coagulation and the transmembrane transport of calcium. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C21333 Annexin A5 Antithrombin-III Antithrombin-III Antithrombin III Serine-Cysteine Proteinase Inhibitor Clade C Member 1 ATIII SERPINC1 Serpin C1 Antithrombin-III (464 aa, ~53 kDa) is encoded by the human SERPINC1 gene. This protein is involved in the negative regulation of serine proteinase activity during blood coagulation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C104683 Antithrombin-III Apelin APJ Endogenous Ligand AGTRL1 Ligand APLN Apelin Apelin (77 aa, ~9 kDa) is encoded by the human APLN gene. This protein is involved in both the inhibition of HIV-1 entry into cells and in immune responses. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C104098 Apelin Apixaban 1H-Pyrazolo(3,4-c)pyridine-3-carboxamide, 4,5,6,7-tetrahydro-1-(4-methoxyphenyl)-7-oxo-6-(4-(2-oxo-1-piperidinyl)phenyl)- BMS-562247-01 APIXABAN Apixaban BMS-562247 Eliquis An orally active inhibitor of coagulation factor Xa with anticoagulant activity. Apixaban directly inhibits factor Xa, thereby interfering with the conversion of prothrombin to thrombin and preventing formation of cross-linked fibrin clots. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61308 Apixaban Apolipoprotein_A-I Apolipoprotein A-I Apolipoprotein A1 APOA1 APO-A1 Apo-AI ApoA-I Apolipoprotein A-I (267 aa, ~31 kDa) is encoded by the human APOA1 gene. This protein is involved in the transport and metabolism of cholesterol. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C116419 Apolipoprotein A-I Apolipoprotein_A-V Apolipoprotein A-V Regeneration-Associated Protein 3 Apolipoprotein A5 APOA5 Apo-AV ApoA-V Apolipoprotein A-V (366 aa, ~41 kDa) is encoded by the human APOA5 gene. This protein is involved in the metabolism of triglycerides. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C190089 Apolipoprotein A-V Apolipoprotein_B-100 Apolipoprotein B-100 APOB Apo B-100 ApoB-100 Apolipoprotein B-100 (4563 aa, ~516 kDa) is encoded by the human APOB gene. This protein plays a role in both transport and cellular uptake of LDL particles. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C106032 Apolipoprotein B-100 Apolipoprotein_M NG20-Like Protein Apolipoprotein M Protein G3a APOM Apo-M ApoM Apolipoprotein M (188 aa, ~21 kDa) is encoded by the human APOM gene. This protein is involved in fatty acid transport. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C178705 Apolipoprotein M Argatroban 1-[5-guanidino-2-[(3-methyl-1,2,3,4-tetrahydroquinolin-8-yl)sulfonylamino]pentanoyl]-4-methyl-piperidine-2-carboxylic acid ARGATROBAN Argatroban Argipidine MD-805 A synthetic derivative of L-arginine with antithrombotic activity. Argatroban is a univalent and direct inhibitor of fibrin-bound thrombin. This agent reversibly binds to the thrombin active site thereby preventing the thrombin-dependent reactions, which include conversion of fibrinogen to fibrin; the activation of factors V, VIII and XI; the activation of protein C; and platelet aggregation. Argatroban is highly selective for thrombin and is able to inhibit the action of both free and clot-associated thrombin. As a result, stabilization of blood clots and coagulation is inhibited. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C28833 Argatroban Arginine-Vasopressin Arginine-Vasopressin Arginine Vasopressin Arg-Vasopressin Vasopressin Antidiuretic Hormone ADH AVP Arginine-vasopressin (9 aa, ~1 kDa) is encoded by the human AVP gene. This protein is involved in peripheral blood vessel vasoconstriction and antidiuretic action in the kidney. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C2285 Arginine-Vasopressin Artemisinin Artemisinin ARTEMISININ http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C78093 Artemisinin Aspirin 2-(Acetyloxy)benzoic Acid Acetylsalicylic acid Acetylsalicylic Acid ASA ASPIRIN Aspergum Aspirin Ecotrin Empirin Entericin Extren Measurin aspirin An orally administered non-steroidal antiinflammatory agent. Acetylsalicylic acid binds to and acetylates serine residues in cyclooxygenases, resulting in decreased synthesis of prostaglandin, platelet aggregation, and inflammation. This agent exhibits analgesic, antipyretic, and anticoagulant properties. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C287 Aspirin Atrial_Natriuretic_Factor Atriopeptin Atrial Natriuretic Peptide Atrionatriuretic Factor Cardionatrin Atrial Natriuretic Factor ANF ANP NPPA Atrial natriuretic factor (28 aa, ~3 kDa) is encoded by the human NPPA gene. This protein is involved in both cardiac homeostasis and pregnancy. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C139911 Atrial Natriuretic Factor Azithromycin AZITHROMYCIN, UNSPECIFIED FORM N-methyl-11-aza-10-deoxy-10-dihydroerythromycin A Azithromycin (2R,3S,4R,5R,8R,10R,11R,12S,13S,14R)-13-[(2,6-Dideoxy-3-C-methyl-3-O-methyl-alpha-L-ribo-hexopyranosyl)oxy]-2-ethyl-3,4,10-trihydroxy-3,5,6,8,10,12,14-heptamethyl-11-[(3,4,6-trideoxy-3-(dimethylamino)-beta-D-xylo-hexopyranosyl)oxy]-1-oxa-6-azacyclopentade AzaSite CP 62993 XZ-450 Zithromax An azalide, derived from erythromycin, and a member of a subclass of macrolide antibiotics with bacteriocidal and bacteriostatic activities. Azithromycin reversibly binds to the 50S ribosomal subunit of the 70S ribosome of sensitive microorganisms, thereby inhibiting the translocation step of protein synthesis, wherein a newly synthesized peptidyl tRNA molecule moves from the acceptor site on the ribosome to the peptidyl (donor) site, and consequently inhibiting RNA-dependent protein synthesis leading to cell growth inhibition and cell death. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C28844 Azithromycin Aztreonam AZTREONAM Azactam Aztreonam SQ 26,776 A monocyclic beta-lactam antibiotic originally isolated from Chromobacterium violaceum with bactericidal activity. Aztreonam preferentially binds to and inactivates penicillin-binding protein-3 (PBP-3), which is involved in bacterial cell wall synthesis, thereby inhibiting bacterial cell wall integrity and leading to cell lysis and death. This agent differs from other beta-lactam antibiotics because it is resistant to beta-lactamase hydrolysis, and it is usually used to treat infections caused by gram-negative aerobic microorganisms. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C28845 Aztreonam Azurocidin Azurocidin 1 Azurocidin 1 (Cationic Antimicrobial Protein 37) Heparin-Binding Protein AZU1 Protein Cationic Antimicrobial Protein, 37kd Cationic Antimicrobial Protein-37 Heparin Binding Protein Cationic Antimicrobial Protein 37 Neutrophil Azurocidin AZAMP AZU AZU1 Azurocidin CAP37 HBP Humazur NAZC Azurocidin (251 aa, ~27 kDa) is encoded by the human AZU1 gene. This protein plays a role in chemotaxis and receptor activation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C17278 Azurocidin B-Cell_Antigen_Receptor_Complex-Associated_Protein_Alpha_Chain MB-1 Membrane Glycoprotein Membrane-Bound Immunoglobulin-Associated Protein B-Cell Antigen Receptor Complex-Associated Protein Alpha Chain Antigen CD79a CD79a Antigen Surface IgM-Associated Protein CD79A CD79a Ig-Alpha B-cell antigen receptor complex-associated protein alpha chain (226 aa, ~25 kDa) is encoded by the human CD79A gene. This protein is involved in the modulation of signaling in and proliferation of B-cells. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C97423 B-Cell Antigen Receptor Complex-Associated Protein Alpha Chain BCHE_Gene Butyrylcholinesterase Gene BCHE BCHE Gene This gene plays a role in acylcholine hydrolysis and the regulation of myeloid cells. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C40134 BCHE Gene BCL2L1_Gene BCL2-Like 1 Gene BCL2L1 Gene BCL2L1 This gene is an apoptotic regulator that can have anti or pro apoptotic effects. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20410 BCL2L1 Gene Bcl-2-Like_Protein_1 Bcl2-Related Protein, Long Isoform Bcl-2-Like Protein 1 BCL2-Related Protein 1, Long Isoform BCL-XL Protein BCL-X Long Protein BCL-X Protein Apoptosis Regulator Bcl-X B-Cell Lymphoma-Extra Large BCL2-Like 1, Long Isoform BCL-X BCL-XL BCL2L1 Bcl2-L-1 Bcl-2-like protein 1 (233 aa, ~26 kDa) is encoded by the human BCL2L1 gene. This protein is involved in the modulation of apoptosis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C17698 Bcl-2-Like Protein 1 Bivalirudin Bivalirudin L-Leucine, D-phenylalanyl-L-prolyl-L-arginyl-L-prolylglycylglycylglycylglycyl-L-asparaginylglycyl-L-alpha-aspartyl-L-phenylalanyl-L-alpha-glutamyl-L-alpha-glutamyl-L-isoleucyl-L-prolyl-L-alpha-glutamyl-L-alpha-glutamyl-L-tyrosyl- BIVALIRUDIN Hirulog A 20 amino acid long synthetic peptide with thrombin-specific anticoagulant properties. Bivalirudin reversibly binds thrombin, free as well as clot bound, at the catalytic site and the anion-binding exosite, thereby preventing the formation and activation of fibrin, factor XIIIa, and other coagulation factors. This drug is primarily used during coronary angioplasty procedures, in combination with aspirin, in patients with unstable angina. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C47415 Bivalirudin Butorphanol Butorphanol BUTORPHANOL http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61659 Butorphanol C-C_Chemokine_Receptor_Type_7 Epstein-Barr Virus-Induced G-Protein Coupled Receptor 1 CD197 Antigen MIP-3 Beta Receptor C-C Chemokine Receptor Type 7 Lymphocyte-Specific G Protein-Coupled Peptide Receptor C-C chemokine receptor type 7 (378 aa, ~43 kDa) is encoded by the human CCR7 gene. This protein plays a role in memory T-cell migration and dendritic cell maturation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C104130 C-C Chemokine Receptor Type 7 C-C_Motif_Chemokine_2 Monocyte Chemotactic and Activating Protein Monocyte Secretory Protein JE Monocyte Chemoattractant Protein 1 C-C Motif Chemokine 2 Monocyte Chemotactic Protein-1 Monocyte Chemoattractant Protein-1 Small Inducible Cytokine A2 Small-Inducible Cytokine A2 Monocyte Chemotactic and Activating Factor Monocyte Chemotactic Protein 1 CCL2 HC11 MCAF MCP-1 MCP1 C-C motif chemokine 2 (99 aa, ~11 kDa) is encoded by the human CCL2 gene. This protein plays a role in monocyte and basophil chemotaxis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20909 C-C Motif Chemokine 2 C-C_Motif_Chemokine_3 Chemokine (C-C motif) Ligand 3 Stem Cell Inhibitor C-C Motif Chemokine 3 Macrophage Inflammatory Protein 1-Alpha Small Inducible Cytokine A3 Tonsillar Lymphocyte LD78 Alpha Protein G0/G1 Switch Regulatory Protein 19-1 Small-Inducible Cytokine A3 MIP-1 Alpha MIP-1-alpha CCL3 LD78 LD78-Alpha MIP-1a MIP-1A MIP1A PAT 464.1 SIS-Beta C-C motif chemokine 3 (92 aa, ~10 kDa) is encoded by the human CCL3 gene. This protein is involved in both the inhibition of HIV binding to C-C chemokine receptor type 5 and the regulation of neutrophil and monocyte chemotaxis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20481 C-C Motif Chemokine 3 C-C_Motif_Chemokine_4 Secreted Protein G-26 Lymphocyte Activation Gene 1 Protein Human Macrophage Inflammatory Protein-1 Beta C-C Motif Chemokine 4 Protein H400 T-Cell Activation Protein 2 Macrophage Inflammatory Protein 1-Beta Small Inducible Cytokine A4 Small-Inducible Cytokine A4 MIP-1-Beta(1-69) G-26 T-Lymphocyte-Secreted Protein ACT-2 ACT2 AT744.1 Act-2 CCL4 HC21 LAG-1 LAG1 MIP-1 Beta MIP-1-Beta MIP-1B MIP1B PAT 744 SCYA4 SIS-Gamma C-C motif chemokine 4 (92 aa, ~10 kDa) is encoded by the human CCL4 gene. This protein is involved in both the regulation of neutrophil and monocyte chemotaxis and the inhibition of HIV binding to C-C chemokine receptor type 5. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20477 C-C Motif Chemokine 4 C-Reactive_Protein C-Reactive Protein Pentraxin 1 C-Reactive Protein [Precursor] Pentraxin 1, Short CRP C-reactive protein (224 aa, ~25 kDa) is encoded by the human CRP gene. This protein is cleaved during biological activation and is associated with host defense mechanisms and inflammatory responses. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C60651 C-Reactive Protein C-X-C_Chemokine_Receptor_Type_4 CXCR4 Receptor Lipopolysaccharide-Associated Protein 3 Seven-Transmembrane-Segment Receptor, Spleen Leukocyte-Derived Seven-Transmembrane-Domain Receptor Leukocyte-Derived Seven Transmembrane Domain Receptor SDF1/PBSF Receptor CXCR4 CD184 Antigen Stromal Cell-Derived Factor 1 Receptor SDF-1 Receptor LPS-Associated Protein 3 Chemokine (C-X-C Motif) Receptor 4 C-X-C Chemokine Receptor Type 4 Neuropeptide Y Receptor Y3 Chemokine, CXC Motif, Receptor 4 CXC-R4 CXCR-4 CXCR4 FB22 Fusin HM89 LAP-3 LCR1 LESTR C-X-C chemokine receptor type 4 (352 aa, ~40 kDa) is encoded by the human CXCR4 gene. This protein is involved in the stimulation of mitogenic signaling pathways, vascularization of the gastrointestinal tract and hematopoiesis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C17789 C-X-C Chemokine Receptor Type 4 C-X-C_Motif_Chemokine_10 10 kDa Interferon Gamma-Induced Protein C-X-C Motif Chemokine 10 Small-Inducible Cytokine B10 IFN-Gamma-Inducible Protein-10 C-X-C Motif Chemokine Ligand 10 Interferon-Gamma-Inducible Protein 10 Small Inducible Cytokine B10 Chemokine (C-X-C Motif) Ligand 10 Interferon-alpha Inducible Protein 10 Interferon-Gamma-Induced Factor Interferon-Inducible Cytokine IP-10 Interferon-Gamma Induced Protein Interferon Gamma-Induced Factor CXCL10 Gamma IP10 Gamma-IP10 IP-10 IP10 C-X-C motif chemokine 10 (98 aa, ~11 kDa) is encoded by the human CXCL10 gene. This protein is involved in chemotaxis of monocytes and T-lymphocytes. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C28756 C-X-C Motif Chemokine 10 C-X-C_Motif_Chemokine_16 Scavenger Receptor for Phosphatidylserine and Oxidized Low Density Lipoprotein C-X-C Motif Chemokine 16 CXC Chemokine Ligand 16 CXCL16 C-X-C motif chemokine 16 (254 aa, ~28 kDa) is encoded by the human CXCL16 gene. This protein may be involved in lymphocyte chemotaxis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C104145 C-X-C Motif Chemokine 16 C3AR1_Gene Complement C3a Receptor 1 Gene C3AR1 C3AR1 Gene This gene plays a role in C3a-mediated chemotaxis, granule enzyme release and superoxide anion production. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C182144 C3AR1 Gene C3a_Anaphylatoxin_Chemotactic_Receptor Complement Component 3a Receptor 1 C3a Anaphylatoxin Chemotactic Receptor Complement C3a Receptor 1 Complement Component 3 Receptor 1 C3AR C3AR1 C3a-R C3a anaphylatoxin chemotactic receptor (482 aa, ~54 kDa) is encoded by the human C3AR1 gene. This protein plays a role in the regulation of chemotaxis, granule enzyme release, superoxide anion production, and bacterial opsonization. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C182148 C3a Anaphylatoxin Chemotactic Receptor CALCA_Gene Calcitonin Related Polypeptide Alpha Gene CALCA CALCA Gene This gene is involved in the regulation of bone incorporation and blood calcium and phosphate levels. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C38189 CALCA Gene CASC15 LINC00340 CASC15 CANCER SUSCEPTIBILITY CANDIDATE 2 http://purl.obolibrary.org/obo/OGG_3000401237 CASC15 CASC2 CANCER SUSCEPTIBILITY CANDIDATE 2 CASC2 http://purl.bioontology.org/ontology/OMIM/608598 CASC2 CCL2_Gene Chemokine (C-C Motif) Ligand 2 Gene CCL2 CCL2 Gene MCP-1 MCP1 This gene is involved in inflammatory processes and disease development. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20907 CCL2 Gene CCL3_Gene Chemokine (C-C Motif) Ligand 3 Gene CCL3 CCL3 Gene MIP-1A MIP1A This gene is involved in intercellular communication. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C24782 CCL3 Gene CCL4_Gene Chemokine (C-C Motif) Ligand 4 Gene CCL4 CCL4 Gene MIP-1B MIP1B This gene plays a role in inflammatory and antiviral responses. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C24784 CCL4 Gene CCR7_Gene Chemokine (C-C motif) Receptor 7 Gene CCR7 CCR7 Gene CD197 This gene plays a role in immune function. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C104128 CCR7 Gene CD14_Gene CD14 Molecule Gene CD14 CD14 Gene This gene plays a role in apoptosis and in ligand-binding interactions. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C21290 CD14 Gene CD163_Gene CD163 Molecule Gene CD163 CD163 Gene This gene plays a role in endocytosis by macrophages. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C104062 CD163 Gene CD177_Antigen Polycythemia Rubra Vera Protein 1 CD177 Antigen Polycythemia Rubra Vera 1 Human Neutrophil Alloantigen 2a Polycythemia Rubra Vera-1 Neutrophil-Specific Antigen 1 NB1 Glycoprotein NB1 GP CD177 antigen (437 aa, ~46 kDa) is encoded by the human CD177 gene. This protein is involved in coagulation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C113575 CD177 Antigen CD177_Gene CD177 Molecule Gene CD177 CD177 Gene This gene is involved in platelet function. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C113573 CD177 Gene CD274_Gene CD274 Molecule Gene CD274 CD274 Gene PD-L1 PDL1 This gene is involved in T cell activation and proliferation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C96022 CD274 Gene CD40LG_Gene CD40 Ligand Gene CD40LG Gene CD154 Gene CD40LG This gene plays a role in the stimulation of B cells in immune responses. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C21132 CD40LG Gene CD40_Ligand CD40 Ligand T Cell Antigen gp39 TNF-Related Activation Protein T-B Cell-Activating Molecule CD154 Antigen Tumor Necrosis Factor Ligand Superfamily Member 5 CD40-ligand T-Cell Antigen Gp39 CD40 Antigen Ligand CD154 CD40-L CD40L CD40LG HIGM1 IMD3 T-BAM TNFSF5 TRAP gp39 CD40 ligand (261 aa, ~29 kDa) is encoded by the human CD40LG gene. This protein is involved in both binding to CD40 and the modulation of B-cell function. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20528 CD40 Ligand CD74_Gene CD74 Molecule Gene CD74 CD74 Gene This gene plays a role in antigen processing and presentation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C97418 CD74 Gene CD79A_Gene CD79a Molecule Gene CD79A CD79A Gene This gene is involved in B-cell signaling and proliferation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C97421 CD79A Gene CD80_Gene CD80 Molecule Gene CD80 CD80 Gene This gene is involved in the stimulation of T-cells and in immune responses. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C21363 CD80 Gene CD86_Gene CD86 Molecule Gene CD86 CD86 Gene This gene plays a role in the modulation of T-cell proliferation and interleukin production. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C78145 CD86 Gene CDH5_Gene Cadherin 5, Type 2 (Vascular Epithelium) Gene CDH5 CDH5 Gene This gene plays a role in cellular adhesion and endothelial cell cohesion. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20722 CDH5 Gene CHGA_Gene Chromogranin A (Parathyroid Secretory Protein 1) Gene CHGA CHGA Gene This gene plays a role in the modulation of the neuroendocrine system. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C21167 CHGA Gene CHI3L1_Gene CHI3L1 Gene Chitinase 3-Like 1 Gene CHI3L1 This gene plays a role in carbohydrate binding, inflammation and tissue remodeling. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C125183 CHI3L1 Gene CLEC5A_Gene MDL-1 MDL1 CLECSF5 Other designations: C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 5|C-type lectin domain family 5 member A|C-type lectin superfamily member 5|myeloid DAP12-associating lectin 1|myeloid DAP12-associating lectin-1 http://purl.obolibrary.org/obo/OGG_3000023601 CLEC5A Gene COL3A1_Gene COL3A1 Gene Collagen Type III Alpha 1 Chain Gene COL3A1 This gene plays a role in collagen formation in connective tissues. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C143052 COL3A1 Gene CP_Gene Ceruloplasmin (Ferroxidase) Gene CP CP Gene This gene is a metalloprotein involved in copper binding in plasma. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C104137 CP Gene CR1_Gene Complement Component (3b/4b) Receptor 1 (Knops Blood Group) Gene CR1 CR1 Gene This gene is involved in the complement activation pathway. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C84437 CR1 Gene CRP_Gene C-Reactive Protein, Pentraxin-Related Gene CRP CRP Gene This gene plays a role in immune and inflammatory processes. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C60649 CRP Gene CSF2_Gene Colony Stimulating Factor 2 (Granulocyte-Macrophage) Gene CSF2 CSF2 Gene GMCSF This gene plays a role in the regulation of hematopoietic cellular processes. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C24310 CSF2 Gene CST3_Gene Cystatin C Gene CST3 CST3 Gene This gene is involved in enzyme inhibition. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C88356 CST3 Gene CXCL10_Gene CXCL10 Gene C-X-C Motif Chemokine Ligand 10 Gene CXCL10 Interferon-gamma-inducible Protein 10 IP-10 IP10 This gene plays a role in immune system processes and is involved in angiogenesis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C24788 CXCL10 Gene CXCL12_Gene Chemokine (C-X-C Motif) Ligand 12 Gene CXCL12 Gene CXCL12 SDF1 This gene is involved in chemotaxis and extracellular matrix regulation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C24797 CXCL12 Gene CXCL16_Gene CXCL16 Gene Chemokine (C-X-C motif) Ligand 16 Gene CXCL16 This gene may be involved in immune-cell chemotaxis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C104143 CXCL16 Gene CXCR4_Gene Chemokine (C-X-C Motif) Receptor 4 Gene CXCR4 CXCR4 Gene This gene is involved in the mediation of viral entry into cells and cellular migration and chemotaxis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C24327 CXCR4 Gene CYP1B1_Gene Cytochrome P450, Family 1, Subfamily B, Polypeptide 1 Gene CYP1B1 Gene CYP1B1 This gene plays a role in eye development, steroid catabolism and xenobiotic metabolism. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C104233 CYP1B1 Gene CYSTM1_Gene C5orf32 CYSTM1 Gene Other designations: UPF0467 protein C5orf32|cysteine-rich and transmembrane domain-containing protein 1|putative nuclear protein ORF1-FL49 http://purl.obolibrary.org/obo/OGG_3000084418 CYSTM1 Gene Cadherin-5 Endothelial-Specific Cadherin Vascular Endothelial Cadherin Vascular Endothelial Cadherin 1 7B4 Antigen CD144 Antigen VE-Cadherin CDH5 Cadherin 5 Cadherin-5 Cadherin-5 (784 aa, ~88 kDa) is encoded by the human CDH5 gene. This protein is involved in endothelial cell polarity and cell-cell adhesion. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C21021 Cadherin-5 Calcium_Chloride Calcium Chloride Calcium Chloride Hexahydrate CALCIUM CHLORIDE Calcium Chloride Dihydrate Calcium Chloride Anhydrous A crystalline, white substance, soluble in water, Calcium Chloride is the chloride salt of calcium, a bivalent metallic element with many crucial biological roles. Calcium is a major constituent of the skeleton but plays many roles as an intracellular and plasma ion as well. In medicine, calcium chloride is also used as a 10% solution in injection, for calcium replenishment. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C28901 Calcium Chloride Carbamazepine 5H-Dibenz(b,f)azepine-5-carboxamide Carbamazepine CARBAMAZEPINE Epitol Tegretol A tricyclic compound chemically related to tricyclic antidepressants (TCA) with anticonvulsant and analgesic properties. Carbamazepine exerts its anticonvulsant activity by reducing polysynaptic responses and blocking post-tetanic potentiation. Its analgesic activity is not understood; however, carbamazepine is commonly used to treat pain associated with trigeminal neuralgia. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C341 Carbamazepine Carbenicillin CARBENICILLIN Carbenicillin Geopen Pyopen A broad-spectrum, semi-synthetic penicillin antibiotic with bactericidal and beta-lactamase resistant activity. Carbenicillin acylates the penicillin-sensitive transpeptidase C-terminal domain by opening the lactam ring. This inactivation prevents the cross-linkage of peptidoglycan strands, thereby inhibiting the third and last stage of bacterial cell wall synthesis. This leads to incomplete bacterial cell wall synthesis and eventually causes cell lysis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C343 Carbenicillin Caspofungin Caspofungin CASPOFUNGIN An antimycotic echinocandin lipopeptide, semisynthetically derived from a fermentation product of the fungus Glarea lozoyensis. Caspofungin inhibits 1,3-beta-glucan synthase, resulting in decreased synthesis of beta(1,3)-D-glucan (an essential component of the fungal cell wall), weakening of the fungal cell wall, and fungal cell wall rupture. This agent is active against Aspergillus and Candida species. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C28910 Caspofungin Cefaclor Cefaclor Hydrate CEFACLOR Cefaclor A beta-lactam, second-generation cephalosporin antibiotic with bactericidal activity. Cefaclor binds to and inactivates penicillin-binding proteins (PBP) located in bacterial cytoplasmic membranes. PBPs are enzymes involved in the terminal stages of assembling the bacterial cell wall and in reshaping the cell wall during growth and division. Inactivation of PBPs interferes with the cross-linkage of peptidoglycan chains necessary for bacterial cell wall strength and rigidity. This results in the weakening of the bacterial cell wall and causes cell lysis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C28911 Cefaclor Cefepime CEFEPIME Cefepime cefepime A semisynthetic, broad-spectrum, fourth-generation cephalosporin with antibacterial activity. Cefepime binds to and inactivates penicillin-binding proteins (PBPs) located on the inner membrane of the bacterial cell wall. PBPs are enzymes involved in the terminal stages of assembling the bacterial cell wall and in reshaping the cell wall during growth and division. Inactivation of PBPs interferes with the cross-linkage of peptidoglycan chains necessary for bacterial cell wall strength and rigidity. This results in the weakening of the bacterial cell wall and causes cell lysis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C65294 Cefepime Cefixime Cefixime Trihydrate CEFIXIME Cefixime FK 027 Suprax cefixime A broad-spectrum, third-generation cephalosporin antibiotic derived semisynthetically from the marine fungus Cephalosporium acremonium with antibacterial activity. As does penicillin, the beta-lactam antibiotic cefixime inhibits bacterial cell wall synthesis by disrupting peptidoglycan synthesis, resulting in a reduction in bacterial cell wall stability and bacterial cell lysis. Stable in the presence of a variety of beta-lactamases, this agent is more active against gram-negative bacteria and less active against gram-positive bacteria compared to second-generation cephalosporins. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C1100 Cefixime Cefoperazone CEFOPERAZONE Cefoperazone A semisynthetic, broad-spectrum, third-generation cephalosporin with antibacterial activity. Cefoperazone binds to and inactivates penicillin-binding proteins (PBPs) located on the inner membrane of the bacterial cell wall. PBPs are enzymes involved in the terminal stages of assembling the bacterial cell wall and in reshaping the cell wall during growth and division. Inactivation of PBPs interferes with the cross-linkage of peptidoglycan chains necessary for bacterial cell wall strength and rigidity. This results in the weakening of the bacterial cell wall and causes cell lysis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61663 Cefoperazone Cefotaxime CEFOTAXIME Cefotaxime A third generation semisynthetic cephalosporin antibiotic with bactericidal activity. Cefotaxime inhibits mucopeptide synthesis by binding to and inactivating penicillin binding proteins thereby interfering with the final transpeptidation step required for cross-linking of peptidoglycan units which are a component of bacterial cell walls. This results in a reduction of cell wall stability and causes cell lysis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C354 Cefotaxime Cefpirome 5H-1-Pyrindinium,1-((7-(((2-amino-4-thiazolyl)(methoxyimino)acetyl)amino)-2-carboxy-8-oxo-5-thia-1-azabicyclo(4.2.0)oct-2-en-3-yl)methyl)-5,6,7,8-tetrahydro-, hydroxide, inner salt, (6R-(6alpha,7beta(Z)))- CEFPIROME Cefpiroma Cefpirome HR 810 A semisynthetic, broad-spectrum, fourth-generation cephalosporin with antibacterial activity. Cefpirome binds to and inactivates penicillin-binding proteins (PBPs) located on the inner membrane of the bacterial cell wall. PBPs are enzymes involved in the terminal stages of assembling the bacterial cell wall and in reshaping the cell wall during growth and division. Inactivation of PBPs interferes with the cross-linkage of peptidoglycan chains necessary for bacterial cell wall strength and rigidity. This results in the weakening of the bacterial cell wall and causes cell lysis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C79563 Cefpirome Ceftaroline_Fosamil Ceftaroline Fosamil (6R,7R)-7-(((2Z)-(Ethoxyimino)(5-(phosphonoamino)-1,2,4-thiadiazol-3-yl)acetyl)amino)-3-((4-(1-methylpyridinium-4-yl)thiazol-2-yl)sulfanyl)-8-oxo-5-thia-1-azabicyclo(4.2.0)oct-2-en-2-carboxylate Monoacetate Monohydrate CEFTAROLINE FOSAMIL PPI-0903 TAK-599 Teflaro An N-phosphono prodrug of the fifth-generation cephalosporin derivative ceftaroline with antibacterial activity. Ceftaroline fosamil is hydrolyzed to the active form ceftaroline in vivo. Ceftaroline binds to and inactivates penicillin-binding proteins (PBPs) located on the inner membrane of the bacterial cell wall. PBPs are enzymes involved in the terminal stages of assembling the bacterial cell wall and in reshaping the cell wall during growth and division. Inactivation of PBPs interferes with the cross-linkage of peptidoglycan chains necessary for bacterial cell wall strength and rigidity. This results in the weakening of the bacterial cell wall and causes cell lysis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C81034 Ceftaroline Fosamil Cefuroxime CEFUROXIME Cefuroxime A semisynthetic, broad-spectrum, beta-lactamase-resistant, second-generation cephalosporin with antibacterial activity. Cefuroxime binds to and inactivates penicillin-binding proteins (PBPs) located on the inner membrane of the bacterial cell wall. PBPs are enzymes involved in the terminal stages of assembling the bacterial cell wall and in reshaping the cell wall during growth and division. Inactivation of PBPs interferes with the cross-linkage of peptidoglycan chains necessary for bacterial cell wall strength and rigidity. This results in the weakening of the bacterial cell wall and causes cell lysis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61669 Cefuroxime Cephradine (6R,7R)-7-((R)-2-Amino-2-(1,4-cyclohexadien-1-yl)acetamido)-3-methyl-8-oxo-5-thia-1-azabicyclo(4.2.0)oct-2-ene-2-carboxylic Acid 7-(D-2-Amino-2-(1,4-cyclohexadien-1-yl)acetamido)-3-methyl-8-oxo-5-thia-1-azabicyclo(4.2.0)-oct-2-ene-2-caboxylic Acid SK&F D-39304 Anspor CEPHRADINE Cefradine Cephradine SQ 11436 Velosef A beta-lactam, first-generation cephalosporin antibiotic with bactericidal activity. Cephradine binds to and inactivates penicillin-binding proteins (PBP) located on the inner membrane of the bacterial cell wall. PBPs participate in the terminal stages of assembling the bacterial cell wall, and in reshaping the cell wall during cell division. Inactivation of PBPs interferes with the cross-linkage of peptidoglycan chains necessary for bacterial cell wall strength and rigidity. This results in the weakening of the bacterial cell wall and causes cell lysis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C47441 Cephradine Ceruloplasmin Ferroxidase Ceruloplasmin CP Ceruloplasmin (1065 aa, ~122 kDa) is encoded by the human CP gene. This protein is involved in iron homeostasis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C104139 Ceruloplasmin Chitinase-3-Like_Protein_1 Chitinase-3-Like Protein 1 Chondrocyte Protein YKL40 Cartilage Glycoprotein 39 39 kDa Synovial Protein CGP-39 CHI3L1 GP-39 YKL-40 hCGP-39 Chitinase-3-like protein 1 (383 aa, ~43 kDa) is encoded by the human CHI3L1 gene. This protein plays a role in tissue remodeling, inflammation and chitin binding. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C93267 Chitinase-3-Like Protein 1 Chloramphenicol CHLORAMPHENICOL [R-(R*,R*)]-2,2-Dichloro-N-[2-hydroxy-1-(hydroxymethyl)-2-(4-nitrophenyl)ethyl]acetamide Chloramphenicol A semisynthetic, broad-spectrum antibiotic derived from Streptomyces venequelae with primarily bacteriostatic activity. Chloramphenicol diffuses through the bacterial cell wall and reversibly binds to the bacterial 50S ribosomal subunit. The binding interferes with peptidyl transferase activity, thereby prevents transfer of amino acids to the growing peptide chains and blocks peptide bond formation. As a result bacterial protein synthesis is blocked and impede bacterial cell proliferation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C363 Chloramphenicol Chloroquine Chloroquine CHLOROQUINE A 4-aminoquinoline with antimalarial, anti-inflammatory, and potential chemosensitization and radiosensitization activities. Although the mechanism is not well understood, chloroquine is shown to inhibit the parasitic enzyme heme polymerase that converts the toxic heme into non-toxic hemazoin, thereby resulting in the accumulation of toxic heme within the parasite. This agent may also interfere with the biosynthesis of nucleic acids. Chloroquine's potential chemosensitizing and radiosensitizing activities in cancer may be related to its inhibition of autophagy, a cellular mechanism involving lysosomal degradation that minimizes the production of reactive oxygen species (ROS) related to tumor reoxygenation and tumor exposure to chemotherapeutic agents and radiation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61671 Chloroquine Cholinesterase Acylcholine Acylhydrolase Plasma Cholinesterase Choline Esterase II Pseudocholinesterase Pseudocholinesterase E1 Butyrylcholinesterase Cholinesterase Butyrylcholine Esterase BCHE CHE1 EC 3.1.1.8 Cholinesterase (602 aa, ~68 kDa) is encoded by the human BCHE gene. This protein plays a role in choline metabolism. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C45486 Cholinesterase Chromogranin-A Pituitary Secretory Protein I Chromogranin A Parathyroid Secretory Protein 1 Secretory Protein I Chromogranin-A CHGA CgA PSP SP-I Chromogranin-A (457 aa, ~51 kDa) is encoded by the human CHGA gene. This protein plays a role in the modulation of both blood pressure and pancreatic release of insulin. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C17284 Chromogranin-A Cilostazol 6-[4-(1-cyclohexyl-1H-tetrazol-5-yl)butoxy]-3,4-dihydro-2(1H)-quinolinone CILOSTAZOL Cilostazol Pletal A quinolinone derivative and cellular phosphodiesterase inhibitor, more specific for phosphodiesterase III (PDE III). Although the exact mechanism of action of is unknown, cilostazol and its metabolites appears to inhibit PDE III activity, thereby suppressing cyclic adenosine monophosphate (cAMP) degradation. This results in an increase in cAMP in platelets and blood vessels, leading to inhibition of platelet aggregation and vasodilation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C1051 Cilostazol Ciprofloxacin ciprofloxacin Ciprofloxacin 1-Cyclopropyl-6-fluoro-1,4-dihydro-4-oxo-7-(1-piperazinyl)-3-quinolinecarboxylic Acid CIPROFLOXACIN Cipro A synthetic broad spectrum fluoroquinolone antibiotic. Ciprofloxacin binds to and inhibits bacterial DNA gyrase, an enzyme essential for DNA replication. This agent is more active against Gram-negative bacteria than Gram-positive bacteria. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C375 Ciprofloxacin Clarithromycin 6-O-Methylerythromycin Clarithromycin CLARITHROMYCIN clarithromycin Abbott-56268 Biaxin A semisynthetic 14-membered ring macrolide antibiotic. Clarithromycin binds to the 50S ribosomal subunit and inhibits RNA-dependent protein synthesis in susceptible organisms. Clarithromycin has been shown to eradicate gastric MALT (mucosa-associated lymphoid tissue) lymphomas, presumably due to the eradication of tumorigenic Helicobacter pylori infection. This agent also acts as a biological response modulator, possibly inhibiting angiogenesis and tumor growth through alterations in growth factor expression. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C1054 Clarithromycin Clavulanate_Potassium 4-Oxa-1-azabicyclo(3.2.0)heptane-2-carboxylic acid, 3-(2-hydroxyethylidene)-7-oxo-, Monopotassium Salt,(2R-(2alpha,3Z,5alpha))- CLAVULANATE POTASSIUM Clavulanate Potassium Amonate A semi-synthetic beta-lactamase inhibitor isolated from streptomyces. Clavunalate potassium contains a beta-lactam ring and binds strongly to beta-lactamase at or near its active site. This protects other beta-lactam antibiotics from beta-lactamase catalysis. This drug is used in conjunction with beta-lactamase susceptible penicillins to treat infections caused by beta-lactamase producing organisms. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C47453 Clavulanate Potassium Clindamycin Clindamycin 7-Chloro-7-deoxylincomycin CLINDAMYCIN Cleocin A semisynthetic broad spectrum antibiotic produced by chemical modification of the parent compound lincomycin. Clindamycin dissociates peptidyl-tRNA from the bacterial ribosome, thereby disrupting bacterial protein synthesis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C377 Clindamycin Clopidogrel Clopidogrel CLOPIDOGREL A thienopyridine, with antiplatelet activity. Clopidogrel targets, irreversibly binds to and alters the platelet receptor for adenosine diphosphate (ADP), thereby blocking the binding of ADP to its receptor, inhibiting ADP-mediated activation of the glycoprotein complex GPIIb/IIIa, and inhibiting fibrinogen binding to platelets and platelet adhesion and aggregation. This results in increased bleeding time. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61686 Clopidogrel Clotrimazole 1-[(2-Chlorophenyl)diphenylmethyl]-1H-imidazole Gyne-Lotrimin Mycelex Troche CLOTRIMAZOLE Clotrimazole CLOT Lotrimin Mycelex A synthetic, imidazole derivate with broad-spectrum, antifungal activity. Clotrimazole inhibits biosynthesis of sterols, particularly ergosterol, an essential component of the fungal cell membrane, thereby damaging and affecting the permeability of the cell membrane. This results in leakage and loss of essential intracellular compounds, and eventually causes cell lysis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C381 Clotrimazole Collagen Collagen collagen COL A family of large fibrous proteins that are the main components of connective tissue and are responsible for maintaining tissue structure. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16447 Collagen Complement_Receptor_Type_1 C3b/C4b Receptor CD35 Antigen Complement Receptor Type 1 CD35 CR1 Complement receptor type 1 (2039 aa, ~224 kDa) is encoded by the human CR1 gene. This protein is involved in complement activation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C84439 Complement Receptor Type 1 Creatine_Kinase_MB Creatine Kinase MB Creatine Kinase-MB Creatine Phosphokinase-MB CK-MB CKMB CPK-MB MM-CK An isoenzyme complex comprised of a heterodimer of creatine kinase M-type and B-type. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C122778 Creatine Kinase MB Cystatin-C Gamma-Trace Neuroendocrine Basic Polypeptide Post-Gamma-Globulin Cystatin C Cystatin-3 Cystatin C Cystatin-C (146 aa, ~16 kDa) is encoded by the human CST3 gene. This protein is involved in the inhibition of cysteine proteinases. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C88359 Cystatin-C Cysteine-rich_Transmembrane_Module_Containing_1 Cysteine-rich Transmembrane Module Containing 1 CYSTM1 A protein coding gene CYSTM1 in human. http://purl.obolibrary.org/obo/HGNC_30239 Cysteine-rich Transmembrane Module Containing 1 Cytochrome_P450_1B1 EC 1.14.14.1 Cytochrome P450 1B1 CYP1B1 CYPIB1 Cytochrome P450 1B1 (543 aa, ~61 kDa) is encoded by the human CYP1B1 gene. This protein plays a role in the metabolism of steroids and xenobiotics. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C104237 Cytochrome P450 1B1 DLL1_Gene Delta-Like 1 (Drosophila) Gene DLL1 DLL1 Gene This gene is involved in notch signaling. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C106582 DLL1 Gene DPP4_Gene Dipeptidyl-Peptidase 4 Gene DPP4 DPP4 Gene This gene is involved in the regulation of proteolysis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C91298 DPP4 Gene Dabigatran DABIGATRAN Dabigatran A benzimidazole and direct thrombin inhibitor, with anticoagulant activity. Upon administration, dabigatran reversibly binds to and inhibits the activity of thrombin, a serine protease that converts fibrinogen into fibrin. This disrupts the coagulation cascade and inhibits the formation of blood clots. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C73224 Dabigatran Dalteparin DALTEPARIN Dalteparin dalteparin A low molecular weight, synthetic heparin. As an anticoagulant/antithrombotic agent, dalteparin binds to antithrombin and enhances the inhibition of Factor Xa. Compared to unfractionated heparins, the use of dalteparin is associated with lower incidences of osteoporosis and heparin-induced thrombocytopenia. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C1453 Dalteparin Delta-like_1 Delta-like Protein 1 DLL1 A protein coding gene DLL1 in human. http://purl.obolibrary.org/obo/HGNC_2908 Delta-like Protein 1 Dexamethasone Amplidermis Hexadecadrol Dexamonozon Alin Oftalmico Fortecortin Fluorodelta (11Beta,16alpha)-9-fluoro-11,17,21-trihydroxy-16-methylpregna-1,4-diene-3,20-dione Gammacorten Dexamethasone Intensol Deltafluorene dexamethasone Mymethasone Dexa-Scheroson Dexamethasonum Visumetazone Lokalison-F 9Alpha-fluoro-11beta,17alpha,21-trihydroxy-16alpha-methylpregna-1,4-diene-3,20-dione 16Alpha-methyl-9alpha-fluoro-delta1-hydrocortisone Dexa-Mamallet Decadron DP Dexamethasone Aknichthol Dexa Desamethasone Auricularum Anemul mono Cortisumman 16Alpha-methyl-9alpha-fluoro-1,4-pregnadiene-11beta,17alpha,21-triol-3,20-dione Dexamecortin 9alpha-Fluoro-16alpha- methylprednisolone Fluoro-9alpha Methyl-16alpha Prednisolone Dexa-Rhinosan Cortidexason 16Alpha-methyl-9alpha-fluoroprednisolone 9Alpha-fluoro-16alpha-methylprednisolone Methylfluorprednisolone Decasone R.p. Millicorten DEXAMETHASONE 1-Dehydro-16alpha-methyl-9alpha-fluorohydrocortisone Dexafluorene Aacidexam Adexone Alba-Dex Alin Alin Depot Auxiloson Baycadron Baycuten Baycuten N Decacort Decadrol Decadron Decalix Decameth Dectancyl Dekacort Deronil Desameton Dexa-sine Dexacortal Dexacortin Dexafarma Dexalocal Dexameth Dexapos Dexinoral Dexone Dinormon Dxevo Hemady Hexadrol Loverine Orgadrone Spersadex TaperDex ZoDex A synthetic adrenal corticosteroid with potent anti-inflammatory properties. In addition to binding to specific nuclear steroid receptors, dexamethasone also interferes with NF-kB activation and apoptotic pathways. This agent lacks the salt-retaining properties of other related adrenal hormones. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C422 Dexamethasone Dexmedetomidine DEXMEDETOMIDINE Dexmedetomidine (+)-4-((S)-alpha,2,3-Trimethylbenzyl)imidazole An imidazole derivate and active d-isomer of medetomidine with analgesic, anxiolytic and sedative properties. Dexmedetomidine selectively binds to presynaptic alpha-2 adrenoceptors located in the brain, thereby inhibiting the release of norepinephrine from synaptic vesicles. This leads to an inhibition of postsynaptic activation of adrenoceptors, which inhibit sympathetic activity, thereby leading to sedation and anxiolysis. The analgesic effect of this agent is mediated by binding to alpha-2 adrenoceptors in the spinal cord. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C47479 Dexmedetomidine Diazepam 7-Chloro-1,3-dihydro-1-methyl-5-phenyl-2H-1,4-benzodiazepin-2-one DIAZEPAM Diazepam Valium diazepam A benzodiazepine derivative with anti-anxiety, sedative, hypnotic and anticonvulsant properties. Diazepam potentiates the inhibitory activities of gamma-aminobutyric acid (GABA) by binding to the GABA receptor, located in the limbic system and the hypothalamus. This increases the frequency of chloride channel opening, allowing the flow of chloride ions into the neuron and ultimately leading to membrane hyperpolarization and a decrease in neuronal excitability. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C28982 Diazepam Dipeptidyl_Peptidase_4 Dipeptidyl-Peptidase IV Dipeptidyl Peptidase 4 Dipeptidyl-Peptidase 4 Dipeptidyl Peptidase IV CD26 Antigen Adenosine Deaminase Complexing Protein 2 EC 3.4.14.5 T-Cell Activation Antigen CD26 ADABP ADCP-2 CD26 DPP IV DPP4 TP103 Dipeptidyl peptidase 4 (766 aa, ~88 kDa) is encoded by the human DPP4 gene. This protein is involved in proteolytic regulation of T cell activation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C91300 Dipeptidyl Peptidase 4 Dipyridamole DIPYRIDAMOLE 2,2',2'',2''''-[(4,8-Dipiperidinopyrimido-[5,4-d]pyrimidine-2,6-diyl)dinitrilo]tetraethanol Dipyridamole dipyridamole DP Persantine A synthetic agent derivative of pyrimido-pyrimidine, with antiplatelet properties. Dipyridamole inhibits adenosine uptake by platelets and endothelial cells, triggering an accumulation of cyclic adenosine monophosphate (cAMP), and inhibiting the stimulation of platelet aggregation by agents such as platelet activating factor and collagen. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C445 Dipyridamole Dirithromycin DIRITHROMYCIN Dirithromycin Erythromycin, 9-deoxo-11-deoxy-9,11-(imino(2-(2-methoxyethoxy)ethylidene)oxy)-,(9S(R))- Dynabac A semi-synthetic macrolide antibiotic pro-drug. Dirithromycin is converted by hydrolysis during intestinal absorption into the microbiologically active erythromycylamine. Eryhtromylamine binds to the 50 S subunit of the 70 S ribosome of susceptible organisms, thereby inhibiting bacterial RNA-dependent protein synthesis. This antibiotic is used in the treatment of infections of the respiratory tract, skin and soft tissue caused by gram-positive microorganisms, including S. aureus, S. pneumonia and pyogenes, gram-negative microorganisms, including H. influenzae, L. pneumophila, M. catarrhalis, and M. pneumoniae. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C47496 Dirithromycin Dobutamine DOBUTAMINE Dobutamine A synthetic catecholamine with sympathomimetic activity. Dobutamine is a direct-acting inotropic agent and an adrenergic agonist that stimulates primarily the beta-1 adrenoceptor, with lesser effect on beta-2 or alpha receptors. Via beta-1 adrenoceptor of the heart, this agent induces positive inotropic effect with minimal changes in chronotropic activities or systemic vascular resistance. Dobutamine also causes vasodilation by stimulating beta-2 adrenergic receptors in blood vessels, augmented by reflex vasoconstriction resulting in increased cardiac output. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61733 Dobutamine Doxycycline Doxycycline Monohydrate DOXYCYCLINE doxycycline Doxycycline A synthetic, broad-spectrum tetracycline antibiotic exhibiting antimicrobial activity. Doxycycline binds to the 30S ribosomal subunit, possibly to the 50S ribosomal subunit as well, thereby blocking the binding of aminoacyl-tRNA to the mRNA-ribosome complex. This leads to an inhibition of protein synthesis. In addition, this agent has exhibited inhibition of collagenase activity. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C457 Doxycycline E-Selectin Cell Adhesion Molecule E-Selectin Leukocyte Endothelial Cell Adhesion Molecule 2 CD62 Antigen-Like Family Member E Leukocyte-Endothelial Cell Adhesion Molecule 2 Endothelial Adhesion Molecule 1 Endothelial Leukocyte Adhesion Molecule 1 CD62E E-Selectin ELAM ELAM-1 ELAM1 ESEL LECAM2 SELE E-selectin (610 aa, ~67 kDa) is encoded by the human SELE gene. This protein is involved in leukocyte adhesion, migration and rolling. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C17491 E-Selectin ELANE_Gene Elastase, Neutrophil Expressed Gene ELANE ELANE Gene PMN-E This gene plays a role in innate host defense. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C104195 ELANE Gene ENO2_Gene Enolase 2 (Gamma, Neuronal) Gene ENO2 ENO2 Gene NSE This gene is involved in cell survival. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C62212 ENO2 Gene EPO_Gene Erythropoietin Gene EPO EPO Gene This gene is involved in the regulation of red blood cell production and function. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C28442 EPO Gene ESM1_Gene Endothelial Cell-Specific Molecule 1 Gene Endocan Gene ESM1 ESM1 Gene This gene may play a role in endothelial cell-leukocyte interactions. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C104087 ESM1 Gene Endothelial_Cell-Specific_Molecule_1 Endothelial Cell-Specific Molecule 1 ESM-1 ESM1 Endocan Endothelial cell-specific molecule 1 (184 aa, ~20 kDa) is encoded by the human ESM1 gene. This protein may play a role in the modulation of leukocyte-endothelial cell interactions. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C104089 Endothelial Cell-Specific Molecule 1 Enoxaparin ENOXAPARIN Enoxaparin enoxaparin A low molecular weight, synthetic heparin. As an anticoagulant/antithrombotic agent, enoxaprin's mechanism of action is similar to that of heparin, although it exhibits a higher ratio of anti-Factor Xa to anti-Factor IIa activity. This agent also has anti-inflammatory properties, inhibiting monocyte adhesion to tumor necrosis factor alpha- or lipopolysaccharide-activated endothelial cells. Compared to unfractionated heparins, the use of enoxaparin is associated with lower incidences of osteoporosis and heparin-induced thrombocytopenia. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C1452 Enoxaparin Erythromycin Erythromycin ERYTHROMYCIN E-Mycin ERYC Ery-Tab EryDerm Eryc Eryderm Ilotycin RP-Mycin Robimycin A broad-spectrum, macrolide antibiotic with antibacterial activity. Erythromycin diffuses through the bacterial cell membrane and reversibly binds to the 50S subunit of the bacterial ribosome. This prevents bacterial protein synthesis. Erythromycin may be bacteriostatic or bactericidal in action, depending on the concentration of the drug at the site of infection and the susceptibility of the organism involved. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C476 Erythromycin Erythropoietin Erythropoeitin erythropoietin Hemopoietin Hematopoietin Erythropoietin Erythrocyte Colony Stimulating Factor EPO Epoetin Erythropoietin (193 aa, ~21 kDa) is encoded by the human EPO gene. This protein plays a role in both erythropoiesis and the maintenance of red blood cell volume. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20429 Erythropoietin F3_Gene Coagulation Factor III, Tissue Factor Gene F3 F3 Gene This gene is involved in the blood coagulation process by initiating blood coagulation cascades. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C21098 F3 Gene FA2H_Gene Fatty Acid 2-Hydroxylase Gene FA2H FA2H Gene FAAH This gene plays a role in the synthesis of (R)-2-hydroxy fatty acids. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C189068 FA2H Gene FABP2_Gene Fatty Acid Binding Protein 2, Intestinal Gene FABP2 FABP2 Gene This gene plays a role in fatty acid metabolism in the intestine. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20926 FABP2 Gene FAP_Gene Fibroblast Activation Protein Alpha Gene FAP FAP Gene This gene is involved in the regulation of fibroblast growth. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C26582 FAP Gene FCGR1A_Gene Fc Fragment of IgG, High Affinity Ia, Receptor (CD64) Gene FCGR1A Gene CD64 FCGR1A This gene is involved in the immune response. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C104234 FCGR1A Gene FCGR2C_Gene Fc Fragment of IgG, Low Affinity IIc, Receptor for (CD32) (Gene/Pseudogene) Gene FCGR2C Gene FCGR2C This gene is involved in the initiation of host immune responses against pathogens and phagocytosis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C38556 FCGR2C Gene FCN1_Gene FCN1 Gene M-Ficolin FCNM Other designations: M-ficolin|collagen/fibrinogen domain-containing protein 1|ficolin (collagen/fibrinogen domain-containing) 1|ficolin-1|ficolin-A|ficolin-alpha http://purl.obolibrary.org/obo/OGG_3000002219 FCN1 Gene FGL2_Gene Fibrinogen Like 2 Gene FGL2 FGL2 Gene This gene may be involved in memory T-cell function. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C131280 FGL2 Gene FLT1_Gene FMS Related Tyrosine Kinase 1 Gene FLT1 FLT1 Gene This gene is involved in cellular proliferation, differentiation and tyrosine kinase signal transduction. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C18414 FLT1 Gene FLVCR1 AXPC1 MFSD7B PCARP PCA FLVCR1 Other designations: feline leukemia virus subgroup C receptor-related protein 1 http://purl.obolibrary.org/obo/OGG_3000028982 FLVCR1 Gene FN1_Gene Fibronectin 1 Gene FN1 FN1 Gene This gene is involved in several important cellular events such as cellular adhesion and migration processes. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C28574 FN1 Gene FTMT_Gene MTF FTMT Ferritin Other designations: ferritin H subunit|ferritin, mitochondrial|mitochondrial ferritin http://purl.obolibrary.org/obo/OGG_3000094033 FTMT Gene Fatty_Acid_2-Hydroxylase Fatty Acid Alpha-Hydroxylase EC 1.14.18.- Fatty Acid Hydroxylase Domain-Containing Protein 1 Fatty Acid 2-Hydroxylase Fatty Acid Hydroxylase FA2H FAAH Fatty acid 2-hydroxylase (372 aa, ~43 kDa) is encoded by the human FA2H gene. This protein plays a role in free fatty acid hydroxylation at the C-2 position yielding (R)-2-hydroxy fatty acids. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C189070 Fatty Acid 2-Hydroxylase Feline_Leukemia_Virus_Subgroup_C_Cellular_Receptor_1 Feline Leukemia Virus Subgroup C Cellular Receptor 1 FLVCR1 A protein coding gene FLVCR1 in human. http://purl.obolibrary.org/obo/HGNC_24682 Feline Leukemia Virus Subgroup C Cellular Receptor 1 Fentanyl N-(1-phenethylpiperidin-4-yl)-N-phenylpropionamide Abstral Duragesic FENTANYL Fentanyl A synthetic, lipophilic phenylpiperidine opioid agonist with analgesic and anesthetic properties. Fentanyl selectively binds to and activates the mu-receptor in the central nervous system (CNS) thereby mimicking the effects of endogenous opiates. Activation of the mu-subtype opioid receptor stimulates the exchange of GTP for GDP on the G-protein complex and subsequently inhibits adenylate cyclase. This causes a decrease in intracellular cAMP which inhibits cAMP-mediated calcium influx into the cell via the calcium channels and thereby results in hyperpolarization and reduced neuronal excitability. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C494 Fentanyl Ferritin Ferritin An iron protein complex, containing up to 23% iron, formed by the union of ferric iron with apoferritin; it is found in the intestinal mucosa, spleen, bone marrow, reticulocytes, and liver, and regulates iron storage and transport from the intestinal lumen to plasma. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16577 Ferritin Fibrinogen Fibrinogen A fibrillar protein present in blood plasma; it converts to fibrin during the process of blood clot formation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C25736 Fibrinogen Fibroleukin Fibrinogen-Like Protein 2 Fibroleukin pT49 FGL2 Fibroleukin (439 aa, ~50 kDa) is encoded by the human FGL2 gene. This protein may be involved in memory T-cell functionality. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C131282 Fibroleukin Fibronectin Large External Transformation-Sensitive Protein Fibronectin Cold-Insoluble Globulin Large, External, Transformation-Sensitive Protein LETS Protein Fibronectin 1 CIG FN FN1 FNZ LETS Fibronectin (2386 aa, ~263 kDa) is encoded by the human FN1 gene. This protein is involved in cell adhesion- and migration-dependent processes including embryogenesis, wound healing, blood coagulation, host defense, and metastasis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16581 Fibronectin Flucloxacillin Floxacillin FLUCLOXACILLIN 6-(3-(2-chloro-6-fluorophenyl)-5-methyl-4-isoxazolecarboxamido)-3,3-dimethyl-7-oxo-4-thia-1-azabicyclo(3.2.0)heptane-2-carboxylic Acid 3-(2-chloro-6-fluorophenyl)-5-methyl-4-isoxazolylpenicillin Flucloxacillin BRL 2039 A narrow-spectrum, semisynthetic isoxazolyl penicillin with antibacterial activity. Floxacillin binds to and inactivates penicillin-binding proteins (PBPs) located on the inner membrane of the bacterial cell wall. Inactivation of PBPs interferes with the cross-linkage of peptidoglycan chains necessary for bacterial cell wall strength and rigidity. This interrupts bacterial cell wall synthesis and results in the weakening of the bacterial cell wall, eventually causing cell lysis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C80591 Flucloxacillin Fluconazole fluconazole Fluconazole alpha-(2,4-difluorophenyl)-alpha- (1,2,4-triazol-1-ylmethyl)-1,2, 4- triazole-1-ethanol FLUCONAZOLE Diflucan A synthetic triazole with antifungal activity. Fluconazole preferentially inhibits fungal cytochrome P-450 sterol C-14 alpha-demethylation, resulting in the accumulation of fungal 14 alpha-methyl sterols, the loss of normal fungal sterols, and fungistatic activity. Mammalian cell demethylation is much less sensitive to fluconazole inhibition. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C500 Fluconazole Flurithromycin Flurithromycin 8-fluoro-erythromycin FLURITHROMYCIN 8-fluoroerythromycin P-0501A http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C65735 Flurithromycin Fondaparinux FONDAPARINUX Fondaparinux fondaparinux Natural Heparin Pentasaccharide ORG 31540 PENTA SR 90107 A synthetic glucopyranoside with antithrombotic activity. Fondaparinux selectively binds to antithrombin III, thereby potentiating the innate neutralization of activated factor X (Factor Xa) by antithrombin. Neutralization of Factor Xa inhibits its activity and interrupts the blood coagulation cascade, thereby preventing thrombin formation and thrombus development. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C73142 Fondaparinux Furosemide SK-Furosemide FRS FUROSEMIDE Furosemide LB 502 LB-502 Lasix A sulfamoylanthranilic acid derivative, also known as frusemide, and potent loop diuretic. Furosemide is widely used to treat hypertension and edema. This agent is highly bound to albumin and is largely excreted unchanged in the urine. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C515 Furosemide GAS6_Gene Growth Arrest-Specific 6 Gene GAS6 GAS6 Gene This gene is involved in both receptor binding and signal transduction. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C101629 GAS6 Gene GC_Gene Group-Specific Component (Vitamin D Binding Protein) Gene GC GC Gene This gene plays a role in vitamin D and plasma metabolite transport. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C38179 GC Gene GDF15_Gene Growth Differentiation Factor 15 Gene GDF15 GDF15 Gene This gene is involved in the regulation of tissue differentiation. It also plays a role in controlling the growth of granulocytes and macrophages. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C24679 GDF15 Gene GIMAP7_Gene IAN7 hIAN7 GIMAP7 Other designations: GTPase IMAP family member 7|IAN-7|immune associated nucleotide|immunity-associated nucleotide 7 protein http://purl.obolibrary.org/obo/OGG_3000168537 GIMAP7 Gene GPR174_Gene GPR174 Gene GPCR17 Other designations: probable G-protein coupled receptor 174 http://purl.obolibrary.org/obo/OGG_3000084636 GPR174 Gene GRN_Gene Granulin Gene GRN GRN Gene This gene is involved in inflammation, wound healing and cell proliferation and in the regulation of lysosomal function. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C101401 GRN Gene GSN_Gene Gelsolin Gene GSN GSN Gene This gene is involved in the regulation of actin filament polymerization. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C150249 GSN Gene GSR_Gene Glutathione-Disulfide Reductase Gene GSR GSR Gene This gene plays a role in glutathione metabolism. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C157040 GSR Gene GYPB_Gene Glycophorin B (MNS Blood Group) Gene GYPB GYPB Gene This gene is involved in the antigenic determination for the MN and Ss blood groups. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C190139 GYPB Gene G_PROTEIN-COUPLED_RECEPTOR_174 G PROTEIN-COUPLED RECEPTOR 174 GPR174 http://purl.bioontology.org/ontology/OMIM/300903 G PROTEIN-COUPLED RECEPTOR 174 Gabapentin 1-(aminomethyl)cyclohexaneacetic Acid GABAPENTIN Gabapentin Gralise Neurontin gabapentin A synthetic analogue of the neurotransmitter gamma-aminobutyric acid with anticonvulsant activity. Although its exact mechanism of action is unknown, gabapentin appears to inhibit excitatory neuron activity. This agent also exhibits analgesic properties. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C1108 Gabapentin Galectin-3 Carbohydrate-Binding Protein 35 Lectin L-29 IgE-Binding Protein 35 kDa Lectin Mac-2 Antigen Galactose-Specific Lectin 3 Galactoside-Binding Protein Laminin-Binding Protein CBP 35 GALBP Gal-3 Galectin-3 L-31 LGALS3 Galectin-3 (250 aa, ~26 kDa) is encoded by the human LGALS3 gene. This protein plays a role in both antibody-mediated immunity and carbohydrate binding. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C104859 Galectin-3 Gamma-Enolase Neuron-Specific Enolase 2-Phospho-D-Glycerate Hydro-Lyase Neural Enolase Phosphopyruvate Hydratase EC 4.2.1.11 Gamma-Enolase ENO2 Enolase 2 NSE Gamma-enolase (434 aa, ~47 kDa) is encoded by the human ENO2 gene. This protein is involved in glycolysis, neurotrophy and neuroprotection. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C62216 Gamma-Enolase Gelsolin Actin-Depolymerizing Factor ADF AGEL Brevin GSN Gelsolin Gelsolin (782 aa, ~86 kDa) is encoded by the human GSN gene. This protein is involved in the modulation of actin filament polymerization. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C150253 Gelsolin Gentamicin Gentamycin Complex Genoptic S.O.P. GENTAMICIN Garamicin Garamycin Genoptic Gentamicin Gentamycin U-Gencin A broad-spectrum aminoglycoside antibiotic produced by fermentation of Micromonospora purpurea or M. echinospora. Gentamicin is an antibiotic complex consisting of four major (C1, C1a, C2, and C2a) and several minor components. This agent irreversibly binds to the bacterial 30S ribosomal subunit. Specifically, this antibiotic is lodged between 16S rRNA and S12 protein within the 30S subunit. This leads to interference with translational initiation complex, misreading of mRNA, thereby hampering protein synthesis and resulting in bactericidal effect. Aminoglycosides are mostly ineffective against anaerobic bacteria, fungi and viruses. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C519 Gentamicin Glycophorin-B Glycophorin B Sialoglycoprotein Delta Glycophorin-B SS-Active Sialoglycoprotein Glycophorin B Blood Group Antigen CD235b Antigen CD235b GYPB PAS-3 Glycophorin-B (91 aa, ~10 kDa) is encoded by the human GYPB gene. This protein is involved in the antigenic determination of the Ss blood group. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C190144 Glycophorin-B Growth_Arrest-Specific_Protein_6 Growth Arrest-Specific Protein 6 AXL Receptor Tyrosine Kinase Ligand AXL Stimulatory Factor GAS-6 GAS6 Growth arrest-specific protein 6 (721 aa, ~80 kDa) is encoded by the human GAS6 gene. This protein is involved in the modulation of receptor tyrosine kinase-dependent signaling. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C101631 Growth Arrest-Specific Protein 6 HAMP_Gene Hepcidin Antimicrobial Peptide Gene HAMP HAMP Gene This gene is involved in both iron metabolism and antimicrobial activity. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C104271 HAMP Gene HGF_Gene Hepatocyte Growth Factor Gene HGF HGF Gene This gene plays a role in cellular communication, growth, proliferation, migration and motility. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C24467 HGF Gene HLA-DQB2_Gene HLA-DQB2 Gene Major Histocompatibility Complex, Class II, DQ Beta 2 Gene HLA-DQB2 This gene is involved in the mediation of antigen presentation. http://purl.obolibrary.org/obo/OGG_3000003120 HLA-DQB2 Gene HLA-DRA_Gene Major Histocompatibility Complex, Class II, DR Alpha Gene HLA-DRA Gene HLA-DRA This gene plays a role in antigen presentation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C101157 HLA-DRA Gene HLA-DR_Antigen Human Leukocyte Antigen-DR Isotype Human Leukocyte Antigen - DR Isotype HLA-DR Antigen HLA-DR Encoded by multiple HLA-DRA and HLA-DRB genes in a complex variable 5 cM region of MHC between HLA-B and -D, HLA-DR Antigens are Class II histocompatibility transmembrane glycoprotein heterodimers of alpha (heavy, 35-kD) and beta (light, 27-kD) chains. Located predominantly on B cells and macrophages, HLA-DR antigens function in antigen presentation to regulatory T cells in the immune response and in self/nonself discrimination. Invariant alpha and polymorphic beta chains have glycosylated N-termini, hydrophobic membrane regions, and hydrophilic C-termini. The heterodimer consists of 4 extracellular domains; invariant alpha-1, polymorphic N-terminal beta-1, and conserved Ig-like alpha-2 and beta-2. Alpha-1 and alpha-2 contain disulfide loops. Beta-1 contains 2 small variable regions. Alpha sequences have relatively simple structure; beta chains carry the major polymorphic determinants. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16692 HLA-DR Antigen HLA-G_Gene Major Histocompatibility Complex, Class I, G Gene HLA-G HLA-G Gene This gene is involved in antigen processing and presentation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C104316 HLA-G Gene HLA_Class_II_Histocompatibility_Antigen_Gamma_Chain CD74 Antigen HLA-DR Antigens-Associated Invariant Chain HLA Class II Histocompatibility Antigen Gamma Chain CD Antigen CD74 Ia Antigen-Associated Invariant Chain CD74 Ii p33 HLA class II histocompatibility antigen gamma chain (296 aa, ~34 kDa) is encoded by the human CD74 gene. This protein plays a role in MHC class II-dependent immunity. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C97420 HLA Class II Histocompatibility Antigen Gamma Chain HLA_DQ_Beta_2_Histocompatibility_Antigen HLA DQ Beta 2 Histocompatibility Antigen HLA-DQB 2 Antigen Measurement HLA DQ Beta 2 Antigen HLADQB2 A protein coding gene HLA-DQB2 in human. http://purl.obolibrary.org/obo/HGNC_4945 HLA DQ Beta 2 Histocompatibility Antigen HMGB1_Gene High-Mobility Group Box 1 Gene HMGB1 HMGB1 Gene This gene plays a role in chromatin remodeling, signal transduction and the regulation of gene transcription. It is also involved in the pro-inflammatory response. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20578 HMGB1 Gene HMOX1_Gene Heme Oxygenase (Decycling) 1 Gene HMOX1 HMOX1 Gene This gene is involved in heme catabolism and cellular homeostasis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C43314 HMOX1 Gene HP_Gene Haptoglobin Gene HP HP Gene This gene plays a role in hemoglobin interactions and in the prevention of oxidative tissue damage. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C39296 HP Gene Haptoglobin Haptoglobin HP Zonulin Haptoglobin (406 aa, ~45 kDa) is encoded by the human HP gene. This protein plays a role in tight junction disassembly, intestinal permeability, heme iron recycling, antimicrobial activity and the regulation of hydrogen peroxide catabolism. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C37962 Haptoglobin Heat_Shock_Protein_70 Heat Shock Protein Family A 70-kDa Heat Shock Protein 70-kD Heat-Shock Protein Heat Shock Protein 70 70-kD Heat Shock Protein HSP 70 HSP-70 HSP70 HSPA A family of structurally related proteins that are involved in both protein folding and cellular stress responses. The members of this family are approximately 70 kDa. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C17765 Heat Shock Protein 70 Heme_Oxygenase_1 Heme Oxygenase 1 EC 1.14.99.3 Heme Oxygenase (Decyclizing) HMOX1 HO1 Heme oxygenase 1 (288 aa, ~33 kDa) is encoded by the human HMOX1 gene. This protein is involved in heme metabolism. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C43318 Heme Oxygenase 1 Heparin Unfractionated Heparin Unfractionated heparin HEPARIN Heparin UFH heparin A sulfur-rich glycosaminoglycan with anticoagulant property. Heparin binds to antithrombin III to form a heparin-antithrombin III complex. The complex binds to and irreversibly inactivates thrombin and other activated clotting factors, such as factors IX, X, XI, and XII, thereby preventing the polymerization of fibrinogen to fibrin and the subsequent formation of clots. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C539 Heparin Hepatocyte_Growth_Factor Lung Fibroblast-Derived Mitogen Fibroblast-Derived Tumor Cytotoxic Factor Scatter Factor Hepatopoietin A Hepatocyte Growth Factor HGF HGF/SF SF Hepatocyte growth factor (728 aa, ~83 kDa) is encoded by the human HGF gene. This protein is involved in both the modulation of hepatocyte proliferation and growth factor receptor signaling in hepatocytes and many other cell types. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20428 Hepatocyte Growth Factor Hepcidin Liver-Expressed Antimicrobial Peptide 1 Putative Liver Tumor Regressor HAMP Hepcidin LEAP-1 PLTR Hepcidin (84 aa, ~9 kDa) is encoded by the human HAMP gene. This protein is involved in antimicrobial activity and iron absorption and storage. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C104274 Hepcidin High_Affinity_Immunoglobulin_Gamma_Fc_Receptor_I Fc Gamma Receptor I A1 Fc-Gamma RI Fc Gamma Receptor IgG Fc Receptor I Fc-Gamma RIA CD64 Antigen High Affinity Immunoglobulin Gamma Fc Receptor I CD64 FCGR1A High affinity immunoglobulin gamma Fc receptor I (374 aa, ~43 kDa) is encoded by the human FCGR1A gene. This protein is involved in the immune response and signal transduction. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C104238 High Affinity Immunoglobulin Gamma Fc Receptor I High_Mobility_Group_Protein_B1 High Mobility Group Protein B1 High-Mobility Group (Nonhistone Chromosomal) Protein 1 High Mobility Group Protein 1 High-Mobility Group Box 1 Chromosomal Protein, Nonhistone, HMG1 Nonhistone Chromosomal Protein HGM1 Sulfoglucuronyl Carbohydrate Binding Protein Amphoterin HMG 1 HMG-1 HMG1 HMG3 HMGB1 SBP-1 High mobility group protein B1 (215 aa, ~25 kDa) is encoded by the human HMGB1 gene. This protein is involved in the regulation of both chromatin structure and DNA topology. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20328 High Mobility Group Protein B1 Histone_H2B HISTONE H2B Histone H2B H2B Histone H2B is a core subunit of the eukaryotic nucleosome complex. Histones are basic nuclear proteins responsible for the nucleosome structure of chromatin. Repeating nucleosome units contain two molecules each of Histones H2A, H2B, H3, and H4 that form an octamer complex around which approximately 146 base pairs of DNA is wrapped. Linker Histone H1 interacts with DNA between nucleosome units in mediating chromatin compaction into higher order structures. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C17460 Histone H2B Hydrochlorothiazide 6-Chloro-3,4-dihydro-2H-1,2,4-benzothiadiazine-7-sulfonamide 1,1-dioxide Hydrodiuril HYDROCHLOROTHIAZIDE Hydrochlorothiazide A short acting thiazide diuretic. Hydrochlorothiazide (HCTZ) is widely used to treat hypertension and edema. This agent's metabolite appears to preferentially bind to and accumulate in red blood cells. This agent is primarily excreted by the kidneys. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C29098 Hydrochlorothiazide Hydroxychloroquine hydroxychloroquine HYDROXYCHLOROQUINE Hydroxychloroquine A 4-aminoquinoline with immunosuppressive, antiautophagy, and antimalarial activities. Although the precise mechanism of action is unknown, hydroxychloroquine may suppress immune function by interfering with the processing and presentation of antigens and the production of cytokines. As a lysosomotropic agent, hydroxychloroquine raises intralysosomal pH, impairing autophagic protein degradation; hydroxychloroquine-mediated accumulation of ineffective autophagosomes may result in cell death in tumor cells reliant on autophagy for survival. In addition, this agent is highly active against the erythrocytic forms of P. vivax and malariae and most strains of P. falciparum but not the gametocytes of P. falciparum. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C557 Hydroxychloroquine ICAM1_Gene Intercellular Adhesion Molecule 1 Gene ICAM1 ICAM1 Gene CD54 This gene is involved in mediating integrin-binding interactions that result in cellular adhesion. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C21006 ICAM1 Gene IFIT2_Gene ISG54 ISG-54 K IFI54 IFIT-2 GARG-39 IFI-54K P54 cig42 IFI-54 G10P2 ISG-54K Other designations: Interferon, alpha-inducible protein (MW 54kD)|interferon-induced 54 kDa protein|interferon-induced protein 54 http://purl.obolibrary.org/obo/OGG_3000003433 IFIT2 Gene IFNL2_Gene Interferon, Lambda 2 Gene IFNL2 IFNL2 Gene IL-28A IL28A This gene is involved in both immunomodulation and antiviral responses. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C104347 IFNL2 Gene IFNL3_Gene Interferon, Lambda 3 Gene IFNL3 IFNL3 Gene IL28B IL-28B This gene plays a role in cytokine signaling. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C106355 IFNL3 Gene IL10_Gene Interleukin 10 Gene IL10 IL10 Gene This gene plays an anti-inflammatory role in immune processes and is involved in a variety of diseases. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C28600 IL10 Gene IL12A_Gene Interleukin 12A (Natural Killer Cell Stimulatory Factor 1, Cytotoxic Lymphocyte Maturation Factor 1, P35) Gene IL12A IL12A Gene This gene plays a role in immunity/defense via the stimulation of both T cells and natural killer cells. It is also involved in cell differentiation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C24494 IL12A Gene IL12B_Gene Interleukin 12B Gene IL12B IL12B Gene This gene is involved in immunity/defense via the stimulation of both T cells and natural killer cells. It also plays a role in cell differentiation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C24495 IL12B Gene IL15_Gene Interleukin 15 Gene IL15 IL15 Gene This gene is involved in the regulation of memory T cells and cytokine production. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C28604 IL15 Gene IL18_Gene Interleukin 18 Gene IL18 IL18 Gene This gene is involved in the induction and regulation of pro-inflammatory cytokines. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C28609 IL18 Gene IL1B_Gene Interleukin 1, Beta Gene IL1B IL1B Gene This gene is involved in the mediation of acute phase inflammatory responses. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C28593 IL1B Gene IL1RN_Gene Interleukin 1 Receptor Antagonist Gene IL1RN IL1RN Gene IL1RA This gene is involved in the inhibition of signaling. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C98164 IL1RN Gene IL23A_Gene Interleukin 23, Alpha Subunit p19 Gene IL23A IL23A Gene IL23 This gene plays a role in transcriptional regulation and in the production of interferon-gamma. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61150 IL23A Gene IL27_Gene Interleukin 27 Gene IL27 IL27 Gene This gene is involved in the modulation of cytokine expression and B- and T-cell activities. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C117085 IL27 Gene IL2RA_Gene Interleukin 2 Receptor Subunit Alpha Gene IL2RA IL2RA Gene This gene plays a role in clathrin-independent endocytosis and immune functions. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C21563 IL2RA Gene IL6_Gene Interleukin 6 Gene IL6 IL6 Gene This gene is involved in immunoregulation processes by activating a cell-surface signaling assembly of proteins. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C24504 IL6 Gene IL8_Gene LUCT MONAP MDNCF LYNAP GCP1 NAF LECT GCP-1 NAP1 NAP-1 CXCL8 IL8 IL-8 Other designations: T-cell chemotactic factor|alveolar macrophage chemotactic factor I|beta endothelial cell-derived neutrophil activating peptide|beta-thromboglobulin-like protein|chemokine (C-X-C motif) ligand 8|emoctakin|granulocyte chemotactic protein 1|interleukin-8|lung giant cell carcinoma-derived chemotactic protein|lymphocyte derived neutrophil activating peptide|monocyte-derived neutrophil chemotactic factor|monocyte-derived neutrophil-activating peptide|neutrophil-activating peptide 1|small inducible cytokine subfamily B, member 8|tumor necrosis factor-induced gene 1 http://purl.obolibrary.org/obo/OGG_3000003576 IL8 Gene IL9_Gene Interleukin 9 Gene IL9 IL9 Gene This gene plays a role in inflammatory processes and has been implicated in the pathogenesis of asthma. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C28599 IL9 Gene IRAK3_Gene Interleukin 1 Receptor Associated Kinase 3 Gene IRAK3 IRAK3 Gene This gene is involved in signal transduction and the immune response. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C24519 IRAK3 Gene ITGAM_Gene CD11b Integrin, Alpha M (Complement Component 3 Receptor 3 Subunit) Gene ITGAM ITGAM Gene This gene plays a role in extracellular matrix interactions and cellular adhesion. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C21162 ITGAM Gene ITGAX_Gene CD11c Integrin, Alpha X (Complement Component 3 Receptor 4 Subunit) Gene ITGAX ITGAX Gene This gene is involved in the initiation of immune cell chemotaxis and phagocytosis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C28529 ITGAX Gene ITLN1_Gene Intelectin 1 (Galactofuranose Binding) Gene ITLN1 ITLN1 Gene Omentin-1 Omentin This gene is involved in the modulation of insulin-dependent signaling. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C124076 ITLN1 Gene Imipenem 1-Azabicyclo(3.2.0)hept-2-ene-2-carboxylic Acid, 6-(1-Hydroxyethyl)-3-((2-((iminomethyl)amino)ethyl)thio)-7-oxo-, Monohydrate, (5R-(5alpha,6alpha(R*)))- IMIPENEM Imipemide Imipenem MK-0787 imipenem A broad-spectrum, semi-synthetic beta-lactam carbapenem derived from thienamycin, produced by Streptomyces cattleya. Imipenem binds to and inactivates penicillin-binding proteins (PBPs) located on the inner membrane of the bacterial cell wall. PBPs are enzymes that are involved in the last stages of assembling the bacterial cell wall and in reshaping the cell wall during growth and division. This inactivation results in the weakening of the bacterial cell wall and eventually causes cell lysis. Imipenem has the greatest affinity for PBP 1A, 1B, and 2, and its lethal effect is related to binding to PBP 2 and 1B. This antibiotic is active against a wide range of gram-positive and gram-negative organisms and is stable in the presence of beta-lactamases. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C570 Imipenem Indapamide INDAPAMIDE Indapamide Lozol An indole derivative of chlorosulphonamide and a sulfamyl diuretic with antihypertensive activity. Indapamide may interact directly with the subunits of delayed rectifier potassium channels, thereby blocking both slow and rapid K+ (IKs and IKr) currents through the channels. Through the homeostasis mechanism in balancing total ion concentration (Ca++, Na+), it reduces vascular hyperreactivity and peripheral and arterial vascular resistance, possibly by inhibiting transmembrane ionic influx, probably calcium ions, and stimulating prostaglandin E2 synthesis, thereby causing vasodilatation. Indapamide exerts its diuretic effect by inhibiting reabsorption of sodium and chloride, primarily as a result of action on the cortical diluting segment of the renal distal tubule, thereby promoting urinary excretion of water and electrolytes. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C29119 Indapamide Integrin_Alpha-M CR-3 Alpha Chain CD11 Antigen-Like Family Member B Integrin Alpha-M Integrin Alpha M Neutrophil Adherence Receptor Neutrophil Adherence Receptor Alpha-M Subunit Cell Surface Glycoprotein MAC-1 Subunit Alpha Leukocyte Adhesion Receptor MO1 Macrophage Antigen Alpha Polypeptide Complement Receptor Type 3, Alpha Subunit CD11b Antigen CD11b ITGAM MAC1 Alpha MO1 Alpha Integrin alpha-M (1152 aa, ~127 kDa) is encoded by the human ITGAM gene. This protein is involved in both leukocyte adhesion and the phagocytosis of complement coated particles. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C17373 Integrin Alpha-M Integrin_Alpha-X p150 95 Integrin Alpha Chain Leukocyte Adhesion Glycoprotein P150,95, Alpha Chain Leukocyte Adhesion Receptor P150,95 CD11 Antigen-Like Family Member C Leukocyte Surface Antigen P150, 95 Integrin Alpha X Integrin Alpha-X Antigen Cd11c (P150), Alpha Polypeptide Myeloid Membrane Antigen, Alpha Subunit Alphax Integrin Chain Axb2 CD11c Cr4 ITGAX Leu M5 Integrin alpha-X (1163 aa, ~128 kDa) is encoded by the human ITGAX gene. This protein is involved in cell-matrix interactions and integrin signaling. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16789 Integrin Alpha-X Intelectin-1 Endothelial Lectin HL-1 Intestinal Lactoferrin Receptor Intelectin 1 Intelectin-1 Galactofuranose-Binding Lectin Lactoferrin Receptor ITLN1 Intelectin Omentin-1 Omentin Intelectin-1 (313 aa, ~35 kDa) is encoded by the human ITLN1 gene. This protein is involved in the enhancement of insulin-dependent signaling. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C124078 Intelectin-1 Intercellular_Adhesion_Molecule_1 Intercellular Adhesion Molecule-1 Human Rhinovirus Receptor Major Group Rhinovirus Receptor Intercellular Adhesion Molecule 1 CD54 Antigen CD54 ICAM-1 ICAM1 Intercellular adhesion molecule 1 (532 aa, ~58 kDa) is encoded by the human ICAM1 gene. This protein plays a role in integrin binding, immune signaling and leukocyte transendothelial migration. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C17304 Intercellular Adhesion Molecule 1 Interferon Human Fibroblast Interferon Human Lymphoblastoid Interferon Human Leukocyte Interferon IFN Interferon interferon Human interferons have been classified into 3 groups: alpha, beta, and gamma. Both alpha- and beta-IFNs, previously designated type I, are acid-stable, but they differ immunologically and in regard to some biologic and physiochemical properties. The IFNs produced by virus-stimulated leukocytes (leukocyte IFNs) are predominantly of the alpha type. Those produced by lymphoblastoid cells are about 90% alpha and 10% beta. Induced fibroblasts produce mainly or exclusively the beta type. The alpha- and beta-IFNs differ widely in amino acid sequence. The gamma or immune IFNs, which are produced by T lymphocytes in response to mitogens or to antigens to which they are sensitized, are acid-labile and serologically distinct from alpha- and beta-IFNs. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20493 Interferon Interferon-induced_Protein_with_Tetratricopeptide_Repeats_2 Interferon-induced Protein with Tetratricopeptide Rrepeats 2 IFIT2 A protein coding gene IFIT2 in human. http://purl.obolibrary.org/obo/HGNC_5409 Interferon-induced Protein with Tetratricopeptide Rrepeats 2 Interferon_Lambda-2 Cytokine Zcyto20 IFN-Lambda-2 Interleukin-28A Interferon Lambda-2 Interferon-Lambda 2 Interferon Lambda 2 Interferon-Lambda-2 IFNL2 IL-28A Interferon lambda-2 (200 aa, ~22 kDa) is encoded by the human IFNL2 gene. This protein is involved in both cytokine-mediated signaling and antiviral activity. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C104349 Interferon Lambda-2 Interferon_Lambda-3 IFN-Lambda-3 Interleukin-28B Interleukin-28C Interferon Lambda-4 Interferon Lambda-3 IFN-Lambda-4 Cytokine Zcyto22 Interferon-Lambda 3 Interferon Lambda 3 Interferon-Lambda-3 IFNL3 IL-28B IL-28C Interferon lambda-3 (196 aa, ~22 kDa) is encoded by the human IFNL3 gene. This protein plays a role in cytokine signaling. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C106357 Interferon Lambda-3 Interleukin-10 T-Cell Growth Inhibitory Factor Interleukin-10 Cytokine Synthesis Inhibitory Factor Interleukin 10 interleukin-10 CSIF IL-10 IL10 TGIF Interleukin-10 (178 aa, ~21 kDa) is encoded by the human IL10 gene. This protein plays a role in the negative regulation of cytokine expression. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20512 Interleukin-10 Interleukin-12 Natural Killer Cell Stimulatory Factor Interleukin-12 Cytotoxic Lymphocyte Maturation Factor Interleukin 12 CLMF IL-12 IL-12 p70 IL-12p70 IL12 NKSF Exhibiting a broad range of biological activities on T and natural killer cells, Interleukin-12 is a disulfide-bonded heterodimeric cytokine composed of a 35-kD IL12A subunit (IL-6 Superfamily) and a 40-kDa IL12B subunit (Type I Cytokine Receptor 3 Family). IL12 stimulates T-cell-independent production of IFN-gamma by PBMCs, enhances NK cell lytic activity, acts as a growth factor for T- and NK-cells, and is important for Th1 and Th2 cell differentiation. Lymphocyte responses to IL12 require NOS2A and are mediated by STAT4 activator of transcription. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20514 Interleukin-12 Interleukin-15 Interleukin-15 Interleukin 15 Interleukin-15 Precursor IL15 Protein IL-15 IL15 MGC9721 Interleukin-15 (162 aa, ~18 kDa) is encoded by the human IL15 gene. This protein plays a role in the regulation of both proliferation and activation of both T-cells and natural killer cells. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20517 Interleukin-15 Interleukin-18 Interferon Gamma-Inducing Factor Interleukin-18 Precursor Interleukin-18 Interleukin 18 Proprotein IFN-gamma-Inducing Factor Interferon-Gamma-Inducing Factor Interleukin 18 IL18 Protein Interferon-Gamma Inducing Factor Interleukin-1 Gamma IGIF IL-1 Gamma IL-18 IL-1g IL18 IL1F4 Interleukin-18 (193 aa, ~22 kDa) is encoded by the human IL18 gene. This protein is involved in the regulation of both natural killer cell activity and the production of interferon gamma. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20520 Interleukin-18 Interleukin-1_Beta Interleukin 1-Beta Preinterleukin 1 Beta interleukin-1-beta Interleukin-1-Beta Interleukin 1, Beta Proprotein Interleukin 1, Beta IL1B Protein Interleukin-1 Beta Catabolin IL-1 Beta IL-1-b IL-1-beta IL-1B IL1-Beta IL1B IL1F2 Interleukin-1 beta (269 aa, ~31 kDa) is encoded by the human IL1B gene. This protein is involved in the macrophage-dependent inflammatory response. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20522 Interleukin-1 Beta Interleukin-1_Receptor-Associated_Kinase_3 Interleukin-1 Receptor-Associated Kinase M Interleukin-1 Receptor-Associated Kinase 3 Interleukin 1 Receptor-Associated Kinase M EC 2.7.11.1 Interleukin 1 Receptor-Associated Kinase 3 IL-1 Receptor-Associated Kinase M IRAK-3 IRAK-M IRAK3 IRAKM Interleukin-1 receptor-associated kinase 3 (596 aa, ~68 kDa) is encoded by the human IRAK3 gene. This protein plays a role in the negative regulation of toll-like receptor signaling http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C29751 Interleukin-1 Receptor-Associated Kinase 3 Interleukin-1_Receptor_Antagonist_Protein Interleukin-1 receptor antagonist protein (177 aa, ~20 kDa) is encoded by the human IL1RN gene. This protein is involved in the inhibition of the interaction between interleukin-1 and its receptor. Intracellular Interleukin-1 Receptor Antagonist Interleukin-1 Receptor Antagonist Protein Intracellular IL-1 Receptor Antagonist Type II IL1 Inhibitor ICIL-1RA IL-1RN IL-1ra IL1RA IL1RN IRAP http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C98166 Interleukin-1 Receptor Antagonist Protein Interleukin-23 Interleukin-23 Interleukin 23 IL-23 IL23 A heterodimeric cytokine composed of interleukin-12 subunit beta and interleukin-23 subunit alpha. This complex binds to the interleukin-23 receptor complex, which activates the JAK-STAT signaling pathway and modulates the proliferation, differentiation and effector functions of T-lymphocytes, natural killer cells and some myeloid lineage cells. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C147535 Interleukin-23 Interleukin-27 Interleukin-27 Interleukin 27 IL-27 IL27 A heterodimeric cytokine that is comprised of interleukin-27 subunits alpha and beta. This protein complex is involved in the regulation of B- and T-lymphocyte activities. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C118114 Interleukin-27 Interleukin-2_Receptor_Subunit_Alpha Interleukin-2 Receptor Alpha Chain IL-2 Receptor Interleukin-2 Receptor Subunit Alpha Low Affinity Interleukin 2 Receptor Interleukin 2 Receptor, Alpha IL-2R Subunit Alpha IL2 Receptor IL-2 Receptor Subunit Alpha Interleukin 2 Receptor T-Cell Growth Factor Receptor TAC Antigen CD25 IL-2-RA IL-2R IL2-RA IL2R IL2RA p55 Interleukin-2 receptor subunit alpha (272 aa, ~31 kDa) is encoded by the human IL2RA gene. This protein plays a role in interleukin-2-dependent signaling. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C17073 Interleukin-2 Receptor Subunit Alpha Interleukin-6 IL6 Protein Interleukin BSF-2 Plasmacytoma Growth Factor Hepatocyte Stimulatory Factor Myeloid Differentiation Inducing Protein B-Cell Stimulatory Factor-2 Interleukin 6 B Cell Differentiation Factor 2 Hybridoma Growth Factor Interferon Beta-2 interleukin-6 Hepatocyte Stimulating Factor B-Cell Differentiation Factor CTL Differentiation Factor B-Cell Stimulatory Factor 2 Interferon, Beta-2 Interleukin-6 BSF-2 BSF2 CDF HGF HPGF HSF IFN Beta 2 IFN-Beta-2 IFNB2 IL-6 IL6 Sigosix Interleukin-6 (212 aa, ~24 kDa) is encoded by the human IL6 gene. This protein is involved in signaling affecting a wide variety of cell types including monocytes, lymphocytes, hepatocytes and nerve cells. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20451 Interleukin-6 Interleukin-8 T-Cell Chemotactic Factor Lymphocyte Derived Neutrophil Activating Peptide Granulocyte Chemotactic Peptide Interleukin 8 Macrophage-Derived Chemotactic Factor Anionic Neutrophil Activating Peptide Lung Giant Cell Carcinoma-Derived Chemotactic Protein Neutrophil-Activating Protein 1 Granulocyte Chemotactic Protein Interleukin 8 C-X-C Motif Chemokine 8 Beta Endothelial Cell-Derived Neutrophil Activating Peptide Beta-Thromboglobulin-Like Protein Monocyte-Derived Neutrophil Chemotactic Factor Leukocyte Adhesion Inhibitor Neutrophil Activation Factor Anionic Neutrophil-Activating Peptide Neutrophil Chemotactic Factor Protein 3-10C Neutrophil-Activating Peptide 1 Monocyte-Derived Neutrophil-Activating Peptide Neutrophil Activation Peptide Interleukin-8 Alveolar Macrophage Chemotactic Factor I CXCL8 GCP-1 GCP-IL-8 IL-8 IL8 MDNCF MONAP NAP-1 Interleukin-8 (99 aa, ~11 kDa) is encoded by the human CXCL8 gene. This protein is involved in chemotaxis and neutrophil activation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20473 Interleukin-8 Interleukin-9 Interleukin 9 Interleukin 9 Precursor IL9 Protein P40 T-Cell and Mast Cell Growth Factor p40 Protein P40 T-Cell Growth Factor T-Cell Growth Factor p40 p40 Cytokine T-Cell/Mast Cell Growth Factor p40 Homolog of Mouse T Cell and Mast Cell Growth Factor 40 Cytokine P40 Interleukin-9 HP40 IL-9 IL9 p40 Interleukin-9 (144 aa, ~16 kDa) is encoded by the human IL9 gene. This protein plays a role in the growth of helper T-cells. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20511 Interleukin-9 Isoproterenol Isoproterenol ISOPROTERENOL A synthetic catechol compound and potent beta adrenergic agonist with peripheral vasodilator, bronchodilator, and cardiac stimulating properties. Isoproterenol exerts its effect on the beta-1 adrenergic receptors in the myocardium, thereby increasing heart rate and cardiac output. In addition, isoproterenol acts on beta-2 adrenergic receptors in bronchiolar and vascular smooth muscle, thereby causing smooth muscle relaxation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C62041 Isoproterenol Itraconazole Oriconazole (+-)-1-sec-Butyl-4-(p-(4-(p-(((2R*,4S*)-2-(2,4-dichlorophenyl)-2-(1H-1,2,4-triazol-1-ylmethyl)-1,3-dioxolan-4-yl)methoxy)phenyl)-1-piperazinyl)phenyl)-delta(sup2)-1,2,4-triazolin-5-one itraconazole Itraconazole ITRACONAZOLE Lozanoc R 51,211 Sporanox A synthetic triazole agent with antimycotic properties. Formulated for both topical and systemic use, itraconazole preferentially inhibits fungal cytochrome P450 enzymes, resulting in a decrease in fungal ergosterol synthesis. Because of its low toxicity profile, this agent can be used for long-term maintenance treatment of chronic fungal infections. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C1138 Itraconazole Ivermectin Avermectin A1a, 5-O-demethyl-25-de(1-methylpropyl)-22,23-dihydro-25-(1-methylethyl)- IVERMECTIN Ivermectin Sklice Stromectol An orally bioavailable macrocyclic lactone derived from Streptomyces avermitilis, with antiparasitic and potential anti-viral activities. Upon administration, ivermectin exerts its anthelmintic effect through binding and activating glutamate-gated chloride channels (GluCls) expressed on nematode neurons and pharyngeal muscle cells. This causes increased permeability of chloride ions, causing a state of hyperpolarization and results in the paralysis and death of the parasite. Ivermectin may exerts its antiviral effect, including its potential activity against severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2), by binding to the importin (IMP) alpha/beta1 heterodimer, which is responsible for the nuclear import of viral proteins such as the integrase (IN) protein. This inhibits nuclear import of host and viral proteins and may inhibit viral replication. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61796 Ivermectin KCNQ1OT1_Gene KCNQ1 Opposite Strand/Antisense Transcript 1 (Non-Protein Coding) Gene KCNQ1OT1 Gene KCNQ1OT1 This gene plays a role in the epigenetic regulation of gene transcription. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C114316 KCNQ1OT1 Gene KDR_Gene Kinase Insert Domain Receptor Gene KDR KDR Gene VEGFR2 This gene plays a role in angiogenesis and vascular regulation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C24532 KDR Gene KLRK1_Gene Killer Cell Lectin-Like Receptor Subfamily K, Member 1 Gene KLRK1 KLRK1 Gene NKG2D Gene This gene plays a role in the activation of natural killer cells. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C101750 KLRK1 Gene KRT18_Gene Keratin 18 Gene KRT18 KRT18 Gene CK18 CK-18 This gene plays a role in keratin filament structure. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C111866 KRT18 Gene Kanamycin Kanamycin Complex KANAMYCIN Kanamycin An aminoglycoside antibiotic with antimicrobial property. Amikacin irreversibly binds to the bacterial 30S ribosomal subunit, specifically in contact with 16S rRNA and S12 protein within the 30S subunit. This leads to interference with translational initiation complex and, misreading of mRNA, thereby hampering protein synthesis and resulting in bactericidal effect. This agent is usually used for treatment of E. coli, Proteus species (both indole-positive and indole-negative), E. aerogenes, K. pneumoniae, S. marcescens, and Acinetobacter species. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C65997 Kanamycin Ketamine KETAMINE Ketamine ketamine A cyclohexanone derivative with analgesic and anesthetic properties. Although its mechanism of action is not well understood, ketamine appears exerts complex pharmacological actions including inhibition of biogenic amine uptake, binding to opioid receptors, and inhibition of N-methyl D-aspartate (NMDA) receptors. Because of the involvement of spinal NMDA receptors in the process of central sensitization, this agent may reduce pain perception and induce sedation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61797 Ketamine Ketoconazole Ketoconazole Cis-1-Acetyl-4-[4-[[2-(2,4-dichlorophenyl)-2-(1H-imidazole-1-ylmethyl)-1,3-dioxolan-4-yl]methoxy]phenyl]piperazine Orifungal M ketoconazole KETOCONAZOLE Fungarest Fungoral Ketoderm Ketoisdin Nizoral Panfungol R-41400 Xolegel A synthetic derivative of phenylpiperazine with broad antifungal properties and potential antineoplastic activity. Ketoconazole inhibits sterol 14-a-dimethylase, a microsomal cytochrome P450-dependent enzyme, thereby disrupting synthesis of ergosterol, an important component of the fungal cell wall. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C605 Ketoconazole LBP_Gene Lipopolysaccharide Binding Protein Gene LBP LBP Gene This gene plays a role in anti-bacterial response. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C105865 LBP Gene LCN2_Gene Lipocalin 2 Gene LCN2 LCN2 Gene This gene may play a role in both the transport of hydrophobic molecules and the mediation of inflammation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C71435 LCN2 Gene LEP_Gene Leptin Gene LEP LEP Gene This gene plays a role in the modulation of appetite and the regulation of body fat storage. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C95047 LEP Gene LGALS3_Gene LGALS3 Gene Lectin, Galactoside-Binding, Soluble, 3 Gene LGALS3 This gene plays a role in carbohydrate binding. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C104857 LGALS3 Gene LILRA5_Gene IMMUNOGLOBULIN-LIKE TRANSCRIPT 11 CD85F LIR9 ILT11 LILRA5 LEUKOCYTE IMMUNOGLOBULIN-LIKE RECEPTOR 9 This gene is involved in immunity. http://purl.bioontology.org/ontology/OMIM/606047 LILRA5 Gene LPA_Gene Lipoprotein(a) Gene LPA LPA Gene This gene is involved in lipid metabolism, proteolysis and the inhibition of tissue-type plasminogen activator. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C140116 LPA Gene LRG1_Gene Leucine Rich Alpha-2-Glycoprotein 1 Gene LRG1 LRG1 Gene This gene plays a role in protein-protein interaction, signal transduction, cell adhesion and granulocyte differentiation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C189799 LRG1 Gene Lactadherin Sperm Surface Protein HP47 Lactadherin Precursor Secreted EGF Repeat and Discoidin Domains-Containing Protein 1 Milk Fat Globule-EGF Factor 8 Sperm Associated Antigen 10 Breast Epithelial Antigen BA46 Milk Fat Globule-EGF Factor 8 Protein O-Acetyl Disialoganglioside Synthase Lactadherin HMFG MFG-E8 MFGE8 MFGM SED1 Lactadherin (387 aa, ~43 kDa) is encoded by the human MFGE8 gene. This protein plays a role in cell adhesion, phagocytosis of apoptotic cells, integrin binding, intestinal epithelial homeostasis and the promotion of mucosal healing. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C26388 Lactadherin Lepirudin Recombinant Hirudin LEPIRUDIN Lepirudin Refludan lepirudin A yeast cell-derived recombinant polypeptide related to the naturally occurring, leech-derived anticoagulant hirudin. Lepirudin directly binds to and inactivates thrombin, producing dose-dependent increases in the activated partial thromboplastin time (aPTT) and prothrombin time (PT). The mechanism of action of this agent is independent of antithrombin III and is not inhibited by platelet factor 4. Natural hirudin, a family of highly homologous isopolypeptides, is produced in trace amounts by the leech Hirudo medicinalis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C1839 Lepirudin Leptin Obesity Factor Obese Protein LEP Leptin Leptin (167 aa, ~16 kDa) is encoded by the human LEP gene. This protein is secreted by adipocytes and plays a role in the regulation of both appetite and body fat stores. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C46081 Leptin Leucine-Rich_Alpha-2-Glycoprotein Leucine Rich Alpha-2-Glycoprotein 1 Leucine Rich Alpha 2 Glycoprotein Leucine-Rich Alpha-2-Glycoprotein LRG LRG1 Leucine-rich alpha-2-glycoprotein (347 aa, ~38 kDa) is encoded by the human LRG1 gene. This protein plays a role in granulocyte differentiation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C189801 Leucine-Rich Alpha-2-Glycoprotein Leukocyte_Immunoglobulin-like_Receptor_Subfamily_A_Member_5 immunoglobulin-like transcript 11 CD85f LIR-9 LILRA5 ILT-11 leukocyte immunoglobulin-like receptor 9 CD85 antigen-like family member F LILRB7 LIR9 ILT11 Category=gene. A leukocyte immunoglobulin-like receptor subfamily member that is a translation product of the human LILRA5 gene or a 1:1 ortholog thereof. http://purl.obolibrary.org/obo/PR_000009806 Leukocyte Immunoglobulin-like Receptor Subfamily A Member 5 Leukotriene_C4_Synthase LTC4S Leukotriene C4 Synthase A protein coding gene LTC4S in human. http://purl.obolibrary.org/obo/HGNC_6719 Leukotriene C4 Synthase Levofloxacin 7H-Pyrido(1,2,3-de)-1,4-benzoxazine-6-carboxylic Acid, 9-Fluoro-2,3-dihydro-3-methyl-10-(4-methyl-1-piperazinyl)-7-oxo-, Hydrate (2:1), (S)- LEVOFLOXACIN levofloxacin Levofloxacin (S)-9-Fluoro-2,3-dihydro-3-methyl-10-(4-methyl-1-piperazinyl)-7-oxo-7H-pyrido(1,2,3-de)-1,4-benzoxazine-6-carboxylic Acid Hydrate (2:1) Levofloxacin Hydrate Levaquin Quixin A broad-spectrum, third-generation fluoroquinolone antibiotic and optically active L-isomer of ofloxacin with antibacterial activity. Levofloxacin diffuses through the bacterial cell wall and acts by inhibiting DNA gyrase (bacterial topoisomerase II), an enzyme required for DNA replication, RNA transcription, and repair of bacterial DNA. Inhibition of DNA gyrase activity leads to blockage of bacterial cell growth. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C1586 Levofloxacin Lincomycin LINCOMYCIN Lincomycin A lincosamide antibiotic derived from bacteria Streptomyces lincolnensis with activity against gram positive and anaerobic bacteria. Lincomycin binds to the 50S subunit of the bacterial ribosome resulting in the inhibition of protein synthesis and thereby produces bactericidal effects in susceptible organisms. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61811 Lincomycin Lipopolysaccharide-Binding_Protein Lipopolysaccharide-Binding Protein LBP LPS-BP Lipopolysaccharide-binding protein (481 aa, ~53 kDa) is encoded by the human LBP gene. This protein plays a role in lipopolysaccharide binding. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C105867 Lipopolysaccharide-Binding Protein Lithostathine-1-Alpha Reg-1-Alpha Regenerating Islet-Derived 1 Alpha Regenerating Islet-Derived Protein 1-Alpha Regenerating Protein I Alpha Islet of Langerhans Regenerating Protein Regenerating Islet-Derived 1-Alpha Pancreatic Stone Protein Pancreatic Thread Protein Lithostathine 1 Alpha Lithostathine Lithostathine-1-Alpha Islet Cells Regeneration Factor ICRF PSP PTP Protein-X REG REG1A Lithostathine-1-alpha (166 aa, ~19 kDa) is encoded by the human REG1A gene. This protein may be involved in the modulation of neuronal and pancreatic cell proliferation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C131324 Lithostathine-1-Alpha Low_Affinity_Immunoglobulin_Gamma_Fc_Region_Receptor_II-C CD32A Antigen IgG Fc Receptor II-C Fc-Gamma-RIIC Fc Gamma Receptor IIC Low Affinity Immunoglobulin Gamma Fc Region Receptor IIC Low Affinity Immunoglobulin Gamma Fc Region Receptor II-C Fc-Gamma RIIC CD32 Antigen Fc-Gamma RII-C Immunoglobulin G Fc Receptor II-C Low Affinity IgG Fc Fragment Receptor IIC IgG Fc Receptor IIC CD32 FCGR2C FcRII-C FcRIIC hFcRII-C Low affinity immunoglobulin gamma Fc region receptor II-c (323 aa, ~36 kDa) is encoded by the human FCGR2C gene. This protein plays a role in the phagocytosis of antigen-antibody complexes. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C38557 Low Affinity Immunoglobulin Gamma Fc Region Receptor II-C M-Ficolin M-Ficolin FCN1 A protein coding gene FCN1 in human. http://purl.obolibrary.org/obo/HGNC_3623 M-Ficolin MALAT1_Gene Metastasis Associated Lung Adenocarcinoma Transcript 1 (Non-Protein Coding) Gene MALAT1 Gene MALAT1 This gene may play a role in carcinogenesis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C92696 MALAT1 Gene MAPK14_Gene Mitogen-Activated Protein Kinase 14 Gene MAPK14 Gene MAPK14 This gene plays a role in stress-related translation and cell cycle regulation. It is also involved in the genotoxic stress response. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C24581 MAPK14 Gene MCEMP1_Gene MCEMP1 Gene C19orf59 MCEMP1 Other designations: mast cell-expressed membrane protein 1 http://purl.obolibrary.org/obo/OGG_3000199675 MCEMP1 Gene MDK_Gene Midkine (Neurite Growth-Promoting Factor 2) Gene MDK MDK Gene This gene is involved in nervous tissue development. It plays a role in neuronal differentiation, growth, regeneration and survival. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C24589 MDK Gene MEG3_Gene LINC00023 FP504 GTL2 prebp1 PRO0518 PRO2160 NCRNA00023 MEG3 maternally expressed 3 (non-protein coding) http://purl.obolibrary.org/obo/OGG_3000055384 MEG3 Gene MFGE8_Gene Milk Fat Globule-EGF Factor 8 Protein Gene MFGE8 MFGE8 Gene This gene plays a regulatory role in the phagocytosis of apoptotic cells. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C24592 MFGE8 Gene MIF_Gene Macrophage Migration Inhibitory Factor (Glycosylation-Inhibiting Factor) Gene MIF MIF Gene This gene plays a role in cell-mediated immunity and macrophage function. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C24596 MIF Gene MIR1184-1_Gene hsa-mir-1184-1 MIRN1184 MIR1184 hsa-mir-1184 http://purl.obolibrary.org/obo/OGG_3100302111 MIR1184-1 Gene MIR122_Gene MIR122 Gene MicroRNA 122 Gene MIR122 This gene is involved in the regulation of gene expression and plays a role in the development of hepatocellular carcinoma. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C80750 MIR122 Gene MIR129-1_Gene MIRN129-1 MIR-129b http://purl.obolibrary.org/obo/OGG_3000406917 MIR129-1 Gene MIR133A1_Gene MIR133A1 Gene MicroRNA 133a-1 Gene MIR133A1 This gene is involved in the regulation of gene expression and plays a role in the development of squamous cell carcinoma. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C81734 MIR133A1 Gene MIR133A2_Gene MIR133A2 Gene MicroRNA 133a-2 Gene MIR133A2 This gene is involved in the regulation of gene expression and plays a role in the development of squamous cell carcinoma. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C81735 MIR133A2 Gene MIR141_Gene MIR141 Gene MicroRNA 141 Gene MIR141 This gene is involved in the regulation of gene expression and plays a role in the development of cholangiocarcinoma and carcinoma of the breast. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C81738 MIR141 Gene MIR143_Gene MIR143 Gene MicroRNA 143 Gene MIR143 This gene is involved in the regulation of gene expression and plays a role in the development of colorectal and bladder carcinomas as well as Burkitt lymphoma, Diffuse large B-Cell lymphoma and chronic lymphocytic leukemia. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C81739 MIR143 Gene MIR146A_Gene MIR146A Gene MicroRNA 146A Gene MIR146A This gene is involved in the regulation of gene expression and plays a role in the development of hepatocellular, breast, thyroid, ovarian and prostatic carcinomas. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C81741 MIR146A Gene MIR146B_Gene MicroRNA 146b Gene MIR146B Gene MIR146B This gene is involved in the regulation of gene expression and plays a role in the development of carcinoma of the breast and glioma. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C81779 MIR146B Gene MIR147B_Gene MIR147B MIR147B Gene microRNA 147b MIRN147B http://purl.obolibrary.org/obo/OGG_3100126311 MIR147B Gene MIR150_Gene MicroRNA 150 Gene MIR150 Gene MIR150 This gene may be involved in the regulation of protein expression. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C105985 MIR150 Gene MIR15A_Gene MicroRNA 151 Gene MIR15A Gene MIR15A This gene is involved in the regulation of gene expression and plays a potential tumor suppressor role in prostate carcinomas, various leukemias, pituitary adenoma, polycystic kidney disease and polycystic liver disease. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C81884 MIR15A Gene MIR15B_Gene MIR15B Gene MicroRNA 15b Gene MIR15B This gene is involved in the regulation of gene expression and plays a potential tumor suppressor role in chronic lymphocytic leukemia and chronic myeloid leukemia.. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C81760 MIR15B Gene MIR16-1_Gene MIR16-1 Gene MicroRNA 16-1 Gene MIR16-1 This gene is involved in the regulation of gene expression and plays a potential tumor suppressor role in hepatocellular and prostate carcinomas, pituitary adenoma, as well as various leukemias and lymphomas. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C80734 MIR16-1 Gene MIR16-2_Gene MIR16-2 Gene MicroRNA 16-2 Gene MIR16-2 This gene is involved in the regulation of gene expression and plays a role in the development of hepatocellular carcinoma and chronic lymphocytic leukemia. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C80735 MIR16-2 Gene MIR181A1_Gene MicroRNA 181a-1 Gene MIR181A1 Gene MIR181A1 This gene is involved in the regulation of gene expression and plays a role in the development of plasma cell myeloma and glioma. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C81745 MIR181A1 Gene MIR181A2_Gene MicroRNA 181a-2 Gene MIR181A2 Gene MIR181A2 This gene is involved in the regulation of gene expression and plays a role in the development of plasma cell myeloma and glioma. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C81746 MIR181A2 Gene MIR193B_Gene MicroRNA 193b Gene MIR193B Gene MIR193B This gene is involved in the regulation of gene expression. http://purl.obolibrary.org/obo/OGG_3000574455 MIR193B Gene MIR199A1_Gene MIR199A1 Gene MicroRNA 199A1 Gene MIR199A1 This gene is involved in the regulation of gene expression and plays a role in the development of epithelial ovarian carcinoma. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C81750 MIR199A1 Gene MIR199A2_Gene MicroRNA 199A2 Gene MIR199A2 Gene MIR199A2 This gene is involved in the regulation of gene expression and plays a role in the development of epithelial ovarian carcinoma. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C81751 MIR199A2 Gene MIR21_Gene MicroRNA 21 Gene MIR21 MIR21 Gene This gene is involved in the regulation of gene expression and plays an oncogenic role in hepatocellular, breast, esophageal, gastric, pancreatic, prostatic and squamous cell carcinomas, glioblastoma and glioma. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C80740 MIR21 Gene MIR223_Gene MIR223 Gene MicroRNA 223 Gene MIR223 This gene is involved in the regulation of gene expression and plays a role in the development of hepatocellular and ovarian carcinomas, acute promyelocytic leukemia and chronic myeloid leukemia. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C80727 MIR223 Gene MIR27A_Gene MIR27A Gene MicroRNA 27a Gene MIR27A This gene is involved in the regulation of gene expression and plays a role in the development of hepatocellular, gastric and breast carcinomas. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C80746 MIR27A Gene MIR328_Gene MIRN328 MIR328 Gene http://purl.obolibrary.org/obo/OGG_3000442901 MIR328 Gene MIR34A_Gene MicroRNA 34a Gene MIR34A Gene MIR34A This gene is involved in the modulation of gene expression. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C95831 MIR34A Gene MIR378A_Gene hsa-mir-378 miRNA378A hsa-mir-378a MIRN378A MIR378A http://purl.obolibrary.org/obo/OGG_3000494327 MIR378A Gene MIR451A_Gene MIR451A Gene MicroRNA 451a Gene MIR415A MIR451 MIR451A This gene is involved in the regulation of gene expression and plays a role in the development of breast carcinoma and glioblastoma. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C81813 MIR451A Gene MIR455_Gene hsa-mir-455 MIRN455 http://purl.obolibrary.org/obo/OGG_3000619556 MIR455 Gene MIR483_Gene MicroRNA 483 Gene MIR483 Gene MIR483 This gene may be involved in the negative regulation of translation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C131516 MIR483 Gene MIR495_Gene hsa-mir-495 MIR495 Gene http://purl.obolibrary.org/obo/OGG_3000574453 MIR495 Gene MIR574_Gene MIR574 Gene MicroRNA 574 Gene MIR574 This gene may play a role in the modulation of target gene expression. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C127130 MIR574 Gene MIR873_Gene MIR873 Gene hsa-mir-873 MIRN873 http://purl.obolibrary.org/obo/OGG_3100126316 MIR873 Gene MME_Gene Membrane Metalloendopeptidase Gene CD10 MME MME Gene This gene is involved in the inactivation of peptide hormones. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C24607 MME Gene MMP10_Gene Matrix Metallopeptidase 10 (Stromelysin 2) Gene MMP10 MMP10 Gene This gene plays a role in degradation of proteoglycans and fibronectin. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C101759 MMP10 Gene MMP8_Gene Matrix Metallopeptidase 8 Gene MMP8 MMP8 Gene This gene is involved in proteolysis and the regulation of matrix remodeling. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C41045 MMP8 Gene MMP9_Gene Matrix Metalloproteinase 9 (Gelatinase B, 92kDa Gelatinase, 92kDa type IV Collagenase) Gene MMP9 MMP9 Gene This gene plays a role in inflammation, keratinocyte growth and the regulation of matrix remodeling. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C26508 MMP9 Gene MPO_Gene Myeloperoxidase Gene MPO MPO Gene This gene is involved in the modulation of neutrophil microbicidal activity. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C91742 MPO Gene MRC1_Gene Mannose Receptor, C Type 1 Gene MRC1 MRC1 Gene This gene is involved in endocytosis of glycoproteins by macrophages. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C104633 MRC1 Gene Macrophage_Mannose_Receptor_1 C-Type Lectin Domain Family 13 Member D Macrophage Mannose Receptor 1 Mannose Receptor, C Type 1-Like 1 CD206 Antigen Macrophage Mannose Receptor 1-Like Protein 1 Mannose Receptor, C Type 1 MRC1 C-Type Lectin Domain Family 13 Member D-Like Macrophage mannose receptor 1 (1456 aa, ~166 kDa) is encoded by the human MRC1 gene. This protein is involved in mediating macrophage endocytosis of glycoproteins. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C104635 Macrophage Mannose Receptor 1 Macrophage_Migration_Inhibitory_Factor L-Dopachrome Isomerase Phenylpyruvate Tautomerase Glycosylation-Inhibiting Factor Macrophage Migration Inhibitory Factor EC 5.3.3.12 L-Dopachrome Tautomerase EC 5.3.2.1 MIF Macrophage migration inhibitory factor (115 aa, ~12 kDa) is encoded by the human MIF gene. This protein is involved in the regulation of the innate immune response. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C28467 Macrophage Migration Inhibitory Factor Magnesium_Chloride_Anhydrous MAGNESIUM CHLORIDE ANHYDROUS Magnesium Chloride Anhydrous http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C76656 Magnesium Chloride Anhydrous Mast_Cell-Expressed_Membrane_Protein_1 MCEMP1 C19orf59 Mast Cell-Expressed Mmembrane Protein 1 A protein that is a translation product of the human MCEMP1 gene or a 1:1 ortholog thereof. http://purl.obolibrary.org/obo/PR_000010236 Mast Cell-Expressed Mmembrane Protein 1 Maternally_Expressed_Gene_3 MEG3 Maternally Eepressed Gene 3 http://purl.bioontology.org/ontology/OMIM/605636 Maternally Eepressed Gene 3 Matrix_Metalloproteinase-9 Matrix Metalloprotease 9 Gelatinase B 92 kDa Type IV Collagenase Type V Collagenase EC 3.4.24.35 Matrix Metalloproteinase-9 92 kDa Gelatinase Macrophage Gelatinase Matrix Metalloproteinase 9 Matrix Metalloprotease-9 GELB MMP-9 MMP9 Matrix metalloproteinase-9 (707 aa, ~78 kDa) is encoded by the human MMP9 gene. This protein plays a role in collagen degradation, macrophage differentiation and cell migration. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C17575 Matrix Metalloproteinase-9 Mebendazole Methyl 5-benzoyl benzimidazole-2-carbamate (5-Benzoyl-1H-benzimidazol-2-yl)-carbamic Acid Methyl Ester MEBENDAZOLE Mebendazole R 17635 Vermox A synthetic benzimidazole derivate and anthelmintic agent. Mebendazole interferes with the reproduction and survival of helminths by inhibiting the formation of their cytoplasmic microtubules, thereby selectively and irreversibly blocking glucose uptake. This results in a depletion of glycogen stores and leads to reduced formation of ATP required for survival and reproduction of the helminth. This eventually causes the helminths death. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C47595 Mebendazole Meropenem Meropenem Trihydrate Merrem I.V. MEROPENEM Meropenem SM-7338 A broad-spectrum carbapenem with antibacterial properties, synthetic Meropenem inhibits cell wall synthesis in gram-positive and gram-negative bacteria. It penetrates cell walls and binds to penicillin-binding protein targets. Meropenem acts against aerobes and anaerobes including Klebsiella, E. coli, Enterococcus, Clostridium sp.. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C1160 Meropenem Metalloproteinase_Inhibitor_1 Metalloproteinase Inhibitor 1 Erythroid Potentiating Activity Collagenase Inhibitor Tissue Inhibitor of Metalloproteinases Tissue Inhibitor of Metalloproteinase 1 Tissue Inhibitor of Metalloproteinases 1 Fibroblast Collagenase Inhibitor Erythroid Potentiating Activity, Collagenase Inhibitor EPA TIMP-1 TIMP1 Metalloproteinase inhibitor 1 (207aa, ~28 kDa) is encoded by the human TIMP1 gene. This protein is involved in both erythropoiesis and metalloproteinase inhibition. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C17543 Metalloproteinase Inhibitor 1 Metaraminol Metaraminol METARAMINOL http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61835 Metaraminol Metastasis-Associated_Lung_Adenocarcinoma_Transcript_1 Nuclear Paraspeckle Assembly Transcript 2 Metastasis-Associated Lung Adenocarcinoma Transcript 1 Nuclear Enriched Abundant Transcript 2 Non-Protein Coding RNA 47 Hepcarcin MALAT1 PRO1073 Metastasis-associated lung adenocarcinoma transcript 1 (~8.7 kb) is encoded by the human MALAT1 gene. This non-coding RNA may play a role in cancer and metastasis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C92698 Metastasis-Associated Lung Adenocarcinoma Transcript 1 Methicillin METHICILLIN Methicillin A semisynthetic, narrow spectrum beta-lactamase-resistant penicillin antibiotic with bactericidal and beta-lactamase resistant activity. Methicillin binds to specific penicillin-binding proteins (BPBs) on the bacterial cell wall, thereby preventing the cross-linkage of peptidoglycans, which are critical components of the bacterial cell wall. This leads to an interruption of the bacterial cell wall and causes bacterial lysis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61842 Methicillin Methylprednisolone (6alpha,11beta)-11,17,21-Trihydroxy-6-methylpregna-1,4-diene-3,20-dione Veriderm Medrol Methylprednisolone METHYLPREDNISOLONE Caberdelta M Depo-Nisolone Methylprednisolonum Predni-M-Tablinen Depo Moderin 6Alpha-Methylprednisolone DepMedalone methylprednisolone Medrol Veriderm Metilbetasone Solubile Sieropresol Adlone Duralone Emmetipi Esametone Firmacort Medlone 21 Medrate Medrol Medrone Mega-Star Meprolone Metrocort Metypresol Metysolon Prednilen Radilem Solpredone Summicort Urbason Wyacort A synthetic corticosteroid with anti-inflammatory and immunomodulating properties. Methylprednisolone binds to and activates specific nuclear receptors, resulting in altered gene expression and inhibition of proinflammatory cytokine production. This agent also decreases the number of circulating lymphocytes, induces cell differentiation, and stimulates apoptosis in sensitive tumor cell populations. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C647 Methylprednisolone Metronidazole Flagyl I.V. RTU METRONIDAZOLE metronidazole Metronidazole Flagyl Tricom A synthetic nitroimidazole derivative with antiprotozoal and antibacterial activities. Although its mechanism of action is not fully elucidated, un-ionized metronidazole is readily taken up by obligate anaerobic organisms and is subsequently reduced by low-redox potential electron-transport proteins to an active, intermediate product. Reduced metronidazole causes DNA strand breaks, thereby inhibiting DNA synthesis and bacterial cell growth. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C651 Metronidazole Miconazole 1-[2-(2,4-Dichlorophenyl)-2-[(2,4-dichlorophenyl)methoxy]ethyl]-1H-imidazole MICONAZOLE Miconazole An antifungal synthetic derivative of imidazole and used in the treatment of candidal skin infections, Miconazole selectively affects the integrity of fungal cell membranes, high in ergosterol content and different in composition from mammalian cells membranes. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C62048 Miconazole MicroRNA_1184-1 microRNA 1184 hsa-mir-1184-1 hsa-mir-1184 MIR1184 MIRN1184 https://identifiers.org/ncbigene/100302111 MicroRNA 1184-1 MicroRNA_122-3p hsa-mir-122a MicroRNA 122-3p MicroRNA 122 MicroRNA 122a hsa-miR-122-3p hsa-miR-122* MicroRNA-122 hsa-mir-122 MIRN122 MIRN122A A 22 ribonucleotide sequence that is a final product of the processing of MIR122 pre-miRNA. This oligonucleotide may be involved in the maintenance of hepatic cells via transcriptional silencing. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C188683 MicroRNA 122-3p MicroRNA_129-1 MIR129-1 hsa-mir-129-1 http://identifiers.org/hgnc/31512 MicroRNA 129-1 MicroRNA_133A MicroRNA 133A cfa-miR-133a A mature miRNA expressed in (MAKE-URI NIL obo:NCBITaxon_9615), with sequence uugguccccuucaaccagcugu http://purl.obolibrary.org/NCRO_MIMAT0009834 MicroRNA 133A MicroRNA_141 MIR141 hsa-mir-141 http://identifiers.org/hgnc/31528 MicroRNA 141 MicroRNA_143 MicroRNA 143 hsa-mir-143 http://purl.obolibrary.org/obo/NCRO_0001911 MicroRNA 143 MicroRNA_146 MicroRNA 146A hsa-mir-146a http://purl.obolibrary.org/obo/NCRO_0001920 MicroRNA 146A MicroRNA_146B MicroRNA 146B hsa-mir-146b http://purl.obolibrary.org/obo/NCRO_0001921 MicroRNA 146B MicroRNA_147 MicroRNA 147B hsa-mir-147b MIR147B MicroRNA 147B MicroRNA_150 MicroRNA 150 hsa-mir-150 http://purl.obolibrary.org/obo/NCRO_0002023 MicroRNA 150 MicroRNA_15A MicroRNA 15A hsa-mir-15a http://purl.obolibrary.org/obo/NCRO_0001694 MicroRNA 15A MicroRNA_15B MIR15B hsa-mir-15b http://identifiers.org/hgnc/31544 MicroRNA 15B MicroRNA_16 MicroRNA 16 hsa-miR-16-5p MIR16 MIRN16 MiR-16 MiRNA16 hsa-miR-16 A 22 ribonucleotide sequence that is a final product of the processing of either MIR16-1 pre-miRNA or MIR16-2 pre-miRNA. This oligonucleotide may be involved in the negative regulation of gene expression. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C129416 MicroRNA 16 MicroRNA_181A hsa-miR-181a-5p MicroRNA 181a hsa-miR-181a Micro RNA 181a MIR181A MIR181a MIRN181a MiR-181a MiRNA181a A 23 ribonucleotide sequence that is a final product of the processing of either MIR181A1 pre-miRNA or MIR181A2 pre-miRNA. This oligonucleotide may be involved in the negative regulation of gene expression. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C178568 MicroRNA 181A MicroRNA_193B MicroRNA 193B hsa-mir-193b http://purl.obolibrary.org/obo/NCRO_0001900 MicroRNA 193B MicroRNA_199a-1 hsa-mir-199a-1 MIR199A1 http://identifiers.org/hgnc/31571 MicroRNA 199a-1 MicroRNA_199a-2 MIR199A2 hsa-mir-199a-2 http://identifiers.org/hgnc/31572 MicroRNA 199a-2 MicroRNA_21 MicroRNA 21 hsa-mir-21 http://purl.obolibrary.org/obo/NCRO_0001863 MicroRNA 21 MicroRNA_223 MicroRNA 223 hsa-mir-223 http://purl.obolibrary.org/obo/NCRO_0001874 MicroRNA 223 MicroRNA_27A MicroRNA 27A hsa-mir-27a http://purl.obolibrary.org/obo/NCRO_0001821 MicroRNA 27A MicroRNA_328 MIR328 hsa-mir-328 http://purl.obolibrary.org/obo/NCRO_0002028 MicroRNA 328 MicroRNA_34A MIR34A hsa-mir-34a http://identifiers.org/hgnc/31635 MicroRNA 34A MicroRNA_378A MIR378A hsa-mir-378 http://identifiers.org/hgnc/31871 MicroRNA 378A MicroRNA_451A hsa-mir-451 MIR451A http://identifiers.org/hgnc/32053 MicroRNA 451A MicroRNA_455 MIR455 hsa-mir-455 http://identifiers.org/hgnc/32344 MicroRNA 455 MicroRNA_483 MicroRNA 483 hsa-mir-483 http://purl.obolibrary.org/obo/NCRO_0002010 MicroRNA 483 MicroRNA_495 MicroRNA 495 hsa-mir-495 http://purl.obolibrary.org/obo/NCRO_0001930 MicroRNA 495 MicroRNA_574 MicroRNA 574 hsa-mir-574 http://purl.obolibrary.org/obo/NCRO_0002164 MicroRNA 574 MicroRNA_873 hsa-mir-873 MicroRNA 873 http://purl.obolibrary.org/obo/NCRO_0002153 MicroRNA 873 Midazolam MIDAZOLAM Midazolam midazolam http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C62049 A short-acting benzodiazepine derivative with an imidazole structure and with anxiolytic, amnestic, hypnotic, anticonvulsant and sedative properties. Midazolam exerts its effect by binding to the benzodiazepine receptor at the gamma-aminobutyric acid (GABA) receptor-chloride ionophore complex in the central nervous system (CNS). This leads to an increase in the opening of chloride channels, membrane hyperpolarization and increases the inhibitory effect of GABA in the CNS. Midazolam may also interfere with the reuptake of GABA, thereby causing accumulation of GABA in the synaptic cleft. Midazolam Midkine Neurite Outgrowth-Promoting Protein Neurite Growth-Promoting Factor 2 Neurite Outgrowth-Promoting Factor 2 Retinoic Acid Inducible Factor Amphiregulin-Associated Protein Midgestation and Kidney Protein ARAP MDK MK Midkine Midkine (143 aa, ~16 kDa) is encoded by the human MDK gene. This protein plays a role in receptor signaling and the modulation of cell proliferation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C26381 Midkine Minocycline Minocycline MINOCYCLINE (2E,4S,4aR,5aS,12aR)- 2-(amino-hydroxy-methylidene)- 4,7-bis(dimethylamino)-10,11,12a-trihydroxy-4a,5,5a,6- tetrahydro-4H-tetracene- 1,3,12-trione http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61849 Minocycline Mitogen-Activated_Protein_Kinase_14 CSAID-Binding Protein MAP Kinase 14 Stress-Activated Protein Kinase 2A Cytokine Suppressive Anti-Inflammatory Drug Binding Protein MAP Kinase Mxi2 p38 MAP Kinase Mitogen-Activated Protein Kinase 14 Mitogen-Activated Protein Kinase p38 Alpha CSAIDS Binding Protein p38 Mitogen Activated Protein Kinase MAP Kinase p38 Alpha p38Alpha EXIP EC 2.7.11.24 MAX-Interacting Protein 2 CSBP MAPK 14 MAPK14 SAPK2A p38 MAPK Mitogen-activated protein kinase 14 (360 aa, ~42 kDa) is encoded by the human MAPK14 gene. This protein is involved in MAP kinase signaling pathways, serine/threonine phosphorylation and the regulation of gene expression. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C26369 Mitogen-Activated Protein Kinase 14 Monocyte_Differentiation_Antigen_CD14 CD14 Antigen Monocyte Differentiation Antigen CD14 Lipopolysaccharide Receptor Myeloid Cell-Specific Leucine-Rich Glycoprotein CD14 Monocyte differentiation antigen CD14 (375 aa, ~40 kDa) is encoded by the human CD14 gene. This protein plays a role in the innate immune response to lipopolysaccharide exposure. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C17488 Monocyte Differentiation Antigen CD14 Morphine MORPHINE Morphine An opiate alkaloid isolated from the plant Papaver somniferum and produced synthetically. Morphine binds to and activates specific opiate receptors (delta, mu and kappa), each of which are involved in controlling different brain functions. In the central nervous and gastrointestinal systems, this agent exhibits widespread effects including analgesia, anxiolysis, euphoria, sedation, respiratory depression, and gastrointestinal system smooth muscle contraction. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C62051 Morphine Moxifloxacin MOXIFLOXACIN Moxifloxacin moxifloxacin A fluoroquinolone antibiotic with antibacterial activity. Moxifloxacin binds to and inhibits the bacterial enzymes DNA gyrase (topoisomerase II) and topoisomerase IV, resulting in inhibition of DNA replication and repair and cell death in sensitive bacterial species. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C62052 Moxifloxacin Myeloperoxidase MYELOPEROXIDASE EC 1.11.1.7 Myeloperoxidase MPO Myeloperoxidase (745 aa, ~84 kDa) is encoded by the human MPO gene. This protein is involved in the regulation of the innate host defense through the production of hypohalous acids. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C71145 Myeloperoxidase N-Terminal_Fragment_Brain_Natriuretic_Protein N-Terminal Fragment of Prohormone Brain Natriuretic Peptide N-Terminal Fragment Brain Natriuretic Protein NT-proBNP(1-76) N-Terminal Fragment of Brain Natriuretic Protein NT-pro-BNP NT-proBNP N-terminal fragment brain natriuretic protein (76 aa, ~9 kDa) is encoded by the human NPPB gene. This protein is a marker for cardiac failure. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C88524 N-Terminal Fragment Brain Natriuretic Protein NAD-Dependent_Deacetylase_Sirtuin-2 SIR2-Like Protein 2 Sir2-Related Protein Type 2 NAD-Dependent Deacetylase Sirtuin-2 Silent Information Regulator 2 EC 3.5.1.- SIRT2 NAD-dependent deacetylase sirtuin-2 (389 aa, ~43 kDa) is encoded by the human SIRT2 gene. This protein plays a role in the deacetylation of tubulin. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C101564 NAD-Dependent Deacetylase Sirtuin-2 NAMPT_Gene Nicotinamide Phosphoribosyltransferase Gene NAMPT NAMPT Gene PBEF1 This gene plays a role in the regulation of B-cell colony formation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C24661 NAMPT Gene NF-kB Nuclear Factor Kappa-B Nuclear Factor NF-Kappa-B Nuclear Factor of Kappa Light Chain Gene Enhancer in B Cells Nuclear Factor Kappa-Light-Chain-Enhancer of Activated B Cells Nuclear Transcription Factor NF-kB Nuclear Factor Kappa B Nuclear Factor of Kappa Light Polypeptide Gene Enhancer in B-Cells NF-Kappa B NF-Kappa-B NF-KappaB NF-kB NFKB NF-kB is a heterodimer complex of two DNA-binding subunits from two families of ubiquitous, inducible, nuclear transcription activators involved in cytokine-induced activation of gene expression. NFKB1 or NFKB2 is bound to REL, RELA, or RELB to form the NF-kB complex. NF-kB is inhibited by IkB proteins (NFKBIA or NFKBIB), which inactivate NF-kB by trapping it in the cytoplasm. Phosphorylation of IkB by kinases (IKBKA or IKBKB) marks them for ubiquitination, allowing NF-kB translocation to the nucleus and DNA binding at kappa-B transcription enhancer motifs. In B-lymphocytes, NF-kB binds to the immunoglobulin kappa light chain enhancer and in T-lymphocytes it binds to enhancers in virally infected cells, including HIV. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C17380 NF-kB NKG2-D_Type_II_Integral_Membrane_Protein NKG2-D Type II Integral Membrane Protein CD Antigen CD314 NKG2-D-Activating NK Receptor Killer Cell Lectin-Like Receptor Subfamily K Member 1 CD314 Antigen Antigen CD314 NK Cell Receptor D CD314 KLRK1 NKG2-D type II integral membrane protein (216 aa, ~25 kDa) is encoded by the human KLRK1 gene. This protein plays a role in ligand-mediated NK cell activation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C101752 NKG2-D Type II Integral Membrane Protein NLRP3_Gene NLR Family, Pyrin Domain Containing 3 Gene NLRP3 NLRP3 Gene This gene plays a role in both inflammation and apoptosis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C77202 NLRP3 Gene NORAD non-coding RNA activated by DNA damage http://identifiers.org/hgnc/44311 NORAD NORAD_Gene NONCODING RNA ACTIVATED BY DNA DAMAGE lncRNA NORAD http://purl.bioontology.org/ontology/OMIM/617037 NORAD Gene NPPA_Gene Natriuretic Peptide A Gene NPPA NPPA Gene This gene is involved in both cardiac homeostasis and pregnancy. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C139907 NPPA Gene NPPB_Gene Natriuretic Peptide Precursor B Gene NPPB NPPB Gene This gene is involved in cardiac homeostasis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C88520 NPPB Gene NRIP3_Gene Nuclear Receptor Interacting Protein 3 Gene NRIP3 NRIP3 Gene This gene may play a role in proteolysis or nuclear receptor activity. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C126614 NRIP3 Gene Nefopam NEFOPAM Nefopam http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C83994 Nefopam Neprilysin EC 3.4.24.11 Common ALL Antigen Antigen CD10 Skin Fibroblast Elastase Common Acute Lymphoblastic Leukemia Antigen Enkephalinase Atriopeptidase Neutral Endopeptidase CD10 Antigen Membrane Metalloendopeptidase CALLA CD10 MME NEP Neprilysin SFE cALLa Neprilysin (750 aa, ~86 kDa) is encoded by the human MME gene. This protein is involved in the metabolism of biologically active peptides. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16836 Neprilysin Netilmicin NETILMICIN Netilmicin A semisynthetic, water soluble aminoglycoside derived from sisomicin, a naturally occurring antibiotic produced by the fermentation of Micromonospora inyoensis. Netilmicin irreversibly binds to the 16S rRNA and S12 protein of the bacterial 30S ribosomal subunit. As a result, this agent interferes with the assembly of initiation complex between mRNA and the bacterial ribosome, thereby inhibiting the initiation of protein synthesis. In addition, netilmicin induces misreading of the mRNA template and causes translational frameshift, thereby results in premature termination. This eventually leads to bacterial cell death. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C66236 Netilmicin Neutrophil_Collagenase Matrix Metalloprotease 8 Neutrophil Collagenase Matrix Metalloproteinase-8 PMNL Collagenase Human Collagenase 2 EC 3.4.24.34 Matrix Metalloproteinase 8 Matrix Metalloprotease-8 CLG1 HNC MMP8 PMNL-CL Neutrophil collagenase (467 aa, ~53 kDa) is encoded by the human MMP8 gene. This protein plays a role in the proteolysis of fibrillar collagen. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C41046 Neutrophil Collagenase Neutrophil_Elastase Neutrophil Elastase Human Leukocyte Elastase Bone Marrow Serine Protease Elastase, Neutrophil Expressed Granulocyte-Derived Elastase PMN Elastase PMN-E Leukocyte Elastate Elastase 2, Neutrophil EC 3.4.21.37 Polymorphonuclear Elastase ELANE Elastase 2 Medullasin Neutrophil elastase (267 aa, ~29 kDa) is encoded by the human ELANE gene. This protein plays a role in innate host defense and tissue remodeling. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C104198 Neutrophil Elastase Neutrophil_Gelatinase-Associated_Lipocalin Siderocalin LCN2 Migration-Stimulating Factor Inhibitor Oncogenic Lipocalin 24p3 Neutrophil Gelatinase-Associated Lipocalin 25 kDa Alpha-2-Microglobulin-Related Subunit Of MMP-9 Lipocalin-2 LCN-2 LCN2 Oncogene 24p3 NGAL Uterocalin p25 Neutrophil gelatinase-associated lipocalin (198 aa, ~23 kDa) is encoded by the human LCN2 gene. This protein may play a role in iron transport, apoptosis, and innate immunity. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C71452 Neutrophil Gelatinase-Associated Lipocalin Nicotinamide_Phosphoribosyltransferase Pre-B Cell-Enhancing Factor Pre-B Cell Enhancing Factor Pre-B-Cell Colony Enhancing Factor 1 Pre-B-Cell Colony-Enhancing Factor 1 Nicotinamide Phosphoribosyltransferase Pre-B-Cell Colony-Enhancing Factor EC 2.4.2.12 NAMPT NAmPRTase Nampt PBEF Visfatin Nicotinamide phosphoribosyltransferase (491 aa, ~56 kDa) is encoded by the human NAMPT gene. This protein plays a role in both NAD biosynthesis and immunomodulation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C30138 Nicotinamide Phosphoribosyltransferase Nitroglycerin NITROGLYCERIN Nitroglycerin nitroglycerin Rectiv An organic nitrate with vasodilator activity. Nitroglycerin is converted into nitric oxide (NO) in smooth muscle and activates guanylyl cyclase, thereby increasing cGMP concentration, and resulting in smooth muscle relaxation. Dilatation of the veins results in decreased venous return to the heart, thereby decreasing left ventricular volume (reduced preload) and decreasing myocardial oxygen requirements. Arteriolar relaxation reduces arteriolar resistance (reduced afterload), thereby decreasing myocardial oxygen demands. In addition, nitroglycerine causes coronary artery dilatation, thereby improving myocardial blood distribution. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C29294 Nitroglycerin Norfloxacin 1,4-Dihydro-1-ethyl-6-fluoro-4-oxo-7-(1-piperazinyl)-3-quinolinecarboxylic Acid NORFLOXACIN Norfloxacin Baccidal Fulgram MK-366 Noroxin Sebercim A synthetic, broad-spectrum fluoroquinolone with antibacterial activity. Norfloxacin inhibits activity of DNA gyrase, thereby blocking bacterial DNA replication. Norfloxacin concentrates in the renal tubules and bladder and is bactericidal against a wide range of aerobic gram-positive and gram-negative organisms. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C47638 Norfloxacin Nuclear_Receptor_Interacting_Protein_3 Nuclear Receptor Interacting Protein 3 NRIP3 A protein coding gene NRIP3 in human. http://purl.obolibrary.org/obo/HGNC_1167 Nuclear Receptor Interacting Protein 3 OPTN_Gene Optineurin Gene OPTN OPTN Gene This gene plays a role in both neuroprotection and Golgi maintenance http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C119640 OPTN Gene ORM1_Gene Orosomucoid 1 Gene ORM1 ORM1 Gene This gene plays a role in immune modulation and transport. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C126965 ORM1 Gene Ofloxacin 9-Fluoro-2,3-Dihydro-3-Methyl-10-(4-Methyl-1-Piperazinyl)-7-Oxo-7H-Pyrido(1,2,3-de)(1,4)benzoxazine-6-Carboxylic Acid, DL- DL-8280 Floxin HOE 280 OFLOXACIN Ocuflox Ofloxacin ofloxacin A fluoroquinolone antibacterial antibiotic. Ofloxacin binds to and inhibits bacterial topoisomerase II (DNA gyrase) and topoisomerase IV, enzymes involved in DNA replication and repair, resulting in cell death in sensitive bacterial species. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C712 Ofloxacin Optineurin Huntingtin Interacting Protein L Huntingtin-Interacting Protein 7 Transcription Factor IIIA-Interacting Protein TFIIIA-IntP Optic Neuropathy-Inducing Protein Tumor Necrosis Factor Alpha-Inducible Cellular Protein Containing Leucine Zipper Domains E3-14.7K-Interacting Protein Huntingtin Yeast Partner L Huntingtin-Interacting Protein L NEMO-Related Protein FIP-2 HIP-7 Optineurin OPTN Optineurin (577 aa, ~66 kDa) is encoded by the human OPTN gene. This protein plays a role in the maintenance of both neurons and the Golgi apparatus. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C119642 Optineurin Oritavancin Oritavancin ORITAVANCIN http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C174855 Oritavancin Osteopontin Urinary Stone Protein Secreted Phosphoprotein 1 Osteopontin Bone Sialoprotein 1 Nephropontin SPP-1 Uropontin OPN Osteopontin (314 aa, ~35 kDa) is encoded by the human SPP1 gene. This protein is involved in the regulation of both tissue mineralization and cell-cell signaling. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C46082 Osteopontin Oxytetracycline OXYTETRACYCLINE (4S,4aR,5S,5aR,6S,12aS)-4-(dimethylamino)-3,5,6,10,11,12a-hexahydroxy-6-methyl-1,12-dioxo-1,4,4a,5,5a,6,12,12a-octahydrotetracene -2-carboxamide Oxytetracycline http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61872 Oxytetracycline Ozagrel OZAGREL Ozagrel http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C66288 Ozagrel PGF_Gene Placental Growth Factor Gene PGF PGF Gene This gene plays a role in the growth, proliferation and migration of endothelial cells. It is also involved in angiogenesis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C24670 PGF Gene PID1_Gene PCLI1 NYGGF4 P-CLI1 Other designations: PTB-containing, cubilin and LRP1-interacting protein|phosphotyrosine interaction domain-containing protein 1 http://purl.obolibrary.org/obo/OGG_3000055022 PID1 Gene PLA2G2A_Gene PLA2G2A Gene Phospholipase A2, Group IIA (Platelets, Synovial Fluid) Gene PLA2G2A This gene is involved in the regulation of the inflammatory response. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C24678 PLA2G2A Gene PLAUR_Gene Plasminogen Activator, Urokinase Receptor Gene PLAUR PLAUR Gene This gene is involved in the activation of cell-surface plasminogen and localized degradation of the underlying extracellular matrix. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C24681 PLAUR Gene PLAU_Gene Plasminogen Activator, Urokinase Gene PLAU PLAU Gene This gene plays a role in blood coagulation and the regulation of monocyte/macrophage functions. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C26581 PLAU Gene PLD4_Gene C14orf175 PLD4 Gene Other designations: PLD 4|choline phosphatase 4|phosphatidylcholine-hydrolyzing phospholipase D4|phospholipase D4 http://purl.obolibrary.org/obo/OGG_3000122618 PLD4 Gene PON1_Gene Paraoxonase 1 Gene PON1 PON1 Gene This gene plays a role in the metabolism of organophosphates, lactones and aromatic carboxylic acid esters. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C116047 PON1 Gene PRDX4_Gene Peroxiredoxin 4 Gene PRDX4 PRDX4 Gene This gene plays a role in both cellular redox and nuclear factor NF-kappa-B activity. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C116654 PRDX4 Gene PROC_Gene Protein C (Inactivator Of Coagulation Factors Va and VIIIa) Gene PROC PROC Gene This gene is involved in the modulation of blood coagulation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C102824 PROC Gene PROS1_Gene Protein S (Alpha) Gene PROS1 PROS1 Gene This gene plays a role in inhibiting blood coagulation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C107571 PROS1 Gene PTX3_Gene Pentraxin 3, Long Gene PTX3 PTX3 Gene This gene is involved in complement recognition of pathogens. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C119680 PTX3 Gene PVT1_Gene Pvt1 Oncogene (Non-Protein Coding) Gene PVT1 PVT1 Gene This gene plays a role in the activation of transcription. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C18403 PVT1 Gene Penicillin_G PENICILLIN G Penicillin G A broad-spectrum, beta-lactam naturally occurring penicillin antibiotic with antibacterial activity. Penicillin G binds to and inactivates the penicillin binding proteins (PBPs) located inside the bacterial cell wall. Inactivation of PBPs interferes with the cross-linkage of peptidoglycan chains necessary for bacterial cell wall strength and rigidity. This interrupts bacterial cell wall synthesis and results in the weakening of the bacterial cell wall and eventually causing cell lysis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61883 Penicillin G Penicillin_V Penicillin V Phenoxymethylpenicillin PENICILLIN V V-Cillin A member of the penicillin family exhibiting broad-spectrum antibiotic property. Penicillin V binds to penicillin binding proteins (PBP), the enzymes that catalyze the synthesis of peptidoglycan, which is a critical component of the bacterial cell wall. This leads to the interruption of cell wall synthesis, consequently leading to bacterial cell growth inhibition and cell lysis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C62064 Penicillin V Pentraxin-Related_Protein_PTX3 Tumor Necrosis Factor Alpha-Induced Protein 5 Pentraxin-3 Pentaxin-Related Protein PTX3 Tumor Necrosis Factor-Inducible Protein TSG-14 Pentraxin-Related Protein PTX3 TNF Alpha-Induced Protein 5 Pentraxin 3 Tumor Necrosis Factor-Inducible Gene 14 Protein TSG-14 Pentraxin-related protein PTX3 (381 aa, ~42 kDa) is encoded by the human PTX3 gene. This protein is involved in both inflammation and complement recognition of pathogens. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C119682 Pentraxin-Related Protein PTX3 Peroxiredoxin-4 Thioredoxin Peroxidase AO372 Thioredoxin-Dependent Peroxide Reductase A0372 Peroxiredoxin-4 Epididymis Secretory Sperm Binding Protein Li 97n Peroxiredoxin IV Antioxidant Enzyme AOE372 Antioxidant Enzyme 372 EC 1.11.1.15 AOE37-2 PRDX4 Prx-IV Peroxiredoxin-4 (271 aa, ~31 kDa) is encoded by the human PRDX4 gene. This protein plays a role in both redox regulation and nuclear factor NF-kappa-B activation in cells. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C116657 Peroxiredoxin-4 Phentolamine PHENTOLAMINE 2-[N-p'-Tolyl-N-(m'-hydroxyphenyl)aminomethyl]imidazoline Phentolamine A synthetic imidazoline with alpha-adrenergic antagonist activity. As a competitive alpha-adrenergic antagonist, phentolamine binds to alpha-1 and alpha-2 receptors, resulting in a decrease in peripheral vascular resistance and vasodilatation. This agent also may block 5-hydroxytryptamine (5-HT) receptors and stimulate release of histamine from mast cells. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C62066 Phentolamine Phospholipase_D4 Phospholipase D4 PLD4 A protein coding gene PLD4 in human. http://purl.obolibrary.org/obo/HGNC_23792 Phospholipase D4 Phosphotyrosine_Interaction_Domain_Containing_1 Phosphotyrosine Interaction Domain Containing 1 PID1 A protein coding gene PID1 in human. http://purl.obolibrary.org/obo/HGNC_26084 Phosphotyrosine Interaction Domain Containing 1 Piperacillin PIPERACILLIN Piperacillin (2S,5R,6R)-6-((R)-2-(4-Ethyl-2,3-dioxo-1-piperazinecarboxamido)-2-phenylacetamido)-3,3-dimethyl-7-oxo-4-thia-1-azabicyclo(3.2.0)heptane-2-carboxylic Acid Monohydrate A broad-spectrum semisynthetic, ampicillin-derived ureidopenicillin antibiotic. Piperacillin binds to penicillin binding proteins (PBP), the enzymes that catalyze the synthesis of peptidoglycan, a critical component of the bacterial cell wall. This blockade leads to the interruption of cell wall synthesis, consequently, leading to bacterial cell growth inhibition and cell lysis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C62069 Piperacillin Placenta_Growth_Factor Placenta Growth Factor Placental Growth Factor-Like Isoform PlGF-3 Placental Growth Factor PGF PLGF-2 PlGF PlGF-203 Placenta growth factor (221 aa, ~25 kDa) is encoded by the human PGF gene. This protein is involved in both angiogenesis and the positive regulation of endothelial cell growth. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C28666 Placenta Growth Factor Plasmin-Antiplasmin_Complex Plasmin/Antiplasmin Complex Plasmin-Antiplasmin Complex Plasmin/Alpha-2-Antiplasmin Complex PAP A protein complex comprised of the serine proteinase plasmin irreversibly bound to its corresponding serine proteinase inhibitor protein (SERPIN) alpha-2-antiplasmin. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C129410 Plasmin-Antiplasmin Complex Plasminogen_Activator_Inhibitor_1 Serine or Cysteine Proteinase Inhibitor Clade E Member 1 Plasminogen Activator Inhibitor-1 Plasminogen Activator Inhibitor Type 1 Endothelial Plasminogen Activator Inhibitor Plasminogen Activator Inhibitor 1 Nexin PAI PAI-1 PAI1 PLANH1 SERPINE1 Serpin E1 Plasminogen activator inhibitor 1 (402 aa, ~45 kDa) is encoded by the human SERPINE1 gene. This protein plays a role in both cell adhesion and the modulation of plasmin activity. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C16947 Plasminogen Activator Inhibitor 1 Polymyxin_B POLYMYXIN B Polymyxin B A mixture of the polypeptides polymyxins B1 and B2, both obtained from Bacillus polymyxa strains, with antimicrobial activity. Polymyxin B exerts its antimicrobial effect through its cationic detergent action on cell membranes. Specifically, this antibiotic binds to the negatively charged site in the lipopolysaccharide layer of the bacterial cell membrane via electrostatic affinity with the positively charged amino groups in the cyclic peptide portion. Subsequently, the fatty acid portion of polymyxin B dissolves in the hydrophobic region of the bacterial cell membrane. This results in an alteration in cell membrane structure, disruption of cell wall integrity and an increase in permeability for water and molecules. This will eventually lead to bacterial cell death. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61894 Polymyxin B Potassium_Chloride Potassium Chloride POTASSIUM CHLORIDE Cena-K K-Lor Klorvess Klotrix Potasalan Slow-K A metal halide composed of potassium and chloride. Potassium maintains intracellular tonicity, is required for nerve conduction, cardiac, skeletal and smooth muscle contraction, production of energy, the synthesis of nucleic acids, maintenance of blood pressure and normal renal function. This agent has potential antihypertensive effects and when taken as a nutritional supplement may prevent hypokalemia. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C47679 Potassium Chloride Prasugrel PRASUGREL Prasugrel An orally bioavailable thienopyridine, with antiplatelet activity. Upon oral administration, the active metabolite of prasugrel targets and irreversibly binds to the platelet receptor for adenosine diphosphate (ADP), thereby blocking the binding of ADP to its receptor. This inhibits ADP-mediated activation of the glycoprotein complex GPIIb/IIIa, fibrinogen binding to platelets and platelet adhesion and aggregation. This results in increased bleeding time. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C81566 Prasugrel Praziquantel Praziquantel PRAZIQUANTEL 4H-Pyrazino(2,1-a)isoquinolin-4-one, 2-(cyclohexylcarbonyl)-1,2,3,6,7,11b-hexahydro- Biltricide Droncit A pyrazinoisoquinoline derivative with anthelminthic property. Praziquantel increases the permeability of the tegument of susceptible worms, resulting in an influx and increase in intra-tegumental calcium leading to rapid contractions and paralysis of the worm's musculature through a subsequent increase in levels of calcium in the sarcoplasmic reticulum. In addition, vacuolization of the tegumental syncytium and blebbing results in tegument disintegration, leads to antigen exposure and elicit host defense responses to the worm. The result is the formation of granulomas and phagocytosis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C47683 Praziquantel Procalcitonin Procalcitonin Pro-CALCA PCT Procalcitonin (116 aa, ~13 kDa) is encoded by the human CALCA gene. This protein plays a role in sepsis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C173465 Procalcitonin Programmed_Cell_Death_1_Ligand_1 CD Antigen CD274 Pdcd1 Ligand 1 Programmed Death Ligand 1 B7 Homolog 1 Programmed Cell Death 1 Ligand 1 CD274 Antigen B7-H1 CD274 PD-L1 PDL1 Programmed cell death 1 ligand 1 (290 aa, ~33 kDa) is encoded by the human CD274 gene. This protein is involved in the mediation of both the activation and proliferation of T cells. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C96024 Programmed Cell Death 1 Ligand 1 Progranulin Progranulin Granulin Precursor PC Cell-Derived Growth Factor Epithelin Precursor Glycoprotein 88 Proepithelin Glycoprotein of 88 kDa GP88 GRN Granulins PCDGF PEPI PGRN Progranulin (593 aa, ~64 kDa) is encoded by the human GRN gene. This protein is involved in lysosome acidification, inflammation and wound healing. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C101403 Progranulin Prolyl_Oligopeptidase Prolyl Oligopeptidase PREP http://phenomebrowser.net/ontologies/mesh/mesh.owl#C022432 Prolyl Oligopeptidase Propofol Diprivan PROPOFOL Propofol A hypnotic alkylphenol derivative. Formulated for intravenous induction of sedation and hypnosis during anesthesia, propofol facilitates inhibitory neurotransmission mediated by gamma-aminobutyric acid (GABA). This agent is associated with minimal respiratory depression and has a short half-life with a duration of action of 2 to 10 minutes. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C29384 Propofol Protein_S Protein S, Vitamin K-Dependent Protein S, Cofactor Vitamin K-Dependent Protein S Cofactor Protein S Vitamin K Dependent Protein S Protein S, Vitamin K Dependent The vitamin K-dependent cofactor of activated PROTEIN C. Together with protein C, it inhibits the action of factors VIIIa and Va. A deficiency in protein S; (PROTEIN S DEFICIENCY); can lead to recurrent venous and arterial thrombosis. http://purl.bioontology.org/ontology/MESH/D017293 Protein S Protein_S100-A12 S100 Calcium-Binding Protein A12 Calcium-Binding Protein In Amniotic Fluid 1 Migration Inhibitory Factor-Related Protein 6 Neutrophil S100 Protein Protein S100-A12 Calgranulin C S100 Calcium Binding Protein A12 Calgranulin-C Extracellular Newly Identified RAGE-Binding Protein CAAF1 CAGC CGRP EN-RAGE ENRAGE MRP6 S100A12 p6 Protein S100-A12 (92 aa, ~11 kDa) is encoded by the human S100A12 gene. This protein plays a role in calcium, zinc, and copper binding and in the regulation of inflammatory processes. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C29926 Protein S100-A12 Protein_S100-A8 Calprotectin L1L Subunit Migration Inhibitory Factor-Related Protein 8 Urinary Stone Protein Band A Leukocyte L1 Complex Light Chain Calgranulin A Myeloid-Related Protein 8 S100 Calcium Binding Protein A8 S100 Calcium-Binding Protein A8 calgranulin A Protein S100-A8 Cystic Fibrosis Antigen S100 calcium binding protein A8 CAGA CFAG CGLA CP-10 L1Ag MIF MRP8 NIF S100A8 p8 Protein S100-A8 (93 aa, ~11 kDa) is encoded by the human S100A8 gene. This protein is involved in calcium and zinc binding and in the modulation of leukocyte functions. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C29927 Protein S100-A8 Protein_S100-A9 Migration Inhibitory Factor-Related Protein 14 Calgranulin B Calprotectin L1H Subunit S100 Calcium Binding Protein A9 Calgranulin-B Myeloid-Related Protein 14 S100 Calcium-Binding Protein A9 calgranulin B Protein S100-A9 Leukocyte L1 Complex Heavy Chain S100 calcium binding protein A9 CAGB CFAG CGLB L1Ag MIF MRP-14 MRP14 NIF S100A9 p14 Protein S100-A9 (114 aa, ~13 kDa) is encoded by the human S100A9 gene. This protein plays a role in the regulation of leukocyte functions and binding to calcium and zinc. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C29928 Protein S100-A9 Pvt1_Oncogene_Long_Non-Coding_RNA Non-Protein Coding RNA 79 PVT1 Long Non-Coding RNA Onco-lncRNA-100 PVT1 MYC Activator Pvt1 Oncogene Long Non-Coding RNA Long Intergenic Non-Protein Coding RNA 79 Oncogene PVT-1 LINC00079 NCRNA00079 PVT-1 PVT1 Pvt1 oncogene long non-coding RNA (~2 kb) is encoded by the human PVT1 gene. This long non-coding RNA may play a role in the positive regulation of MYC gene expression. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C18601 Pvt1 Oncogene Long Non-Coding RNA Quinine (-)-Quinine QUIN QUININE Quinine A quinidine alkaloid isolated from the bark of the cinchona tree. Quinine has many mechanisms of action, including reduction of oxygen intake and carbohydrate metabolism; disruption of DNA replication and transcription via DNA intercalation; and reduction of the excitability of muscle fibers via alteration of calcium distribution. This agent also inhibits the drug efflux pump P-glycoprotein which is overexpressed in multi-drug resistant tumors and may improve the efficacy of some antineoplastic agents. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C794 Quinine REG1A_Gene Regenerating Family Member 1 Alpha Gene REG1A REG1A Gene This gene may be involved in cell proliferation in the brain and pancreas. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C131322 REG1A Gene REG3A_Gene Regenerating Islet-Derived 3 Alpha Gene REG3A REG3A Gene This gene may be involved in pancreatic cell proliferation and differentiation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C105382 REG3A Gene REN_Gene REN REN Gene Renin Gene This gene plays a role in angiotensin metabolism. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C113589 REN Gene RETN_Gene Resistin Gene RETN RETN Gene This gene plays a role in the modulation of insulin activity. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C113641 RETN Gene RFTN1_Gene RAFTLIN PIB10 PIG9 RFTN1 Other designations: cell migration-inducing gene 2 protein|proliferation-inducing protein 10|proliferation-inducing protein 9|raft-linking protein|raftlin http://purl.obolibrary.org/obo/OGG_3000023180 RFTN1 Gene RGL4_Gene Ral Guanine Nucleotide Dissociation Stimulator-Like 4 Gene RGL4 RGL4 Gene This gene plays a role in guanyl-nucleotide metabolism. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C113576 RGL4 Gene Raftlin cell migration-inducing gene 2 protein Raft-linking protein RFTN1 MIG2 KIAA0084 A protein that is a translation product of the human RFTN1 gene or a 1:1 ortholog thereof. http://purl.obolibrary.org/obo/PR_000013920 Raftlin Ral-GDS-Related_Protein RalGDS-Like 4 RalGDS Related Oncogene Ral-GDS Related Protein Ral-GDS Related Protein Rgr Ral-GDS-Related Protein RGL4 Ral-GDS-related protein (473 aa, ~52 kDa) is encoded by the human RGL4 gene. This protein plays a role in in the metabolism of guanine nucleotides. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C113578 Ral-GDS-Related Protein Recombinant_Granulocyte-Macrophage_Colony-Stimulating_Factor Recombinant Granulocyte-Macrophage Colony-Stimulating Factor Recombinanr Colony-Stimulating Factor 2 Colony-Stimulating Factor, Granulocyte-Macrophage CSF 39300/GM-CSF GM-CSF (Schering) CSF-GM (Hoechst) Recombinant Colony-Stimulating Factor 2 CSF 39300 GM CSF GM-CSF GMCSF A recombinant therapeutic agent which is chemically identical to or similar to the endogenous glycoprotein cytokine growth factor granulocyte-macrophage colony stimulating factor (GM-CSF). Therapeutic GM-CSF induces the clonal expansion and differentiation of progenitor blood cells and stimulates the cytotoxicity of monocytes and neutrophils, thereby restoring immune function and host antitumor immune responses and stimulating engraftment of transplanted bone marrow tissue. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C1288 Recombinant Granulocyte-Macrophage Colony-Stimulating Factor Regenerating_Islet-Derived_Protein_3-Alpha Regenerating Islet-Derived Protein III-Alpha Proliferation-Inducing Protein 42 Human Proislet Peptide Hepatointestinal Pancreatic Protein Regenerating Islet-Derived Protein 3-Alpha Islet Neogenesis Associated Protein Proliferation-Inducing Protein 34 Pancreatitis-Associated Protein PAP Homologous Protein Reg III-Alpha Islet Neogenesis-Associated Protein Pancreatitis-Associated Protein 1 REG-3-Alpha Pancreatic Beta Cell Growth Factor HIP/PAP INGAP REG3A Regenerating islet-derived protein 3-alpha (175 aa, ~19 kDa) is encoded by the human REG3A gene. This protein may be involved in pancreatic inflammation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C105384 Regenerating Islet-Derived Protein 3-Alpha Remifentanil REMIFENTANIL Remifentanil http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C66513 Remifentanil Renin Renin Precursor, Renal EC 3.4.23.15 Angiotensin-Forming Enzyme Angiotensinogenase REN Renin Renin (406 aa, ~45 kDa) is encoded by the human REN gene. This protein plays a role in activation of angiotensin. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C113591 Renin Resistin C/EBP-Epsilon-Regulated Myeloid-Specific Secreted Cysteine-Rich Protein Cysteine-Rich Secreted Protein A12-Alpha-Like 2 Adipose Tissue-Specific Secretory Factor C/EBP-Epsilon Regulated Myeloid-Specific Secreted Cysteine-Rich Protein Precursor 1 Cysteine-Rich Secreted Protein FIZZ3 Resistin RETN Resistin (108 aa, ~11 kDa) is encoded by the human RETN gene. This protein plays a role in the regulation of insulin-mediated glucose metabolism. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C113643 Resistin Rivaroxaban Rivaroxaban 5-Chloro-N-(((5S)-2-oxo-3-(4-(3-oxomorpholin-4-yl)phenyl)- 1,3-oxazolidin-5-yl)methyl)thiophene-2-carboxamide RIVAROXABAN BAY 59-7939 Xarelto An orally bioavailable oxazolidinone derivative and direct inhibitor of the coagulation factor Xa with anticoagulant activity. Upon oral administration, rivaroxaban selectively binds to both free factor Xa and factor Xa bound in the prothrombinase complex. This interferes with the conversion of prothrombin (factor II) to thrombin and eventually prevents the formation of cross-linked fibrin clots. Rivaroxaban does not affect existing thrombin levels. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C77995 Rivaroxaban Roxithromycin Roxitromycine Roxithromycin 9-(2',5'-Dioxahexyloxyimino)erythromycin (3R,4S,5S,6R,7R,9R,11S,12R,13S,14R)-6-[(2S,3R,4S,6R)-4-d-3-hydroxy-6-methyloxan-2-yl]oxy-14-ethyl-7,12,13-trihydroxy-4-[(2R,4R,5S,6S)-5-hydroxy-4-methoxy-4,6-dimethyloxan-2-yl]oxy-10-(2-methoxyethoxymethoxyimino)-3,5,7,9,11,13-hexamethyl-1-oxacyclotetradecan-2-one (9E)-Erythromycin, 9-[O-[(2-methoxyethoxy)methyl]oxime] ROXITHROMYCIN RU 28965 RU 965 Rulide A semi-synthetic derivative of the macrolide antibiotic erythromycin that includes an N-oxime side chain on the lactone ring, with antibacterial and anti-malarial activities. Roxithromycin binds to the subunit 50S of the bacterial ribosome, which inhibits bacterial protein synthesis and leads to inhibition of bacterial cell growth and replication. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C818 Roxithromycin S100A12_Gene S100A12 Gene S100 Calcium Binding Protein A12 Gene S100A12 This gene is involved in calcium-dependent signal transduction pathways and cytoskeletal regulation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C24760 S100A12 Gene S100A8_Gene S100A8 Gene S100 Calcium Binding Protein A8 Gene S100A8 This gene plays a regulatory role in calcium-binding interactions and may play a role in intermediate filament regulation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C24761 S100A8 Gene S100A9_Gene S100 Calcium Binding Protein A9 Gene S100A9 Gene S100A9 This gene plays a regulatory role in calcium-binding interactions and may play a role in intermediate filament regulation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C24762 S100A9 Gene SCUBE1_Gene SCUBE1 Gene Other designations: signal peptide, CUB and EGF-like domain-containing protein 1|signal peptide-CUB domain-EGF-related 1 http://purl.obolibrary.org/obo/OGG_3000080274 SCUBE1 Gene SDC1_Gene Syndecan 1 Gene CD138 SDC1 SDC1 Gene This gene is involved in cell adhesion, signal transduction and cytoskeleton organization. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C96912 SDC1 Gene SELENOP_Gene SELENOP Gene Selenoprotein P Gene SELENOP SEPP1 This gene is involved in selenium metabolism. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C105737 SELENOP Gene SELE_Gene Selectin E Gene SELE SELE Gene This gene plays a role in inflammation by mediating cellular adhesion to vasculature. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C21043 SELE Gene SERPINA1_Gene Serpin Family A Member 1 Gene SERPINA1 Gene SERPINA1 This gene plays a role in both coagulation and the regulation of proteolysis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C105010 SERPINA1 Gene SERPINC1_Gene SERPINC1 Gene Serpin Peptidase Inhibitor, Clade C (Antithrombin), Member 1 Gene SERPINC1 ATIII Antithrombin III This gene is involved in the regulation of the coagulation cascade. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C104681 SERPINC1 Gene SERPINE1_Gene SERPINE1 Gene Serpin Family E Member 1 Gene SERPINE1 This gene is involved in the control of blood coagulation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C39650 SERPINE1 Gene SIGLEC10_Gene SIGLEC10 Gene Sialic Acid Binding Ig Like Lectin 10 Gene SIGLEC10 This gene is involved in sialic acid binding and immunoregulation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C171288 SIGLEC10 Gene SIRT2_Gene Sirtuin 2 Gene SIRT2 SIRT2 Gene This gene plays a role in protein acetylation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C101562 SIRT2 Gene SIRT3_Gene Sirtuin 3 Gene SIRT3 SIRT3 Gene This gene plays a role in the regulation of protein acetylation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C95589 SIRT3 Gene SMPD3_Gene Sphingomyelin Phosphodiesterase 3, Neutral Membrane (Neutral Sphingomyelinase II) Gene SMPD3 SMPD3 Gene This gene plays a role in phospholipid metabolism. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C105029 SMPD3 Gene SNHG7_Gene SNHG7 NCRNA00061 http://purl.obolibrary.org/obo/OGG_3000084973 SNHG7 Gene SPP1_Gene Secreted Phosphoprotein 1 Gene SPP1 SPP1 Gene This gene is involved in signaling and tissue mineralization. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C95570 SPP1 Gene Sarpogrelate SARPOGRELATE Sarpogrelate http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C73158 Sarpogrelate Scavenger_Receptor_Cysteine-Rich_Type_1_Protein_M130 CD163 Molecule Antigen CD163 Macrophage-Associated Antigen Hemoglobin Scavenger Receptor Scavenger Receptor Cysteine-Rich Type 1 Protein M130 CD163 Antigen CD163 Scavenger receptor cysteine-rich type 1 protein M130 (1156 aa, ~125 kDa) is encoded by the human CD163 gene. This protein plays a role in clearance and endocytosis of hemoglobin/haptoglobin complexes by macrophages. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C104064 Scavenger Receptor Cysteine-Rich Type 1 Protein M130 Selenoprotein_P Selenoprotein P SELENOP SEPP1 SeP Selenoprotein P (381 aa, ~43 kDa) is encoded by the human SELENOP gene. This protein is involved in the modulation of selenium metabolism. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C105739 Selenoprotein P Serum_Amyloid_A Serum Amyloid A SAA A family of apolipoproteins that are associated with high-density lipoprotein particles in the serum. These proteins may play a role in both the acute-phase of inflammation and in cholesterol transport. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C105940 Serum Amyloid A Sialic_Acid-Binding_Ig-Like_Lectin_10 Sialic Acid-Binding Ig-Like Lectin 10 Siglec-Like Protein 2 Sialic Acid Binding Ig-Like Lectin 10 SIGLEC10 Siglec-10 Sialic acid-binding Ig-like lectin 10 (697 aa, ~77 kDa) is encoded by the human SIGLEC10 gene. This protein is involved in immunoregulation and carbohydrate binding. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C171290 Sialic Acid-Binding Ig-Like Lectin 10 Small_Nucleolar_RNA_Host_Gene_7 SNHG7 NCRNA00061 MGC16037 http://identifiers.org/hgnc/28254 Small Nucleolar RNA Host Gene 7 Sodium_Nitroprusside Sodium Nitroprusside SODIUM NITROPRUSSIDE http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C66544 Sodium Nitroprusside Sphingomyelin_Phosphodiesterase Acid Sphingomyelinase Sphingomyelinase, Acid EC 3.1.4.12 Sphingomyelin Phosphodiesterase SMPD1 aSMase Sphingomyelin phosphodiesterase (629 aa, ~70 kDa) is encoded by the human SMPD1 gene. This protein plays a role in sphingomyelin catabolism. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C105021 Sphingomyelin Phosphodiesterase Spironolactone Spironolactone 17-Hydroxy-7alpha-mercapto-3-oxo-17alpha-pregn-4-ene-21-carboxylic Acid, gamma Lactone, Acetate SPIRONOLACTONE Aldactone SC 9420 SPL A synthetic 17-spironolactone corticosteroid with potassium-sparing diuretic, antihypertensive, and antiandrogen activities.Spironolactone competitively inhibits adrenocortical hormone aldosterone activity in the distal renal tubules, myocardium, and vasculature. This agent may inhibit the pathophysiologic effects of aldosterone produced in excess by various types of malignant and benign tumors. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C840 Spironolactone Streptomycin Streptomycin STREPTOMYCIN An aminoglycoside antibiotic derived from Streptomyces griseus with antibacterial activity. Streptomycin irreversibly binds to the 16S rRNA and S12 protein within the bacterial 30S ribosomal subunit. As a result, this agent interferes with the assembly of initiation complex between mRNA and the bacterial ribosome, thereby inhibiting the initiation of protein synthesis. In addition, streptomycin induces misreading of the mRNA template and causes translational frameshift, thereby results in premature termination. This eventually leads to bacterial cell death. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61952 Streptomycin Stromal_Cell-Derived_Factor_1 C-X-C Motif Chemokine 12 Intercrine Reduced In Hepatomas Stromal Cell-Derived Factor 1 Chemokine (C-X-C Motif) Ligand 12 Pre-B Cell Growth-Stimulating Factor SDF-1-Beta(1-72) Pre-B Cell Growth Stimulating Factor CXCL12 IRH PBSF SDF-1 SDF1 hIRH hSDF-1 hSDF-1beta Stromal cell-derived factor 1 (93 aa, ~11 kDa) is encoded by the human CXCL12 gene. This protein is involved in signal transduction and chemotaxis of T-lymphocytes, and monocytes. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C28774 Stromal Cell-Derived Factor 1 Stromelysin-2 Stromelysin-II EC 3.4.24.22 Matrix Metalloprotease 10 Matrix Metalloproteinase-10 Stromelysin-2 Matrix Metalloprotease-10 Matrix Metalloproteinase 10 MMP-10 MMP10 SL-2 Transin-2 Stromelysin-2 (476 aa, ~54 kDa) is encoded by the human MMP10 gene. This protein plays a role in the metabolism of the extracellular matrix. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C101761 Stromelysin-2 Sufentanil SUFENTANIL Sufentanil http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61956 Sufentanil Sulbactam (2S,5R)-3,3-Dimethyl-7-oxo-4-thia-1-azabicyclo(3.2.0)heptane-2-carboxylic Acid 4,4-dioxide CP 45899 SULBACTAM Sulbactam A semi-synthetic beta-lactamase inhibitor. The beta-lactam ring of sulbactam irreversibly binds to beta-lactamase at or near its active site, thereby blocking enzyme activity and preventing metabolism of other beta-lactam antibiotics by the enzyme. Combining this agent with a beta-lactamase susceptible antibiotic, such as penicillins or a cephalosporin, to treat infections caused by beta-lactamase producing organisms, results in a decreased turnover rate of the beta-lactamase sensitive antibiotic and enhances its antibacterial activity. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61957 Sulbactam Sulfadiazine SULFADIAZINE Sulfadiazine A synthetic pyrimidinyl sulfonamide derivative, short-acting bacteriostatic Sulfadiazine inhibits bacterial folic acid synthesis by competing with para amino benzoic acid. It is used in combination with pyrimethamine to treat toxoplasmosis in patients with acquired immunodeficiency syndrome and in newborns with congenital infections. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C29468 Sulfadiazine Sulfamethoxazole SULFAMETHOXAZOLE Benzenesulfonamide, 4-amino-N-(5-methyl-3-isoxazolyl)- Sulfisomezole Sulfanilamide, N'-(5-methyl-3-isoxazolyl)- Sulfamethoxazole Gamazole Metoxal Radonil A sulfonamide bacteriostatic antibiotic that is most commonly used in combination with trimethoprim as the drug Bactrim. Sulfamethoxazole competitively inhibits dihydropteroate synthase preventing the formation of dihydropteroic acid, a precursor of folic acid which is required for bacterial growth. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C47737 Sulfamethoxazole Syndecan-1 Antigen CD138 CD138 Antigen CD138 SDC1 SYND1 Syndecan-1 Syndecan-1 (310 aa, ~32 kDa) is encoded by the human SDC1 gene. This protein is involved in the mediation of cell adhesion, signaling and cytoskeletal organization. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C96914 Syndecan-1 T-Lymphocyte_Activation_Antigen_CD80 B71 Antigen B-lymphocyte Activation Antigen B7-1 T-Lymphocyte Activation Antigen CD80 CD80 Antigen Activation B7-1 Antigen CTLA-4 Counter-Receptor B7.1 CD28 Antigen Ligand 1 B7 B7-1 BB1 CD28LG CD28LG1 CD80 LAB7 T-lymphocyte activation antigen CD80 (288 aa, ~33 kDa) is encoded by the human CD80 gene. This protein is involved in the regulation of T-cell activation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C15173 T-Lymphocyte Activation Antigen CD80 T-Lymphocyte_Activation_Antigen_CD86 Activation B7-2 Antigen T-Lymphocyte Activation Antigen CD86 B-Lymphocyte Antigen B7.2 CTLA-4 Counter-Receptor B7.2 B-Lymphocyte Activation Antigen B7-2 B72 Antigen CD28 Antigen Ligand 2 CD86 Antigen B70 BU63 FUN-1 T-lymphocyte activation antigen CD86 (329 aa, ~38 kDa) is encoded by the human CD86 gene. This protein plays a role in signal transduction that mediates T-cell proliferation and interleukin gene transcription. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C78147 T-Lymphocyte Activation Antigen CD86 TFF1_Gene Trefoil Factor 1 Gene TFF1 TFF1 Gene This gene is involved in maintenance of gastric mucosal integrity and regulates gastric cell proliferation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20872 TFF1 Gene TGFB1_Gene Transforming Growth Factor, Beta 1 (Camurati-Engelmann Disease) Gene TGFB1 TGFB1 Gene This gene plays a role in cell growth, proliferation and biogenesis/organization. It is also involved in the inhibition of apoptosis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C24856 TGFB1 Gene THBD_Gene Thrombomodulin Gene THBD THBD Gene CD141 This gene plays a role in the modulation of blood coagulation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C101378 THBD Gene THBS1_Gene Thrombospondin 1 Gene THBS1 THBS1 Gene This gene plays a role in the mediation of both intercellular and cell-matrix interactions. It is also involved in platelet aggregation and angiogenesis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C28661 THBS1 Gene THPO_Gene Thrombopoietin Gene THPO THPO Gene This gene plays a role in promoting megakaryocytopoiesis, the cellular development process that leads to platelet production. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C18458 THPO Gene TIMP1_Gene Tissue Inhibitor of Metalloproteinase 1 (Erythroid Potentiating Activity, Collagenase Inhibitor) Gene TIMP1 TIMP1 Gene This gene plays a role in the degradation of the extracellular matrix. It is also involved in the promotion of cell proliferation and inhibition of apoptosis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C28675 TIMP1 Gene TJP1_Gene Tight Junction Protein 1 Gene TJP1 TJP1 Gene ZO-1 ZO1 This gene plays a role in cell-cell adhesion. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C114822 TJP1 Gene TNFSF12_Gene TNFSF12 Gene Tumor Necrosis Factor (Ligand) Superfamily, Member 12 Gene TNFSF12 This gene plays a role in angiogenesis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C117066 TNFSF12 Gene TNF_Gene Tumor Necrosis Factor (TNF Superfamily, Member 2) Gene TNF TNF Gene This gene is involved in apoptosis, cell growth and cell proliferation. It also plays a role in immune and inflammatory responses. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C18368 TNF Gene TNNI3_Gene Troponin I3, Cardiac Type Gene TNNI3 TNNI3 Gene This gene is involved in cardiac muscle contraction. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C104223 TNNI3 Gene TREM1_Gene Triggering Receptor Expressed On Myeloid Cells 1 Gene TREM1 TREM1 Gene This gene is involved in the stimulation of neutrophil and monocyte-mediated inflammatory responses. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C178290 TREM1 Gene TSLP_Gene Thymic Stromal Lymphopoietin Gene TSLP TSLP Gene This gene plays a regulatory role in the development of B lymphocytes. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C24883 TSLP Gene Tazobactam (2S,3S,5R)-3-Methyl-7-oxo-3-(1H-1,2,3-triazol-1-ylmethyl)-4-thia-1-azabicyclo(3.2.0)heptane-2-carboxylic acid, 4,4-dioxide TAZOBACTAM Tazobactam YTR-830H A penicillanic acid sulfone derivative and beta-lactamase inhibitor with antibacterial activity. Tazobactam contains a beta-lactam ring and irreversibly binds to beta-lactamase at or near its active site. This protects other beta-lactam antibiotics from beta-lactamase catalysis. This drug is used in conjunction with beta-lactamase susceptible penicillins to treat infections caused by beta-lactamase producing organisms. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C62079 Tazobactam Telithromycin TELITHROMYCIN Telithromycin (1S,2R,5R,7R,8R,9S,11R,13R,14R)-8-[(2S,3R,4S,6R)-4-dimethylamino-3-hydroxy-6-methyl-oxan-2-yl]oxy-2-ethyl-9-methoxy-1,5,7,9,11,13-hexamethyl-15-[4-(4-pyridin-3-ylimidazol-1-yl)butyl]-3,17-dioxa-15-azabicyclo[12.3.0]heptadecane-4,6,12,16-tetrone Ketek http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C61963 Telithromycin Terbinafine Terbinafine TERBINAFINE (E)-N-(6,6-Dimethyl-2-hepten-4-ynyl)-N-methyl-1-naphthalene Methanamine SF 86-327 A synthetic allylamine derivative with antifungal activity. Terbinafine exerts its effect through inhibition of squalene epoxidase, thereby blocking the biosynthesis of ergosterol, an important component of fungal cell membranes. As a result, this agent disrupts fungal cell membrane synthesis and inhibits fungal growth. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C48019 Terbinafine Tetracycline 4-(Dimethylamino)-1,4,4A,5,5A,6,11,12A-Octahydro-3,6,10,12,12A-Pentahydroxy-6-Methyl-1,11-Dioxo-2-Naphthacenecarboxamide TETRACYCLINE tetracycline Tetracycline TCN A broad-spectrum naphthacene antibiotic produced semisynthetically from chlortetracycline, an antibiotic isolated from the bacterium Streptomyces aureofaciens. In bacteria, tetracycline binds to the 30S ribosomal subunit, interferes with the binding of aminoacyl-tRNA to the mRNA-ribosome complex, thereby inhibiting protein synthesis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C865 Tetracycline Therapeutic_Epinephrine EPINEPHRINE Epinephrine Therapeutic Epinephrine Epinephrine autoinjector Adrenal Adrenaline Epi Epipen adrenaline The synthetic form of the naturally occurring sympathomimetic amine with vasoconstricting, intraocular pressure-reducing, and bronchodilating activities. By stimulating vascular alpha-adrenergic receptors, epinephrine causes vasoconstriction, thereby increasing vascular resistance and blood pressure. When administered in the conjunctiva, this agent binds to alpha-adrenergic receptors in the iris sphincter muscle, resulting in vasoconstriction, a decrease in the production of aqueous humor, and a lowering of intraocular pressure. Through its beta1 receptor-stimulating actions, epinephrine increases the force and rate of myocardial contraction and relaxes bronchial smooth muscle, resulting in bronchodilation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C473 Therapeutic Epinephrine Thrombomodulin Antigen CD141 Fetomodulin Thrombomodulin CD141 Antigen BDCA-3 CD141 TM Thrombomodulin (575 aa, ~60 kDa) is encoded by the human THBD gene. This protein plays a role in thrombin binding, fibrinolysis and coagulation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C101380 Thrombomodulin Thrombopoietin Megakaryocyte Colony-Stimulating Factor Megakaryocyte Stimulating Factor C-MPL Ligand Megakaryocyte Growth and Development Factor Megakaryocyte Colony Stimulating Factor Thrombopoietin thrombopoietin Prepro-Thrombopoietin Myeloproliferative Leukemia Virus Oncogene Ligand MGDF ML MPL Ligand THPO TPO TSF Thrombopoietin (353 aa, ~38 kDa) is encoded by the human THPO gene. This protein is involved in both megakaryocyte differentiation and platelet activation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20441 Thrombopoietin Thrombospondin-1 Thrombospondin-1 Thrombospondin 1 THBS1 TSP TSP-1 TSP1 Thrombospondin-1 (1170 aa, ~129 kDa) is encoded by the human THBS1 gene. This protein plays a role in both cell-cell and cell-matrix interactions. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C17547 Thrombospondin-1 Thymic_Stromal_Lymphopoietin Thymic Stromal Lymphopoietin Protein TSLP Thymic Stromal Lymphopoietin TSLP Thymic stromal lymphopoietin (159 aa, ~18 kDa) is encoded by the human TSLP gene. This protein plays a role in the induction of chemokine release. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C30135 Thymic Stromal Lymphopoietin Ticagrelor Thioxlant-6C AR-C126532XX (1S,2S,3R,5S)-3-(7-((1R,2S)-2-(3,4-Difluorophenyl)cyclopropylamino)-5-(propylthio)-3H-(1,2,3)triazolo(4,5-d)pyrimidin-3-yl)-5-(2-hydroxyethoxy)cyclopentane-1,2-diol AZD6140 Brilinta Brilique TICAGRELOR Ticagrelor Ticalog An orally bioavailable cyclopentyltriazolopyrimidine, with antiplatelet activity. Upon oral administration, ticagrelor and its major metabolite targets and reversibly binds to the platelet adenosine diphosphate (ADP) P2Y12 receptor (P2Y12R) at a site distinct from that of the endogenous agonist ADP. This blocks the platelet signaling pathway, thereby inhibiting the activation of the glycoprotein complex GPIIb/IIIa, fibrinogen binding to platelets and platelet adhesion and aggregation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C76404 Ticagrelor Tigecycline Tigecycline TIGECYCLINE Tygacil A broad-spectrum glycylcycline antibiotic derived from tetracycline. Tigecycline binds to the 30S ribosomal subunit, thereby interfering with the binding of aminoacyl-tRNA to the mRNA-ribosome complex. This prevents the incorporation of amino acid residues into the elongating peptide chain, inhibiting protein synthesis and eventually bacterial cell growth. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C72865 Tigecycline Tight_Junction_Protein_ZO-1 Zonula Occludens Protein 1 Tight Junction Protein ZO-1 Tight Junction Protein 1 Zonula Occludens 1 Protein Zona Occludens Protein 1 TJP1 ZO-1 ZO1 Tight junction protein ZO-1 (1748 aa, ~195 kDa) is encoded by the human TJP1 gene. This protein plays a role in tight junction formation and signal transduction. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C114824 Tight Junction Protein ZO-1 Tinidazole Fasigyn Simplotan TDZ TINIDAZOLE Tindamax Tinidazole tinidazole A 5-nitroimidazole derivative with antiprotozoal property. Although the mechanism of action has not been fully elucidated, it has been suggested that tinidazole is metabolized and yields nitrite anions and metronidazole. Metronidazole's nitro group in turn is reduced via the parasite ferredoxin, thereby generating a series of free nitro radicals including nitro anions. Toxicity is achieved via depletion of sulfhydryl groups and DNA strand breaks with multiple hits having an additive effect and ultimately leading to cell death. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C890 Tinidazole Tirofiban TIROFIBAN Tirofiban A non-peptide tyrosine derivative, with anticoagulant activity. Upon administration, tirofiban antagonizes fibrinogen binding to the platelet cell surface receptor, glycoprotein (GP) IIb/IIIA complex, one of the two purinergic receptors activated by ADP. This prevents the GP IIb/IIIa receptor complex-mediated activation of adenylyl cyclase. This results in decreased levels of cAMP, interferes with the platelet membrane function and subsequent platelet-platelet interaction, prevents the release of platelet granule constituents and prolongs bleeding time. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C76405 Tirofiban Tissue_Factor Tissue Thromboplastin CD142 Antigen Tissue Factor Thromboplastin Coagulation Factor III F3 F3 Protein Factor III TF Tissue factor (295 aa, ~33 kDa) is encoded by the human F3 gene. This protein is involved in both binding to coagulation factor VII and the initiation of blood coagulation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C17197 Tissue Factor Tobramycin TOBRAMYCIN Tobramycin An aminoglycoside antibiotic derived from Streptomyces tenebrarius with bacteriostatic activity. Following active transport into the cell, tobramycin binds irreversibly to a specific aminoglycoside receptor on the bacterial 30S ribosomal subunit and interferes with the initiation complex between messenger RNA and the 30S subunit, thereby inhibiting initiation of protein synthesis, consequently leading to bacterial cell death. In addition, tobramycin induces misreading of the mRNA template causing incorrect amino acids to be incorporated into the growing polypeptide chain, consequently interfering with protein elongation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C62082 Tobramycin Toll-Like_Receptor_2 CD282 Antigen Toll-Like Receptor 2 Toll/Interleukin 1 Receptor-Like 4 Toll/Interleukin 1 Receptor-Like Protein TIL4 TLR2 Toll-like receptor 2 (784 aa, ~90 kDa) is encoded by the human TLR2 gene. This protein is involved in signal transduction that modulates innate immunity. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C30102 Toll-Like Receptor 2 Torsemide TORSEMIDE Torasemide Torsemide An anilinopyridine sulfonylurea belonging to the class of loop diuretics. Torsemide has a prolonged duration of action compared to other loop diuretics, is extensively protein bound in plasma and has a relatively long half-life. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C29506 Torsemide Transforming_Growth_Factor_Beta-1 Transforming Growth Factor-Beta 1 Transforming Growth Factor Beta-1 TGF-Beta 1 TGF-Beta-1 TGF-Beta1 TGFB1 Transforming growth factor beta-1 (390 aa, ~44 kDa) is encoded by the human TGFB1 gene. This protein is involved in cell proliferation, cell death and a large number of signal transduction pathways. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20457 Transforming Growth Factor Beta-1 Trefoil_Factor_1 Gastrointestinal Trefoil Protein pS2 Trefoil Protein 1 pS2 Protein Polypeptide P1.A Trefoil Factor 1 Breast Cancer Estrogen-Inducible Protein Protein pS2 PNR-2 TFF1 hP1.A pS2 Trefoil factor 1 (84 aa, ~9 kDa) is encoded by the human TFF1 gene. This protein is involved in the maintenance of the gastrointestinal mucosa. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C17330 Trefoil Factor 1 Triggering_Receptor_Expressed_On_Myeloid_Cells_1 CD354 Antigen Triggering Receptor Expressed On Myeloid Cells 1 Triggering Receptor Expressed On Monocytes 1 TREM-1 TREM1 Triggering receptor expressed on myeloid cells 1 (234 aa, ~26 kDa) is encoded by the human TREM1 gene. This protein is involved in the stimulation of inflammation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C178292 Triggering Receptor Expressed On Myeloid Cells 1 Troponin_T TNNT Troponin T Troponin I, troponin T, and troponin C are the three closely associated subunits of the troponin complex of thin filaments in muscle. The complex serves as a calcium-sensitive switch that regulates muscle contraction. Troponin T binds tropomyosin to the troponin complex and inhibits F-actin-myosin interactions. The troponin T gene family comprises three isoforms: slow skeletal (TNNT1), cardiac (TNNT2) and fast skeletal (TNNT3). Because it is not normally found in blood, cardiac troponin-T in serum is a sensitive indicator of myocardial cell injury. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C38041 Troponin T Tumor_Necrosis_Factor Tumor Necrosis Factor-alpha (macrophage-derived) Tumor Necrosis Factor-Alpha Tumor Necrosis Factor Tumor Necrosis Factor Alpha Tumor Necrosis Factor Ligand Superfamily Member 2 TNF TNF Alpha TNF-A TNF-Alpha TNFA Tumor necrosis factor (233 aa, ~26 kDa) is encoded by the human TNF gene. This protein is involved in the induction of cytokine expression, the stimulation of cell proliferation and the positive regulation of cell differentiation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20535 Tumor Necrosis Factor Tumor_Necrosis_Factor_Ligand_Superfamily_Member_12 APO3 Ligand TNF-Related Weak Inducer of Apoptosis Tumor Necrosis Factor Ligand Superfamily Member 12 APO3/DR3 Ligand TNF Superfamily Member 12 TNFSF12 TWEAK Tumor necrosis factor ligand superfamily member 12 (249 aa, ~27 kDa) is encoded by the human TNFSF12 gene. This protein plays a role in the positive regulation of angiogenesis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C117068 Tumor Necrosis Factor Ligand Superfamily Member 12 Urapidil URAPIDIL Urapidil http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C152806 Urapidil Urokinase-Type_Plasminogen_Activator EC 3.4.21.73 urokinase-plasminogen activator U-Plasminogen Activator Urokinase-Type Plasminogen Activator Urinary Plasminogen Activator Plasminogen Activator, Urinary Plasminogen Activator, Urokinase Urokinase Plasminogen Activator u-plasminogen activator PLAU Urokinase u-PA uPA urokinase Urokinase-type plasminogen activator (431 aa, ~49 kDa) is encoded by the human PLAU gene. This protein plays a role in both cell surface receptor binding and the cleavage of plasminogen between Arg-580 and Val-581 to form the fibrinolytic enzyme plasmin. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C17242 Urokinase-Type Plasminogen Activator Urokinase_Plasminogen_Activator_Surface_Receptor Urokinase Plasminogen Activator Surface Receptor Urokinase Receptor Urokinase-type Plasminogen Activator Receptor Monocyte Activation Antigen Mo3 CD87 Antigen U-Plasminogen Activator Receptor UPA Receptor Urokinase Plasminogen Activator Receptor Plasminogen Activator, Urokinase Receptor CD87 U-PAR uPAR PLAUR Urokinase plasminogen activator surface receptor (335 aa, ~37 kDa) is encoded by the human PLAUR gene. This protein is involved in urokinase localization, plasmin formation, and signal transduction. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C17321 Urokinase Plasminogen Activator Surface Receptor V-set_and_Transmembrane_Domain-containing_Protein_1 V-set and Transmembrane Domain-containing Protein 1 VSTM1 A protein coding gene VSTM1 in human. http://purl.obolibrary.org/obo/HGNC_29455 V-set and Transmembrane Domain-containing Protein 1 VDR_Gene Vitamin D Receptor Gene VDR VDR Gene This gene plays a role in transcriptional regulation and in vitamin D3 metabolism. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C18503 VDR Gene VIM_Gene Vimentin Gene VIM VIM Gene This gene plays an important role in cytoskeletal structure during embryogenesis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C48796 VIM Gene VSTM1_Gene UNQ3033 SIRL1 Other designations: LAIR homolog|OSCAR-like transcript-1|V-set and transmembrane domain-containing protein 1|signal inhibitory receptor on leukocytes-1 http://purl.obolibrary.org/obo/OGG_3000284415 VSTM1 Gene Vancomycin VANCOMYCIN Vancomycin vancomycin A branched tricyclic glycosylated peptide with bactericidal activity against most organisms and bacteriostatic effect on enterococci. At a site different from that of penicillins and cephalosporins, vancomycin binds tightly to the D-alanyl-D-alanine portion of cell wall precursors, thereby interfering with bacterial cell wall synthesis. This leads to activation of bacterial autolysins that destroy the cell wall by lysis. Vancomycin may also alter the permeability of bacterial cytoplasmic membranes and may selectively inhibit RNA synthesis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C925 Vancomycin Vascular_Endothelial_Growth_Factor_Receptor_1 Vascular Endothelial Growth Factor Receptor 1 Vascular Permeability Factor Receptor Tyrosine Protein Kinase Receptor FLT Tyrosine-Protein Kinase FRT Fms-Like Tyrosine Kinase 1 Receptor Tyrosine Kinase,Class V EC 2.7.10.1 Tyrosine Protein Kinase FRT Tyrosine-Protein Kinase Receptor FLT Vascular Endothelial Growth Factor Receptor FLT FLT-1 FLT1 Flt-1 VEGFR VEGFR-1 VEGFR1 Vascular endothelial growth factor receptor 1 (1338 aa, ~151 kDa) is encoded by the human FLT1 gene. This protein is involved in angiogenesis, tyrosine phosphorylation, ligand binding and signal transduction. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C17975 Vascular Endothelial Growth Factor Receptor 1 Vascular_Endothelial_Growth_Factor_Receptor_2 Vascular Endothelial Growth Factor Receptor 2 Kinase Insert Domain Receptor Protein-Tyrosine Kinase Receptor Flk-1 EC 2.7.1.112 CD309 Antigen Antigen CD309 EC 2.7.10.1 Fetal Liver Kinase 1 Kinase Insert Domain Receptor (A Type III Receptor Tyrosine Kinase) CD309 FLK-1 KDR VEGFR-2 VEGFR2 Vascular endothelial growth factor receptor 2 (1356 aa, ~152 kDa) is encoded by the human KDR gene. This protein is involved in ligand-dependent signaling, vasculogenesis and tyrosine phosphorylation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C28496 Vascular Endothelial Growth Factor Receptor 2 Vimentin Epididymis Luminal Protein 113 Vimentin Protein VIM Vimentin Vimentin (466 aa, ~54 kDa) is encoded by the human VIM gene. This protein plays a role in the localization of organelles and other cellular components. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C48797 Vimentin Vitamin_D-Binding_Protein Vitamin D-Binding Alpha-Globulin Group-Specific Component Gc Protein-Derived Macrophage Activating Factor Vitamin D-Binding Protein Vitamin D-Binding Protein-Macrophage Activating Factor Gc-Globulin Epididymis Secretory Protein Li 51 DBP DBP-maf Gc Gc-MAF GcMAF VDBP Vitamin D-binding protein (474 aa, ~53 kDa) is encoded by the human GC gene. This protein plays a role in both vitamin transport and actin polymerization. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C84254 Vitamin D-Binding Protein Vitamin_D3_Receptor Vitamin D3 Receptor Vitamin D Hormone Receptor Protein Phosphatase 1, Regulatory Subunit 163 Vitamin D Receptor Cholecalciferol Receptor Calcitriol Receptor Nuclear Receptor Subfamily 1 Group I Member 1 1,25-Dihydroxyvitamin D3 Receptor Receptors, Calcitriol NR1I1 VDR Vitamin D3 receptor (427 aa, ~48 kDa) is encoded by the human VDR gene. This protein is involved in vitamin D-mediated transcriptional regulation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C17485 Vitamin D3 Receptor Vitamin_K-Dependent_Protein_C Blood Coagulation Factor XIV Anticoagulant Protein C Autoprothrombin IIA Vitamin K-Dependent Protein C EC 3.4.21.69 PROC Protein C Vitamin K-dependent protein C (461 aa, ~52 kDa) is encoded by the human PROC gene. This protein is involved in the degradation of factors Va and VIIIa. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C102826 Vitamin K-Dependent Protein C Voriconazole (2R,3S)-2-(2,4-Difluorophenyl)-3-(5-fluoropyrimidin-4-yl)-1-(1,2,4-triazol-1-yl)butan-2-ol VORICONAZOLE voriconazole Voriconazole Vfend A synthetic triazole with antifungal activity. Voriconazole selectively inhibits 14-alpha-lanosterol demethylation in fungi, preventing the production of ergosterol, an essential constituent of the fungal cell membrane, and resulting in fungal cell lysis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C1707 Voriconazole WAP_Four-Disulfide_Core_Domain_Protein_2 Putative Protease Inhibitor WAP5 WAP Four-Disulfide Core Domain Protein 2 WAP Domain Containing Protein HE4-V4 Major Epididymis-Specific Protein E4 Epididymis-Specific Whey-Acidic Type Four-Disulfide Core Protein Epididymal Protein 4 Epididymal Secretory Protein E4 Human Epididymis Protein 4 EP4 HE4 WFDC2 EDDM4 WAP four-disulfide core domain protein 2 (124 aa, ~13 kDa) is encoded by the human WFDC2 gene. This protein may play a role in both proteinase inhibition and spermatogenesis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20893 WAP Four-Disulfide Core Domain Protein 2 WFDC2_Gene WAP Four-Disulfide Core Domain 2 Gene WFDC2 WFDC2 Gene HE4 EDDM4 This gene plays a putative role in epithelial host defense. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C20891 WFDC2 Gene Warfarin 3-(Alpha-acetonylbenzyl)-4-hydroxycoumarin 4-Hydroxy-3-(3-oxo-1-phenylbutyl)-2H-1-benzopyran-2-one 3-Alpha-phenyl-beta-acetylethyl-4-hydroxycoumarin Compound 42 WARF Compound 42 3-(.alpha.-Acetonylbenzyl)-4-hydroxycoumarin WARF compound 42 3-(.alpha.-Phenyl-.beta.-acetylethyl)-4-hydroxycoumarin 1-(4'-Hydroxy-3'-coumarinyl)-1-phenyl-3-butanone Co-Rax Rodex WARFARIN Warfarin warfarin A synthetic anticoagulant. Warfarin inhibits the regeneration of vitamin K1 epoxide and so the synthesis of vitamin K dependent clotting factors, which include Factors II, VII, IX and X, and the anticoagulant proteins C and S. This inhibition results in a sequential depression of Factors VII, IX, X and II activities. Vitamin K is an essential cofactor for the post ribosomal synthesis of the vitamin K dependent clotting factors. The vitamin promotes the biosynthesis of gamma-carboxyglutamic acid residues in these proteins which are essential for biological activity. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C945 Warfarin XDH_Gene Xanthine Dehydrogenase Gene XDH XDH Gene This gene plays a role in the oxidative metabolism of purines. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C39590 XDH Gene ZFAS1 ZFAS1 long non-coding RNA, human long non-coding RNA ZFAS1, human http://purl.bioontology.org/ontology/MESH/C000611949 ZFAS1 ZFAS1_Gene HSUP2 NCRNA00275 ZNFX1-AS1 C20orf199 HSUP1 ZFAS1 http://purl.obolibrary.org/obo/OGG_3000441951 ZFAS1 Gene ischemia-modified_albumin serum albumin, ischemia-modified ischemia-modified serum albumin albumin, ischemia-modified IMA http://purl.bioontology.org/ontology/MESH/C561522 Ischemia-modified Albumin leukotriene_C4_synthase leukotriene C4 synthase LTC4S LTC4S Gene Other designations: LTC4 synthase http://purl.obolibrary.org/obo/OGG_3000004056 LTC4S Gene (10E)-12-oxododec-10-enoic acid 12-Oxo-dodec-10t-ensaeure Delta(10)-ODA 12-oxo-10t-12:1 (10E)-12-Oxododecenoic acid 12-oxo-(E)-10-dodecenoic acid 12-oxo-10t-C12:1 (E)-12-oxododec-10-enoic acid 12-oxo-trans-dodec-10-enoic acid traumatin 12-oxo-10E-dodecenoic acid 12-oxo-dodec-10t-enoic acid A monounsaturated fatty acid comprising dodecanoic acid having a trans-double bond at the 10-position and a 12-oxo group. http://purl.obolibrary.org/obo/CHEBI_19144 12-oxo-trans-10-dodecenoic acid Apolipoprotein(a) Antiangiogenic AK38 Protein EC 3.4.21.- Apo(a) LPA Lp(a) Apolipoprotein(a) (4548 aa, ~501 kDa) is encoded by the human LPA gene. This protein is involved in the regulation of thrombosis and lipid metabolism. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C140118 Apolipoprotein(a) Dihydroxyphenylalanine,(+-)-3-(3,4-Dihydroxyphenyl)alanine,DL-3,4-Dopa,(+-)-Dopa DOPA, DL- Dopa, DL- Dopamine The racemic mixture of the precursor of dopamine L-DOPA (levodopa) and D-DOPA, with antiparkinsonian properties. L-DOPA is converted to dopamine by DOPA decarboxylase and can cross the blood-brain barrier (BBB). When in the brain, levodopa is decarboxylated to dopamine and stimulates the dopaminergic receptors, thereby compensating for the depleted supply of endogenous dopamine seen in Parkinson's disease. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C81078 Dopamin, DL- Fatty Acid-Binding Protein 2 Intestinal-Type Fatty Acid-Binding Protein Fatty Acid-Binding Protein, Intestinal Fatty Acid Binding Protein 2, Intestinal FABP2 FABPI I-FABP Fatty acid-binding protein, intestinal (132 aa, ~15 kDa) is encoded by the human FABP2 gene. This protein plays a role in binding to saturated long-chain fatty acids with a high affinity and to unsaturated long-chain fatty acids with less affinity. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C29616 Fatty Acid-Binding Protein, Intestinal Fibroblast Activation Protein, Alpha FAP FAPA A protein encoded by FAP gene. http://purl.bioontology.org/ontology/OMIM/600403 Fibroblast Activation Protein, Alpha FL-aa-7 GTPase, IMAP family member 7 IMAP family member 7 GIMAP7 A protein encoded by GIMAP7 gene. http://purl.bioontology.org/ontology/MESH/C520502 GTPase, IMAP Family Member 7 Glutathione Reductase Glutathione-Disulfide Reductase Glutathione Reductase, Mitochondrial Glutathione S-Reductase Epididymis Luminal Protein 75 Epididymis Secretory Sperm Binding Protein Li 122m EC 1.8.1.7 GR GRase GSR Glutathione reductase, mitochondrial (522 aa, ~56 kDa) is encoded by the human GSR gene. This protein plays a role in the synthesis of the sulfhydryl form of glutathione. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C157042 Glutathione Reductase, Mitochondrial Macrophage Inhibitory Cytokine-1 Placental TGF-Beta Prostate Differentiation Factor Prostate-Derived Factor Macrophage Inhibitory Cytokine 1 NSAID-Regulated Protein 1 NSAID-Activated Protein 1 Placental Bone Morphogenic Protein NSAID-Regulated Gene 1 Protein Nonsteroidal Anti-Inflammatory Drug-Activated Protein 1 Growth/Differentiation Factor 15 Macrophage-Inhibiting Cytokine 1 NSAID-Activated Gene 1 Protein NSAID (Nonsteroidal Anti-Inflammatory Drug)-Activated Protein 1 GDF-15 GDF15 MIC1 NAG-1 NAG1 NRG-1 NRG1 PDF PTGF-Beta PTGFB Growth/differentiation factor 15 (308 aa, ~34 kDa) is encoded by the human GDF15 gene. This protein plays a role in both tissue differentiation and signal transduction. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C34026 Growth/Differentiation Factor 15 HLA Class I Histocompatibility Antigen, Alpha Chain G b2 Microglobulin MHC Class I Antigen G HLA G Antigen HLA-G HLA class I histocompatibility antigen, alpha chain G (338 aa, ~38 kDa) is encoded by the human HLA-G gene. This protein is involved in the mediation of antigen presentation and processing. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C104327 HLA Class I Histocompatibility Antigen, Alpha Chain G Long QT Intronic Transcript 1 Non-Protein Coding RNA 12 KCNQ1 Opposite Strand/Antisense Transcript 1 KCNQ1 Antisense RNA 2 KCNQ1 Overlapping Transcript 1 KCNQ1OT1 LIT1 NCRNA00012 KCNQ1 opposite strand/antisense transcript 1 (~92 kb) is encoded by the human KCNQ1OT1 gene. This non-coding RNA plays a role in epigenetic processes. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C114318 KCNQ1 Opposite Strand/Antisense Transcript 1 Cell Proliferation-Inducing Protein 46 Keratin, Type I Cytoskeletal 18 Cell Proliferation-Inducing Gene 46 Protein Cytokeratin 18 Cytokeratin-18 CK-18 K18 KRT18 Keratin-18 Keratin, type I cytoskeletal 18 (430 aa, ~48 kDa) is encoded by the human KRT18 gene. This protein plays a role in both intermediate filament structure and the inhibition of apoptosis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C111868 Keratin, Type I Cytoskeletal 18 Cold Autoinflammatory Syndrome 1 Protein NACHT, LRR and PYD Domains-Containing Protein 3 Angiotensin/Vasopressin Receptor AII/AVP-Like PYRIN-Containing APAF1-Like Protein 1 Cryopyrin NLRP3 NACHT, LRR and PYD domains-containing protein 3 (1034 aa, ~118 kDa) is encoded by the human NLRP3 gene. This protein plays a role in the modulation of both inflammation and apoptosis. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C77204 NACHT, LRR and PYD Domains-Containing Protein 3 SIR2-Like Protein 3 NAD-Dependent Deacetylase Sirtuin-3, Mitochondrial EC 3.5.1.- SIRT3 hSIRT3 NAD-dependent deacetylase sirtuin-3, mitochondrial (399 aa, ~44 kDa) is encoded by the human SIRT3 gene. This protein plays a role in the deacetylation of proteins. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C95591 NAD-Dependent Deacetylase Sirtuin-3, Mitochondrial NORADRENALINE, (+/-)- (+/-)-Noradrenaline Noradrenaline Norepinephrine (.+-.)-Norepinephrine (.+-.)-Noradrenaline 1,2-benzenediol, 4-(2-amino-1-hydroxyethyl)-, (+/-)- Norepinephrine, DL- norepinephrine noradrenaline Arterenol A synthetic phenylethylamine that mimics the sympathomimetic actions of the endogenous norepinephrine. Norepinephrine acts directly on the alpha- and beta-adrenergic receptors. Clinically, norepinephrine is used as a peripheral vasoconstrictor that causes constriction of arterial and venous beds via its alpha-adrenergic action. It is also used as a potent inotropic and chronotropic stimulator of the heart mediated through its beta-1 adrenergic action. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C62098 Norepinephrine, DL- Phospholipase A2, Membrane Associated Phosphatidylcholine 2-Acylhydrolase Phospholipase A2, Group IIA Group IIA Phospholipase A2 Non-Pancreatic Secretory Phospholipase A2 Phospholipase A2 Group IIA Membrane Associated Phospholipase A2 Phosphatidylcholine 2-Acylhydrolase 2A Phospholipase A2 Polypeptide B EC 3.1.1.4 GIIC sPLA2 NPS-PLA2 PLA2B PLA2G2A PLA2L PLA2S PLAS1 Phospholipase A2, membrane associated (144 aa, ~16 kDa) is encoded by the human PLA2G2A gene. This protein plays a role in the metabolism of phospholipids. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C34063 Phospholipase A2, Membrane Associated Posterior Pituitary Hormones Pituitrin A substance or extract from the neurohypophysis (PITUITARY GLAND, POSTERIOR). http://purl.bioontology.org/ontology/MESH/D010909 Pituitary Hormones, Posterior Serum Paraoxonase/Arylesterase 1 Arylesterase B-Type Serum Aryldiakylphosphatase Paraoxonase B-Type EC 3.1.1.81 A-Esterase 1 Aromatic Esterase 1 Serum Aryldialkylphosphatase 1 EC 3.1.1.2 EC 3.1.8.1 Esterase A K-45 PON 1 PON1 Serum paraoxonase/arylesterase 1 (355 aa, ~40 kDa) is encoded by the human PON1 gene. This protein plays a role in the catabolism of aromatic carboxylic acid esters, organophosphates and lactones. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C116049 Serum Paraoxonase/Arylesterase 1 Signal Peptide, CUB and EGF-like Domain-containing Protein 1 SCUBE1 A protein coding gene SCUBE1 in human. http://purl.obolibrary.org/obo/HGNC_13441 Signal Peptide, CUB and EGF-like Domain-containing Protein 1 Cardiac Troponin I Troponin I, Cardiac Muscle TNNI3 cTnI Troponin I, cardiac muscle (210 aa, ~24 kDa) is encoded by the human TNNI3 gene. This protein is involved in muscle filament movement in cardiac cells. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C104226 Troponin I, Cardiac Muscle Xanthine Oxidase EC 1.1.3.22 Xanthine Dehydrogenase/Oxidase Xanthine Dehydrogenase Xanthine Oxidoreductase EC 1.1.1.204 XD XDH XO XOR Xanthine dehydrogenase/oxidase (1333 aa, ~146 kDa) is encoded by the human XDH gene. This protein is involved in purine degradation. http://ncicb.nci.nih.gov/xml/owl/EVS/Thesaurus.owl#C39587 Xanthine Dehydrogenase/Oxidase